Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function - Pdf 10

The Saccharomyces cerevisiae vacuolar acid trehalase is
targeted at the cell surface for its physiological function
Susu He
1,2,3
, Kerstin Bystricky
4,5
, Sebastien Leon
6
, Jean M. Franc¸ois
1,2,3
and Jean L. Parrou
1,2,3
1 University of Toulouse, INSA, UPS, INP & INRA, France
2 INRA-UMR 792 Inge
´
nierie des Syste
`
mes Biologiques et proce
´
de
´
s, Toulouse, France
3 CNRS-UMR 5504, Toulouse, France
4 Laboratoire de Biologie Mole
´
culaire Eucaryote, University of Toulouse, France
5 CNRS-UMR5099, Toulouse, France
6 Institut Jacques Monod, UMR7592 CNRS ⁄ Universite
´
Paris Diderot, France
Introduction

INSA, UPS, INP & INRA, 135, Avenue de
Rangeuil, F-31077, Toulouse, France
Fax: +33 5 6155 9400
Tel: +33 5 6155 9492
E-mail: [email protected]
(Received 6 May 2009, revised 9 June
2009, accepted 21 July 2009)
doi:10.1111/j.1742-4658.2009.07227.x
Previous studies in the yeast Saccharomyces cerevisiae have proposed a vac-
uolar localization for Ath1, which is difficult to reconcile with its ability to
hydrolyze exogenous trehalose. We used fluorescent microscopy to show
that the red fluorescent protein mCherry fused to the C-terminus of Ath1,
although mostly localized in the vacuole, was also targeted to the cell sur-
face. Also, hybrid Ath1 truncates fused at their C-terminus with the yeast
internal invertase revealed that a 131 amino acid N-terminal fragment of
Ath1was sufficient to target the fusion protein to the cell surface, enabling
growth of the suc2D mutant on sucrose. The unique transmembrane domain
appeared to be indispensable for the production of a functional Ath1, and
its removal abrogated invertase secretion and growth on sucrose. Finally,
the physiological significance of the cell-surface localization of Ath1 was
established by showing that fusion of the signal peptide of invertase to
N-terminal truncated Ath1 allowed the ath1D mutant to grow on trehalose,
whereas the signal sequence of the vacuolar-targeted Pep4 constrained Ath1
in the vacuole and prevented growth of this mutant on trehalose. Use of
trafficking mutants that impaired Ath1 delivery to the vacuole abrogated
neither its activity nor its growth on exogenous trehalose.
Abbreviations
EndoH, endoglycosidase H; GH, glycolsyl hydrolase; GP, green fluorescent protein; MVB, multivesicular body; TM, transmembrane.
5432 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS
centrifugation of a yeast protoplast preparation. The

localization of Ath1 at the cell periphery is required
for growth on trehalose, whereas the vacuolar localiza-
tion of this protein is not compatible with growth on
this carbon source.
Results
Ath1 is localized at the cell periphery
In a previous report, the localization of S. cerevisiae
Ath1 was visualized using a pGFPATH1 construct
that expressed a GFP fused to the N-terminus of Ath1
under the strong TPI1 promoter [12]. We obtained a
comparable result with a GFP–Ath1 construct that
was expressed under the control of the methionine-
repressible MET25 promoter in a glucose medium
lacking methionine (Fig. 1A). However, western blot-
ting using a GFP antibody on extracts from cells
expressing GFP–Ath1 revealed a major band migrating
at a position corresponding to  30 kDa, instead of
bands migrating at > 150 kDa (Fig. 1B). Fluorescence
in the vacuole may therefore be caused by free GFP
which accumulated in this organelle because it has
been reported that targeting of GFP-fusion proteins to
the vacuolar lumen leads to their degradation by vacu-
olar proteases. However, this degradation process is
usually delayed, leading to the transient accumulation
of GFP-containing proteolytic fragments of  30 kDa,
and a sustained luminal vacuolar fluorescence [16].
Note that a similar result was reported by Huang et al.
[12], although they were also able to detect a band
corresponding to the native GFP–Ath1.
This proteolytic problem, coupled with the fact that

treatment, the glycosylation that was reported for this
protein [7] may explain this migration property at an
apparent size much higher than expected. However,
the expected band at a size of 164 kDa
(Ath1 + mCherry) was barely detected upon EndoH
treatment, and instead, a relatively strong band migrat-
ing at around 65 kDa could be identified (Fig. 1E).
As a second, independent way to support the locali-
zation of Ath1 at the cell periphery, we used the
invertase secretion system. Invertase is a secreted pro-
tein with a classical signal peptide at its N-terminus
(amino acids 1–19) for secretion at the cell periphery.
S. He et al. Functional localization of Ath1 in S. cerevisiae
FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5433
Deletion of this signal peptide (suc2
ic
allele) prevents
secretion and results in the accumulation of the trun-
cated form of the enzyme in the cell, impairing the
ability of S. cerevisiae to grow on sucrose or raffinose
as the sole carbon source. We generated an inframe
fusion of full-length ATH1 and suc2
ic
(pSC1–ATH1),
leading to the chimeric Ath1–Suc2 protein expressed
under the ATH1 promoter. As shown in Fig. 2, suc2D
mutant expressing this gene construct recovered
growth on sucrose, like the positive control expressing
the full-length secreted invertase under its own pro-
moter (pLC1), whereas suc2D mutant transformed with

Fig. 2. Complementation of the S. cerevisiae SEY6210 strain (suc2D mutant) with different Ath1–invertase chimera. (A) Schematic representa-
tion of the different gene fusion constructs. pSC1, negative control (invertase without signal peptide); pLC1, positive control (full-length invertase);
for the remaining constructs, the Suc2 signal peptide has been replaced by full-length ATH1 sequence (pSC1–ATH1) or N-terminal sequence
variants of ATH1 with decreasing size; (B) growth on YP medium with sucrose (complementation test) or glucose (control) for 5 days.
Functional localization of Ath1 in S. cerevisiae S. He et al.
5434 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS
Replacing the ATH1 promoter in pSC1–ATH1 with
the stronger SUC2 promoter resulted in an invertase
activity similar to that in pLC1 (data not shown). We
noticed that the invertase activity in a crude extract of
cells transformed with pLC1 was lower than that in
intact cells. This may be caused by incomplete lysis of
the cells or partial denaturation of proteins during
extraction and vortexing with glass beads
In addition to the cell biology data, we also revali-
dated our enzymatic assay of acid trehalase. Our cur-
rent method is based on the measurement of the
activity in intact cells according to the procedure
employed to measure secreted invertase [17], in which
NaF is added to the incubation mixture to block glu-
cose uptake. We verified that the use of NaF did not
cause any enzymatic artifact, for example, cell lysis or
the release of intracellular glucose. First, incubation of
intact cells from an exponential culture grown on
glucose that do not express acid trehalase because of
glucose repression [18] in a reaction mixture optimal
for neutral trehalase activity and containing NaF did
not lead to any glucose production from trehalose
(data not shown). This excluded the possibility of cell
leakage and the release of proteins or intracellular glu-

to the first 69 amino acids of Ath1, which includes the
TM domain, and pSC1–tm that only bears the first 46
amino acids of Ath1 excluding the TM domain, were
introduced into the suc2D mutant SEY6210. Transfor-
mants were tested for growth recovery on sucrose
(Fig. 2B) and for invertase activity (Fig. 3). As shown
in Fig. 2B, suc2D mutant cells transformed with pSC1–
N or pSC1–TM were able to grow on YP sucrose as
readily as pSC1–ATH1, whereas cells transformed with
pSC1–tm poorly grew on sucrose, as did cells bearing
the negative control pSC1.
Invertase activity was measured in intact cells and
crude extracts from suc2D mutant transformed with
these various constructs, compared with growth effi-
ciency on sucrose (Figs 2 and 3). Cells transformed
with pSC1–N showed an activity nearly twofold higher
than that in cells expressing a fusion to the full-length
Ath1 (pSC1–ATH1). One explanation might be that
the full size Ath1 fused to internal invertase somehow
Fig. 3. Invertase activity in the S. cerevisiae SEY6210 strain (suc2D
mutant) transformed with the various Ath1–invertase constructs.
The constructs are those shown in Fig. 2. Transformed cells were
cultivated in YP sucrose medium until the stationary phase before
measurement of invertase activity on intact cells and in crude
extract as described in Experimental procedures. Histograms show
the results of two independent experiments (mean ± SD).
Fig. 4. Ath1 predicted functional domain using the SMART program.
Theoretical glycosylation sites (yellow triangles); N-terminal trans-
membrane segment (TM); N-term (GH_65N), central (GH_65m) and
C-term (GH_65C) domains from the CAZy glycoside hydrolase

fragment by using a mCherry fusion that was
expressed under the control of the ATH1 promoter
(pN–mCherry). Figure 5A shows a fluorescent signal
at the cell periphery and a stronger signal in the vacu-
ole, similar to that observed using full-length Ath1
fused to mCherry (compare Figs 5A and 1D). This
result confirmed that the N-terminal part of Ath1 was
sufficient to target the recipient protein to these two
cellular compartments.
Reciprocally, we analyzed the consequences of delet-
ing the first 100 codons of the ATH1 sequence
(path1DN) on red protein localization. When expressed
in a wild-type strain grown on trehalose, the Ath1DN–
mCherry fusion protein led to a fluorescent signal
exclusively in the vacuole (Fig. 5B). No discernable
signal could be detected at the cell periphery, even
after 10-fold longer exposure times. From this result,
we first verified that a BYath1D mutant transformed
with the centromeric plasmid pATH1 carrying the
wild-type ATH1 gene recovered wild-type characteris-
tics, i.e. growth on trehalose as the sole carbon source
(not shown), and acid trehalase activity in both intact
cells and cell crude extracts (Fig. 6). However, when
this ath1D mutant was transformed by path1DN it was
not able to grow on trehalose (data not shown) and
had no Ath1 activity (Fig. 6). From these data, we
were able to confirm that the 131 amino acid N-termi-
nal fragment contains important information for
cell-surface targeting, and we suggest that there may
be vacuolar targeting determinants in the catalytic

periphery could restore trehalase activity. We made
use of the invertase secretion property by fusing the
signal peptide of this protein to the N-terminus of the
Ath1DN variant Fig. 7A). When transformed in ath1D
mutant cells, the resulting plasmid pSPSUC2–
ATH1DN did allow recovery of the growth ability on
trehalose and the acid trehalase activity in both cell
crude extract and intact cells (Fig. 6). Moreover, the
ath1D mutant strain bearing this plasmid grew about
two times faster than wild-type BY4741 strain on syn-
thetic trehalose medium (l = 0.10 versus 0.047;
Fig. 8). Localization of this hybrid protein was verified
by C-terminal fusion to mCherry. Setting our exposure
time as in Fig. 1, we found that the intensity of the
fluorescent signal at the cell periphery was significantly
higher than that of the full-length Ath1–mCherry pro-
tein (compare Figs 7B and 1D). However, the bulk of
the fluorescent signal still resided in the vacuolar com-
partment, which substantiated the idea that the cata-
lytic domain of Ath1 contains some targeting signal
for the vacuole. Using western blot analysis, we found
a 65kDa proteolytic fragment that was already
obtained with the Ath1–mCherry fusion protein
(Fig. 1C), but also a clearly detectable band corre-
sponding to the SPSuc2–Ath1DN–mCherry chimeric
protein after EndoH treatment (173 kDa, Fig. 7C),
indicating better stability for this construct than for
native Ath1. Overall, these results suggest that secre-
tion of Ath1 at the cell periphery is associated with the
stabilization and physiological function of this protein.

giving the SPSUC2–Ath1DN and SPPEP4–
Ath1DN chimeras. (Panel II) BY4741 cells
were transformed with pSPSUC2–ath1DN–
mCherry and cultivated in YN trehalose
medium. Exponential growing cells were
collected for live cell microscopy (B), and
immunoblot on crude extract before ()) and
after (+) deglycosylation with EndoH using
DsRed polyclonal antibody (C). (D) BY4741
cells transformed with pSPPEP4–ath1DN–
mCherry were collected for live cell micros-
copy. M, molecular mass markers; arrow-
head, expected full-length fusion protein;
asterisk, degradation product.
S. He et al. Functional localization of Ath1 in S. cerevisiae
FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5437
vacuolar pool of acid trehalase has no role in trehalose
assimilation for cell growth.
As a complementary approach, we used mutants of
genes involved in the vacuolar sorting pathway, like
VPS4 which encodes a protein implicated in the deliv-
ery of proteins from the prevacuolar compartment to
the vacuole [25]. As shown in Fig. 9A, the intracellular
red fluorescent signal derived from Ath1–mCherry was
totally mislocalized in a vps4D mutant, being com-
pletely excluded from the lumen of vacuole. However,
the fluorescent signal at the cell periphery was still visi-
ble in this vps4D mutant and the relative Ath1 activity
between intact cells and crude extract was identical to
that of wild-type cells (Fig. 9B). The presence of the

BY4741 ath1D mutant strain expressing the catalytic domain of
Ath1 (amino acids 301 to 1211) fused to signal sequence of Suc2
and Pep4, respectively, were transferred in YN trehalose medium
to evaluate growth complementation. BY4741, positive control;
ath1D, negative control.
Fig. 9. Localization and activity of Ath1 in
vps4D mutant. Cells cultivated in YN treha-
lose medium to the exponential phase were
collected for live cell microscopy (A), and to
test the activity of acid trehalase in intact
cells or cell crude extracts (B), as described
in Experimental Procedures. Histograms
show the results of two independent experi-
ments (mean ± SD). (C) Crude extract from
vps4D cells expressing Ath1–mCherry
immunoblotted with the DsRed polyclonal
antibody, before ()) and after (+)
deglycosylation with EndoH. M, molecular
mass markers. Bar = 2 lm.
Functional localization of Ath1 in S. cerevisiae S. He et al.
5438 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS
fusion and in its truncated variant, respectively. When
transformed in suc2D mutant, these constructs did not
restore growth on sucrose or invertase activity
(Fig. 10A). Similarly, when using BYath1D mutant as
a recipient strain for functional complementation by
various Ath1 variants, the plasmid path1DTM, which
expressed an Ath1 protein lacking the TM domain,
was not able to complement growth deficiency of this
mutant on trehalose or yield measurable Ath1 activity

early steps of endoplasmic reticulum protein synthesis
and ⁄ or during folding.
Discussion
Vacuolar Ath1 is also found at the cell surface
Controversy concerning the localization of Ath1 has
been raised in two recent papers. In a previous study,
we suggested a localization for Ath1 at the cell surface
based on enzymatic data because most Ath1 activity
could be measured in intact cells [14], in a manner sim-
ilar to that for the secreted invertase [17]. However,
Huang et al. [12] provided several arguments for a
strict vacuolar localization of Ath1, identifying the
MVB pathway as the main transport route for sorting
this protein into the vacuole. In this paper, we used
Fig. 10. Role of the single transmembrane (TM) domain in protein expression. (A) Left, schematic view of chimera proteins Ath1DTM–invert-
ase and NDTM–invertase, respectively. Right, complementation tests of Suc2D mutant by these two constructions on YP sucrose agar for
5 days, and invertase activity (IA). (B) BY4741 cells transformed with plasmid pNDTM–mCherry were cultivated in YN trehalose medium to
the exponential phase and collected for live cell imaging. (C) The HA–ATH1 or HA–ATH1DTM gene constructs expressing Ath1 with or
without the TM sequence tagged with HA under the GAL1 promoter were transformed into ath1D mutant cultivated in YN galactose.
EndoH-treated crude extracts were immunoblotted with the anti-HA IgG. Lane 1, wild-type Ath1 (negative control); lane 2, HA–Ath1; lane 3,
HA–Ath1DTM. M, molecular mass markers.
S. He et al. Functional localization of Ath1 in S. cerevisiae
FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5439
two independent methodologies, fluorescence micros-
copy and gene fusion to invertase, which together pro-
vided evidence that Ath1 is also targeted to the cell
surface. Using the GFP or the red fluorescent protein
mCherry fused to the C-terminus of Ath1, we clearly
observed a localization of Ath1 at the cell periphery,
although the bulk fluorescent signal was still seen in

‘acid trehalase’ pool [14].
The cell-surface localization accounts for growth
on trehalose
It is known that Ath1 hydrolyzes exogenous trehalose
to grow on this carbon source. Based on an exclusive
vacuolar localization for this protein, two models have
been proposed [27]. The first suggested that Ath1 is
transported to the plasma membrane where it binds to
trehalose located at the cell surface; both trehalose and
trehalase are then internalized by endocytosis into the
vacuole where hydrolysis takes place. According to
the results of Huang et al. [12], this model may be
discarded because transport of Ath1 via the MVB
pathway en route to the vacuole bypasses the plasma
membrane. The second model considered that treha-
lose alone is delivered to the vacuole by endocytosis,
where it is hydrolyzed by the resident Ath1. However,
this model requires the identification of a trehalose
endocytosis process and this is difficult to reconcile
with mono- and disaccharides entering the cell by
sugar permeases [19], and yeast cells possessing a high-
affinity trehalose transporter encoded by AGT1 [28].
Instead, we provide arguments that support a more
simple model [14], in which trehalose can be assimi-
lated by either a Agt1–Nth1 pathway, implicating the
uptake and intracellular hydrolysis by neutral treha-
lase, or by direct hydrolysis of trehalose by the extra-
cellular acid trehalase encoded by ATH1 into glucose,
which is thereafter taken up by the cells. These two
pathways only function in a MAL-positive strain such

Ath1 delivery to the vacuole and significantly reduced
its proteolysis. Similar observations were obtained with
the vps1D strain (S. He, unpublished), which was ini-
tially identified as a protein involved in transport from
the late-Golgi complex to the prevacuolar compart-
ment [31] in the vacuole protein-sorting pathway. To
summarize, these results demonstrated that the vacuole
Functional localization of Ath1 in S. cerevisiae S. He et al.
5440 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS
is not the obligate functional destination for Ath1, and
that partial proteolysis of Ath1 could take place in this
subcellular compartment. In contrast, targeting this
enzyme at the cell surface is indispensable for growth
of yeast cells on trehalose.
Ath1 domains relevant for cell-surface targeting
and protein function
The finding that Ath1 could be targeted at the cell
periphery raised questions about secretion determi-
nants because domain-predicting tools did not identify
any sequence feature to explain Ath1 intracellular traf-
ficking. Klionsky and co-workers [12] showed that the
short TM domain located at the N-terminus of Ath1
contained sufficient information to deliver Ath1 to the
vacuole via the MVB pathway. They reached this con-
clusion using a chimeric construct in which only the
TM domain was fused to GFP. Alternatively, we spe-
cifically removed the unique TM domain from full-
length Ath1 or from the 131 amino acid N-terminal
fragment fused to Suc2, and found that absence of this
TM domain abrogated the activity of invertase and

ble formation) and secondary-structure elements that
might also contribute to export [37]. A common fea-
ture between these glycolytic enzymes and S. cerevisiae
Ath1 is the lack of a classical secretion sequence. How-
ever, because Ath1 is not a cytosolic protein, these
modes of secretion remain unknown. By contrast, the
classical secretion pathway cannot be excluded because
it was reported that mutations that cause accumulation
of secretory proteins in the endoplasmic reticulum
(sec18) or in the Golgi apparatus (sec7) led to dimin-
ished Ath1 activity [38,39]. Also, previous findings of
co-purification of Ath1 with cell-surface secreted pro-
teins such as invertase [7,40] and Ygp1 [41] further
supported this mode of secretion. In conclusion, the
secretion pathway for Ath1 needs to be thoroughly
reinvestigated using specific mutants altered in various
secretion processes.
Experimental procedures
Strains, media and culture conditions
BY4741 (MAT a his3-D1 leu2-D0 ura3-D0 met15-D0),
BY4742 (MAT a his3-D1 leu2-D0 lys2-D0 ura3-D0) and
SEY6210 (MAT a his3-D200 leu2-3,112 lys2-801 trp1-901
ura3-52 suc2-D9) were used as recipient strains for various
gene constructs, as described in Table 1. Yeast transforma-
Table 1. Strains used in this study. Euroscarf, Institute of Molecular Biosciences, Johann Wolfgang Goethe-University Frankfurt, Germany;
H. Bussey, McGill University, Que
´
bec, Canada.
Strain Genotype Reference
BY4741 MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 Euroscarf

ers ATH1_)1000_BH and ATH1_+508 (for primers list
see Table 2) were used to amplify a DNA fragment carry-
ing the ATH1 gene and its promoter and terminator from
extracted genomic DNA of BY4741. This PCR product
was first cloned in pGEM-T-easy vector and a cut Bam-
HI ⁄ PstI fragment was inserted into centromeric YCplac33
(linearized by BamHI and PstI) to construct pATH1 (for
plasmids list see Table 3). Mutagenesis of the TM domain
of Ath1 was carried out using the four nucleotides recombi-
nant PCR method [43]. Use of ATH1_A and ATH1_D
external primers, together with the internal mutagenic prim-
ers ATH1_B and ATH1_C, led to the deletion of nucleo-
tides 139–207 that encode the TM domain of Ath1. The
recombinant PCR fragment was cloned into the pGEM-
T-easy vector and cut by AgeI ⁄ AflII digestion to replace the
AgeI ⁄ AflII fragment in pATH1, which yielded path1DTM.
The same method was used to construct path1DN, with the
primers ATH1_E, ATH1_F, ATH1_G and ATH1_D that
lead to the deletion of nucleotides 1-300 of ATH1 sequence.
To fuse the signal peptide of Suc2 to the catalytic
domain of Ath1, the following constructions were carried
out using the centromeric plasmid pLC1 containing the
SUC2 gene (1602 bp) flanked by its own promoter [44].
The pSPSUC2–ath1DN plasmid was constructed by replac-
ing the fragment coding the catalytic domain of invertase,
which starts from the 112th nucleotide to the stop codon
(remaining 5¢-end fragment including the region coding sig-
nal peptide of Suc2)ofSUC2 in pLC1 by the ath1 allele
without its 5¢-end 300 bp (Fig. 7). To construct pSPPEP4–
ath1DN, the SUC2 ORF in pLC1 was replaced by the

to achieve in frame fusion with suc2
ic
allele, all these PCR
fragments were cloned in pGEM-T-easy vector and excised
by BamHI digestion for subcloning into the BglII site of
pSC1 to produce plasmids pSC1–ATH1, pSC1–N, pSC1–
TM, pSC1–tm, pSC1–ath1DTM and pSC1–NDTM, respec-
tively.
Ath1 was tagged with 3HA at the N-terminal end by
inserting 3HA after the start codon ATG of ATH1. For
this purpose, two rounds of the recombinant PCR were
successively carried out. First, we fused ATH1 promoter
(primers ATH1_1 and ATH1_2) and the 3HA (primers
HA_D and HA_R, using pFA6a–3HA–KanMX6 as tem-
plate), using ATH1_1 and HA_R as external primers. Sec-
ond, this recombinant PCR product was fused to an ATH1
5¢-end PCR product (primers ATH1_3 and ATH1_4) using
ATH1_1 and ATH1_4 as external primers. This final HA-
tagged PCR fragment was cloned into the pGEM-T-easy
vector and was then excised by SnaBI ⁄ AgeI to replace the
SnaBI ⁄ AgeI fragment in pATH1 and path1DTM, respec-
tively, to obtain pHA–ATH1 and pHA–ath1DTM.
Using the plasmid pFA6a–KanMX6–PGAL1 as the tem-
plate, the primers PGAL_D and PGAL_R were used to
amplify a GAL1 promoter PCR cassette that was co-trans-
formed into yeast cells with SnaBI-linearized plasmids
pHA–ATH1 and pHA–ath1DTM, respectively. Cells carry-
ing recombinant plasmids pPGAL1–HA–ATH1 or
pPGAL1–HA–ath1DTM, which express the HA-tagged ver-
sions of Ath1 under the strong promoter GAL1 instead of

were obtained by replacing the suc2
ic
allele sequence by
mCherry in plasmids pSC1–N and pSC1–NDTM. This was
carried out by co-transformation into yeast cells of a
mCherry PCR cassette obtained from primers mCherry–
pSC1_D and mCherry–pSC1_R, together with AgeI-linear-
ized pSC1–N and pSC1–NDTM, respectively.
Western blotting
Crude cell extract was prepared in the same way as crude
extract for trehalase activity measurement [14] with
Table 2. Primer sequences for PCR. Restriction sites are shown in bold, underlined and homologue recombination region in italics.
Name Oligo sequence
F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA
R1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC
ATH1_pUG36_D GC
ACTAGTATGAAAAGAATAAGATCGCTTT
ATH1_pUG36_R GC
CCCGGGATCATTGAGAACAATTTCC
ATH1_)1000_BH GC
GGATCCGTATGACCACATTCTATACTGA
ATH1_+508 GAGCCAATATCAAATCTGGTGGTAATCC
ATH1_A GAGGAACAAAAATAGT
ACCGGTAATAAC
ATH1_B GTAAGCCTGGAACTCTTTGT GTCAAACCTTGAGAAAGAAC
ATH1_C GTTCTTTCTCAAGGTTTGAC ACAAAGAGTTCCAGGCTTAC
ATH1_D CAAATCTATGATTT
CTTAAGGGCCA
ATH1_E AGCAAGCAC
TACGTATCACGACAAACCAAC

S. He et al. Functional localization of Ath1 in S. cerevisiae
FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5443
additional protease inhibitor (Roche, Basel, Switzerland,
NO.11836170001). Crude extract containing tagged proteins
was first treated with EndoH for 3 h at 37 °C. Western
blots were performed using the primary mouse mAb anti-
HA IgG (Roche, No. 11583816001) at a dilution of 1 ⁄ 2000
or mouse mAb anti-GFP IgG (Roche, NO. 11814460001)
at a dilution of 1 ⁄ 1000 or rabbit living colors DsRed poly-
clonal antibody (Clontech, Palo Alto, CA, USA,
NO.632496) at a dilution of 1 ⁄ 1000, and the secondary
antibody horseradish peroxidase-conjugated goat anti-
mouse or rabbit IgG at a dilution of 1 ⁄ 20000 supplied in
SuperSignal West Pico Complete Mouse (Pierce, Rockford,
IL, USA, NO. 34081) or rabbit (Pierce, NO. 34084) IgG
Detection Kit.
Fluorescence and microscopy
Fluorescent protein tagged cells were cultivated in YN
trehalose or glucose medium to reach the exponential
phase, and then cells were collected by centrifugation
(3000 g, 5 min). Images were captured on a Metamorph
driven Olympus IX81 wide-field microscope equipped with
a Coolsnap HQ camera and a Polychrome V (Till Photo-
nics, Munich, Germany). A 100·⁄1.4 Oil Plan-Apochro-
mat objective from Zeiss was used. Exposure times were
500 ms for GFP (excitation k = 490 nm) and 2000 ms
for mCherry (excitation k = 590 nm). Images were
minimally adjusted for brightness and contrast using
photoshop.
Assay of trehalase and invertase activity

pPGAL1–HA–ATH1 To express a chimeric protein with HA tag in the N-terminus of Ath1 This study
pPGAL1–HA–ath1DTM To express a chimeric protein with HA tag in the N-terminus of Ath1DTM This study
path1DN–mCherry Bearing mCherry at the 3¢-end of ath1DN This study
pSPSUC2–ath1DN–mCherry Bearing mCherry at the 3¢-end of SPSUC2-ath1DN This study
pSPPEP4–ath1DN–mCherry Bearing mCherry at the 3¢-end of SPPEP4-ath1DN This study
pSC1–ATH1 ATH1 ORF fused to 5¢-end of suc2
ic
allele This study
pSC1–N ATH1 5¢-end 395 nucleotides fused to 5¢-end of suc2
ic
allele This study
pSC1–TM ATH1 5¢-end 209 nucleotides fused to 5¢-end of suc2
ic
allele This study
pSC1–tm ATH1 5¢-end 140 nt fused to 5¢-end of suc2
ic
allele This study
pSC1–ath1DTM ath1DTM fused to 5¢-end of suc2
ic
allele This study
pSC1–NDTM ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding the TM domain
(amino acids 47-69) fused to 5¢-end of suc2
ic
allele
This study
pN–mCherry ATH1 5¢-end 395 nucleotides fused to 5¢-end of mCherry This study
pNDTM–mCherry ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding TM domain
(amino acids 47-69) fused to 5¢-end of mCherry
This study
Functional localization of Ath1 in S. cerevisiae S. He et al.

functions after severe heat stress [In Process Citation].
Mol Microbiol 37, 42–53.
6 Francois J & Parrou JL (2001) Reserve carbohydrates
metabolism in the yeast Saccharomyces cerevisiae.
FEMS Microbiol Rev 25, 125–145.
7 Mittenbuhler K & Holzer H (1988) Purification and
characterization of acid trehalase from the yeast suc2
mutant. J Biol Chem 263, 8537–8543.
8 Destruelle M, Holzer H & Klionsky DJ (1995) Isolation
and characterization of a novel yeast gene, ATH1, that
is required for vacuolar acid trehalase activity. Yeast
11, 1015–1025.
9 Pedreno Y, Maicas S, Arguelles JC, Sentandreu R &
Valentin E (2004) The ATC1 gene encodes a cell wall-
linked acid trehalase required for growth on trehalose
in Candida albicans. J Biol Chem 279 , 40852–40860.
10 Swaim CL, Anton BP, Sharma SS, Taron CH & Benner
JS (2008) Physical and computational analysis of the
yeast Kluyveromyces lactis secreted proteome. Proteo-
mics 8, 2714–2723.
11 Keller F, Schellenberg M & Wiemken A (1982) Locali-
zation of trehalase in vacuoles and of trehalose in the
cytosol of yeast (Saccharomyces cerevisiae). Arch Micro-
biol 131, 298–301.
12 Huang J, Reggiori F & Klionsky DJ (2007) The trans-
membrane domain of acid trehalase mediates ubiquitin-
independent multivesicular body pathway sorting. Mol
Biol Cell 18, 2511–2524.
13 Nwaka S, Mechler B, Destruelle M & Holzer H (1995)
Phenotypic features of trehalase mutants in Saccharo-

D229–D232.
22 Parrou JL, Jules M, Beltran G & Francois J (2005)
Acid trehalase in yeasts and filamentous fungi: localiza-
tion, regulation and physiological function. FEMS
Yeast Res 5, 503–511.
23 Haguenauer-Tsapis R (1992) Protein-specific features of
the general secretion pathway in yeast: the secretion of
acid phosphatase. Mol Microbiol 6, 573–579.
24 Ammerer G, Hunter CP, Rothman JH, Saari GC, Valls
LA & Stevens TH (1986) PEP4 gene of Saccharomy-
ces cerevisiae encodes proteinase A, a vacuolar enzyme
required for processing of vacuolar precursors. Mol Cell
Biol 6, 2490–2499.
25 Bryant NJ & Stevens TH (1998) Vacuole biogenesis in
Saccharomyces cerevisiae: protein transport pathways to
the yeast vacuole. Microbiol Mol Biol Rev 62, 230–247.
S. He et al. Functional localization of Ath1 in S. cerevisiae
FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5445
26 Blondel MO, Morvan J, Dupre S, Urban-Grimal D,
Haguenauer-Tsapis R & Volland C (2004) Direct
sorting of the yeast uracil permease to the endosomal
system is controlled by uracil binding and Rsp5p-
dependent ubiquitylation. Mol Biol Cell 15, 883–
895.
27 Nwaka S & Holzer H (1998) Molecular biology of
trehalose and the trehalases in the yeast Saccharomyces
cerevisiae. Prog Nucleic Acid Res Mol Biol 58, 197–237.
28 Plourde-Owobi L, Durner S, Parrou JL, Wieczorke R,
Goma G & Francois J (1999) AGT1, encoding an
alpha-glucoside transporter involved in uptake and

Nombela C (2006) Genetic and proteomic evidences
support the localization of yeast enolase in the cell
surface. Proteomics 6, S107–S118.
36 Nombela C, Gil C & Chaffin WL (2006) Non-conven-
tional protein secretion in yeast. Trends Microbiol 14,
15–21.
37 Prudovsky I, Mandinova A, Soldi R, Bagala C, Grazi-
ani I, Landriscina M, Tarantini F, Duarte M, Bellum S,
Doherty H et al. (2003) The non-classical export routes:
FGF1 and IL-1alpha point the way. J Cell Sci 116,
4871–4881.
38 Harris SD & Cotter DA (1987) Vacuolar (lysosomal)
trehalase of Saccharomyces cerevisiae.
Curr Microbiol
15, 245–249.
39 Mittenbuhler K & Holzer H (1991) Characterization of
different forms of yeast acid trehalase in the secretory
pathway. Arch Microbiol 155, 217–220.
40 Biswas N & Ghosh AK (1996) Characterisation of an
acid trehalase of Saccharomyces cerevisiae present in
trehalase–sucrase aggregate. Biochim Biophys Acta 1290,
95–100.
41 Destruelle M, Holzer H & Klionsky DJ (1994) Identifi-
cation and characterization of a novel yeast gene: the
YGP1 gene product is a highly glycosylated secreted
protein that is synthesized in response to nutrient limi-
tation. Mol Cell Biol 14, 2740–2754.
42 Woods RA & Gietz RD (2001) High-efficiency transfor-
mation of plasmid DNA into yeast. Methods Mol Biol
177, 85–97.


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status