Tìm hiểu cấu trúc DNA

Download miễn phí Tìm hiểu cấu trúc DNA





ª Đặc điểm

-Xoắn phải (Hình ảnh các

bậc thang xoắn ốc)

-Khung deoxyribose-phosphat

ở ngoài

-Các base hướng vào trục

xoắn kép

 





Để tải tài liệu này, vui lòng Trả lời bài viết, Mods sẽ gửi Link download cho bạn ngay qua hòm tin nhắn.

Ket-noi - Kho tài liệu miễn phí lớn nhất của bạn


Ai cần tài liệu gì mà không tìm thấy ở Ket-noi, đăng yêu cầu down tại đây nhé:
Nhận download tài liệu miễn phí

Tóm tắt nội dung tài liệu:


CẤU TRÚC DNA ĐẠI CƯƠNG DNA : DeoxyriboNucleic Acid DNA:- Vật liệu thông tin di truyền - Tổng hợp protein Truyền tải thông tin di truyền - Sự tái bản (Replication) - Sự phiên mã (Transcription) - Sự dịch mã (Translation) - Sự phiên mã ngược (Reverse Transcription) THÀNH PHẦN CẤU TẠO DNA NUCLEOTID NUCLEOTID = Base + ose + acid phosphoric Base : Pyrimidine : Cytosin (C), Thymin (T) Purin : Adenin (A), Guanin (G) BASE PYRIMIDIN BASE PURIN CÁC OSE ACID PHOSPHORIC LIÊN KẾT CÁC THÀNH PHẦN CỦA MÔÏT NUCLEOTID Liên kết Ose - Base Liên kết Este LIÊN KẾT OSE-ACID PHOSPHORIC Liên kết este NUCLEOTID - NUCLEOSID NUCLEOSID = Base + ose NUCLEOTID=Nucleosid+acid phosphoric LIÊN KẾT GIỮA CÁC NUCLEOTID TRONG DNA hydro CẤU TRÚC DNA Nhiều nucleotid nối lại với nhau bằng liên kết este = 1 chuỗi polynucleotid 2 chuỗi polynucleotid nối với nhau bằng liên kết Hydro  DNA Liên kết hydro : kém bền vững theo từng cặp base cố định : - adenin-thymin - guanin-cytosin LIÊN KẾT HYDRO GIỮA ADENIN VÀ THYMIN LIÊN KẾT HYDRO GIỮA GUANIN VÀ CYTOSIN ĐẶC ĐIỂM 2 CHUỖI POLYNUCLEOTID CỦA DNA Đối song (Antiparallel) Bổsung(Complementary) Hình xoắn( Helix) CÁC BẬC CẤU TRÚC CỦA DNA Các polymer Các polymerase Trình tự sắp xếp cố định các nucleotid Khác nhau giữa mọi cá thể Cấu trúc bậc một CẤU TRÚC XOẮN KÉP CỦA DNA 1953 : Watson & Crick James Watson (1928-) Francis Crick (1916-) CẤU TRÚC XOẮN KÉP CỦA DNA Đặc điểm -Xoắn phải (Hình ảnh các bậc thang xoắn ốc) -Khung deoxyribose-phosphat ở ngoài -Các base hướng vào trục xoắn kép DẠNG SIÊU XOẮN CỦA DNA (Supercoiled) Các Topoisomer - Trục chuỗi xoắn kép tự cuộn quanh mình nhiều vòng  cấu trúc siêu xoắn - Enzyme dễ tác động lên DNA trong quá trình tái bản - Thu gọn thể tích DNA/nhân DẠNG SIÊU XOẮN CỦA DNA (Nhìn dưới kính hiển vi) TOPOISOMERASE Enzyme dùng gỡ xoắn Biến cấu trúc topoisomer thành polymer Tạo thuận lợi tách 2 chuỗi polynucleotid TÓM TẮT CẤU TRÚC PHÂN TỬ DNA Nucleotid (Base + Deoxyribose + H3PO4) Nhiều nucleotid nối nhau = chuỗi polynucleotid Liên kết hydro kém bền vững giữa 2 chuỗi polynucleotid của DNA Cấu trúc xoắn kép (dạng polymer) Cấu trúc siêu xoắn (dạng Topoisomer) Topoisomerase : các men tháo vòng (gỡ xoắn) NHIỄM SẮC THỂ DNA Quấn quanh histon Nucleosom Sợi nhiễm sắc(chromatin) Nhiễm sắc tử Nhiễm sắc thể GEN - Gen : đơn vị cơ bản của di truyền, là một đoạn nhiễm sắc thể mã hóa một chuỗi polynucleotid hay một phân tử RNA. Cấu trúc một gen Exons : chứa thông tin di truyền dịch mã thành protein Introns : nằm xen kẽ với các exons không chứa thông tin di truyền không dịch mã thành protein EXON - INTRON GEN Gen người là gen không liên tục. Trình tự DNA toàn phần của một sinh vật, chứa toàn bộ thông tin di truyền của DNA gọi là bộ gen hay bản đồ gen (genome). Bộ gen người : 100.000 gen LIÊN HỆ GEN VÀ UNG THƯ ONCOGEN: Gen có khả năng sinh ung thư. Nắm mã sản xuất các protein bất thường. Hậu quả: Tế bào trở nên độc lập với các yếu tố tăng trưởng. ONCOGEN Protein bất thường đóng vai trò: Yếu tố tăng trưởng tế bào. Thụ thể yếu tố tăng trưởng. Dẫn truyền thông tin lệch lạc từ ngoài vào trong tế bào PROTO-ONCOGEN Tiền oncogen: Dạng chưa bị biến đổi , chưa bị hoạt hóa của oncogen, hiện diện trong tế bào bình thường. Khi bị hoạt hóa proto-oncogen sẽ chuyển thành oncogen. GEN ĐÈ NÉN Nắm mã tổng hợp các protein kiểm soát sự tăng trưởng tế bào: Ngừng chu trình tế bào. Chết được lập trình của tế bào ( Apoptosis) GEN ĐÈ NÉN Gen Rb: Nhánh dài NST 13 Mã hóa protein p105,ức chế chu trình tế bào. Đột biến Rb: Rétinoblastome. K vú, phổi, sarcôm xương... GEN ĐÈ NÉN GEN p53: Nhánh ngắn NST 17. Mã hóa protein 21(53 kDa), làm ngừng chu trình tế bào ở G1nhằm: Sửa chữa DNA. Chết được lập trình của tế bào. Đột biến p53: ung thư phổi, vú, buồng trứng,bọng đái... GEN ĐÈ NÉN BRCA 1: Nhánh dài NST 13. Mã hóa bởi 5592 cặp nucleotid . Tổng hợp 1 protein chứa 1864 acid amin. Đột biến BRCA 1: 85% ung thư vú 25-65% ung thư buồng trứng. GEN ĐÈ NÉN BRCA 2: Nhánh dài NST 13 Mã hóa bởi 10.254 nucleotid. Tổng hợp 1 protein chứa 3418 acid amin. Đột biến BRCA 2: 85% ung thư vú. Ung thư tụy, tiền liệt tuyến, dạ dày... GEN “NHẢY” Lịch sử: Barbara M. Clintock( Nobel 1983) Nghiên cứu sự thay đổi màu sắc của quả bắp Aán Độ”yếu tố di truyền di động”hay gen “nhảy”. Gen “nhảy” Transposon: Gen có khả năng chuyển vị trên 1 NST hay “nhảy” từ NST này qua NST khác, hay từ tế bào này sang tế bào khác. Vị trí của gen trên NST quyết định biểu hiện thông tin di truyền của tế bào. MÃ DI TRUYỀN (CODON) 1 Codon = 3 nucleotid liên tiếp mã hóa một acid amin, ví dụ : AUG : Met, GCC : Ala 64 codon : 61 codon mã hóa acid amin 3 codon stop (UAA, UAG, UGA) =mã kết thúc. 22 acid amin  nhiều codon khác nhau mã hóa cùng 1 acid amin Ngoại lệ : Met và Trp : chỉ được mã hóa bởi 1 codon SỰ ĐỘT BIẾN Biến cố bất thường trong quá trình sao chép các Base của DNA Tái bản : giai đoạn xảy ra đột biến nhiều nhất Phiên mã : đột biến của mRNA Dịch mã CÁC LOẠI ĐỘT BIẾN Đột biến “thầm lặng” (Mutation “Silencieuse”) 1 codon này bị thay thế bằng 1 codon khác Codon mới mã hóa cùng 1 acid amin Ví dụ : Codon UUU bị thay bằng codon UUC Cả 2 codon đều mã hóa cho Phe Không gây bệnh lý CÁC LOẠI ĐỘT BIẾN Đột biến “bảo tồn” (Mutation “conservatrice”) Codon mới mã hóa 1 acid amin khác nhưng cùng nhóm acid amin (gốc Base hay gốc Acid) Ví dụ : Codon AAA (Lys) bị đột biến thành AGA (Arg) Lys và Arg cùng nhóm acid amin (gốc Base) Không gây bệnh lý CÁC LOẠI ĐỘT BIẾN Đột biến “sai hướng” (Mutation “faux sens”) Codon mới mã hóa 1 acid amin khác nhưng khác nhóm ví dụ: Codon AAG (Lys) bị đột biến thành GAG (Glu) Lys : acid amin gốc Base Glu : acid amin gốc acid Bệnh lý CÁC LOẠI ĐỘT BIẾN Đột biến Intron Đột biến ở chỗ nối : Exon-Intron Bên trong Intron : hiếm gặp Bệnh lý do không cắt nối Exon-Intron trong quá trình tổng hợp mRNA CÁC LOẠI ĐỘT BIẾN Đột biến theo kiểu khiếm khuyết base Đoạn polynucleotid của DNA : AUGGCCUCUAACCAUGGCAUA AUG GCC UCU ACC CAU GGC AUA Met Ala Ser Asn His Gly ILe Đột biến mất 1 base ở vị trí thứ 4 AUG CCU CUA ACC AUG GCA UA Met Pro Leu Thr Met Ala Tiếp tục đột biến mất 1 base ở vị trí thứ 4 AUG CUC UAA CCA UGG CAU A Met Leu stop BIỂU HIỆN ĐỘT BIẾN DNA TRÊN GEN Khuếch đại gen Khiếm khuyết gen Chuyển vị gen Ghép đoạn gen Đảo đoạn gen SỬA CHỮA DNA TỔN THƯƠNG DNA DO HÓA TRỊ Tổn thương DNA thông qua quá trình chống biến dưỡng - Ức chế men Methotrexate 5-FU Cytosine arabinoside ỨC CHẾ TOPOISOMERASE Ức chế topoisomerase 1: Các Taxane, Topotecan, Camptothecine. Ức chế topoisomerase 2: Podophyllotoxin( Etoposide, Vepeside) TỔN THƯƠNG DNA BẰNG CÁCH TẠO NỐI CHÉO Gắn chặt 2 chuỗi polynucleotid Alkylant (Endoxan) TỔN THƯƠNG DNA DO XẠ TRỊ Mất một nucleotid Mất một base Đứt đoạn 1 chuỗi polynucleotid Đứt đoạn 2 chuỗi polynucleotid Tạo cầu nối dính chặt 2 chuỗi polynucleotid Biến đổi cấu trúc các base John E. Sulston ...

Music ♫

Copyright: Tài liệu đại học ©