Structural and biochemical characterization of a human
adenovirus 2/12 penton base chimera
Chloe Zubieta
1,
*, Laurent Blanchoin
2
and Stephen Cusack
1
1 European Molecular Biology Laboratory, Grenoble Outstation, France
2 Laboratoire de Physiologie Cellulaire Vegetale, Commissariat a l’Energie Atomique, Centre National de la Recherche Scientifique,
Institut National de la Recherche Agronomique, Universite Joseph Fourier, Unite Mixte de Recherche 5168, Grenoble, France
Adenoviruses are nonenveloped double-stranded DNA
viruses found in mammalian and non-mammalian
vertebrates. Human adenoviruses are divided into six
subgroups (A–F) based on genetic organization, hema-
gluttination patterns, immuno-crossreactivity, and nuc-
leotide content. Over 50 serotypes have been identified
in humans; these cause generally mild respiratory,
enteric and ocular disease. However, in immunocom-
promised, very young, or elderly individuals, adenoviral
infections can lead to serious illness or death [1,2].
Apart from their role as a common human pathogen,
adenoviruses are one of the most studied vectors for
gene delivery due to extensive knowledge of their
biology and the ability to manipulate the adenoviral
genome [3–5].
The adenoviral T ¼ 25 icosahedral capsid consists
of three major polypeptides: the trimeric hexon, which
forms the facets of the particle, the pentameric penton
base (pb), which forms the vertices, and the trimeric
fiber protein, which extends from the penton base at

crystal structure of a
human adenovirus 2 ⁄ 12 penton base chimera crystallized as a dodecamer.
The structure is generally similar to human adenovirus 2 penton base, with
the main differences localized to the fiber protein-binding site. Fluorescence
anisotropy assays using a trimeric fiber protein mimetic called the minifiber
and wild-type human adenovirus 2 and chimeric penton base demonstrate
that fiber protein binding is independent of the hypervariable loop, with a
K
d
for fiber binding estimated in the 1–2 lm range. Interestingly, competi-
tion assays using labeled and unlabeled minifiber demonstrated virtually
irreversible binding to the penton base, which we ascribe to a conforma-
tional change, on the basis of comparisons of all available penton base
structures.
Abbreviations
hAd, human adenovirus; MPD, 2-methyl-2,4-pentane diol; NCS, noncrystallographic symmetry averaging; pb, penton base; TMR,
tetramethylrhodamine.
4336 FEBS Journal 273 (2006) 4336–4345 ª 2006 The Authors Journal compilation ª 2006 FEBS
and 60 copies of the penton base monomers. In addi-
tion to its role as a critical component of the viral cap-
sid, the penton base also contains an Arg-Gly-Asp
(RGD) motif that acts as a trigger for endocytosis of
the adenovirus into the host cell. Furthermore, the
architecture of the entire virus, including the positions
of the cementing proteins, has been revealed in detail
by recent high-resolution cryoelectron microscopy
reconstructions [6–11].
Initial cell attachment occurs via interactions of the
fiber protein C-terminal head domain. For the major-
ity of serotypes, including adenoviruses 2 and 12, the

integrin binding being communicated to the fiber-bind-
ing region of the penton base.
Although the adenovirus penton base exhibits a high
degree of sequence homology (typically over 70%
homology between different subgroups of human
adenoviruses), the RGD motif is located in a hyper-
variable loop region of the penton base protein. This
region can vary in length from approximately eight
residues in human adenovirus serotype 12 (hAd12) to
over 70 residues in human adenovirus 2 (hAd2). Previ-
ous crystallographic studies of the hAd2 penton base
revealed this region to be very flexible, with the hyper-
variable loop almost completely disordered. At a
unique crystal contact, a helix turn from the hypervari-
able loop was identified; however, the amino acid
sequence could not be definitively assigned [20]. Cryo-
electron microscopy reconstructions of adenovirus 2
[21] with an RGD-recognizing antibody and with a
soluble a
V
b
5
integrin [16] show only diffuse density for
the hypervariable loop region; however, the resolution
was limited to  21 A
˚
. In contrast, cryoelectron micro-
scopy reconstructions of complexes with soluble inte-
grin and hAd12 gave more defined density in the
region of the RGD motif due to the better order of

matically shortening the hypervariable loop to the
hAd12 sequence, we eliminated any possible direct
interactions between the hypervariable loop of the
penton base and the fiber protein. We present here the
3.6 A
˚
crystal structure of an hAd2pb ⁄ 12pb chimera
and fluorescence anisotropy binding data of the wild
type and the chimeric construct with a fiber protein
mimetic.
Results and Discussion
The 73-residue hypervariable loop of hAd2pb was
replaced with the eight-residue hypervariable loop
from hAd12 (Fig. 1). Owing to the proteolytic sensi-
tivity of the construct, a more stable N-terminally
truncated (49-TGGR ) version was designed. All
structural studies presented here used the ) 49 N-ter-
minally truncated hAd2pb ⁄ 12pb chimera.
Analogous to the hAd2 penton base, the hAd2 ⁄ 12
chimeric construct formed well-behaved pentamers in
solution, as confirmed by gel filtration and negative-
stain electron microscopy (data not shown). As with
hAd2pb, the solvent environment has marked effects
on the equilibrium between pentamer and dodecamer
C. Zubieta et al. Human adenovirus 2 ⁄ 12 penton base chimera
FEBS Journal 273 (2006) 4336–4345 ª 2006 The Authors Journal compilation ª 2006 FEBS 4337
(regular arrangements of 12 pentamers), and the chi-
mera formed dodecahedral particles under crystalliza-
tion conditions. These crystallization conditions were,
however, different from those for hAd2. For hAd2pb,

˚
in hAd2 ⁄ 12pb and hAd2pb give a volume of
 300 000 A
˚
3
, too small to accommodate an extra
2940 residues corresponding to the N-terminal exten-
sion from the 60 copies of the full-length protein. The
formation of small subviral particles by truncated viral
capsid proteins is not limited to adenovirus. For exam-
ple, this phenomenon of spontaneous assembly into
regular particles has been noted for recombinant
human papilloma virus L1 protein, a pentameric cap-
sid protein. Only upon a 10-residue N-terminal trunca-
tion does the L1 protein form small virus-like particles
of icosahedral symmetry [23].
The physiologic role, if any, of penton base dode-
camer formation in infected cells has not been defined
for adenovirus. However, the N-terminal extremity of
the penton base contains two PPxY motifs, shown to
interact with the WW domains of cellular ubiquitin
ligases [24,25]. As these motifs are presumably import-
ant for adenovirus infection, it would be undesirable
to incorporate truncated penton bases into virions,
and dodecahedron formation could be a mechanism to
avoid this.
Fig. 1. Sequence alignment of adenovirus penton base. hAd2 (accession number P03276), hAd12 (accession number P36716) and the
hAd2 ⁄ 12 chimera are aligned with the consensus secondary structure above the sequence. b-Strands are in orange and helices are in green.
The hypervariable loop is highlighted in yellow, with the RGD motif in red.
Human adenovirus 2 ⁄ 12 penton base chimera C. Zubieta et al.

) as con-
tact area. Thus, a large amount of the available surface
area of the molecule is buried upon pentamerization,
increasing the stability of the protein.
The hAd2 ⁄ 12 penton base monomer can be divided
into a basal jellyroll domain formed by two b-sheets
and a distal domain formed by insertions between the
strands of the jellyroll domain (Fig. 3). Antiparallel
b-sheets made up of strands CHEF and BIDG pack
against each other, forming the jellyroll topology,
a typical viral capsid protein fold [26]. The distal
domain is formed by an insertion of  230 residues
(residues 133–367) between strands D and E and a
smaller insertion of  50 residues (residues 404–458)
between strands F and G. The hypervariable loop,
Table 1. Data collection and refinement statistics for hAd2/12 pen-
ton base.
Ad2 ⁄ 12 penton base
chimera
Data collection statistics
Space group I222
Cell dimensions (A
˚
) a ¼ 266.50
b ¼ 292.92
c ¼ 307.30
Oscillation range 0.5°
Contents of asymmetric unit 3 pentamers
Observations
Total measured reflections 363 715

free
(%)
e
27.5 ⁄ 32.8
Model geometry
RMSD bond lengths (A
˚
) 0.015
RMSD bond angles (°) 1.68
Ramachandran plot
Favored + additional regions 96.7%
Disallowed (number) 3.3% (3)
a
Values in parentheses refer to the highest resolution shell.
b
R
factor
¼ S|I ) <I> | ⁄SI,where<I> is the average value of a reflection,
I.
c
Averaging with RAVE to high resolution limit with 15-fold sym-
metry.
d
Correlation between the densities of all noncrystallographic
symmetry averaging (NCS)-related points. R
fac
¼ S|F
obs
) F
map

FEBS Journal 273 (2006) 4336–4345 ª 2006 The Authors Journal compilation ª 2006 FEBS 4339
containing the RGD motif, is located at the top of
the distal domain within the first insertion, and faces
the solvent-exposed exterior of the particle. As in the
hAd2pb structures, even the shorter Ad12 hypervaria-
ble loop is highly flexible, as demonstrated by relat-
ively poor electron density and high temperature
factors. In all monomers, residues 297–317 were disor-
dered and not modeled.
The second insertion into the jellyroll domain con-
tains part of the putative fiber protein-binding site.
This portion of the protein undergoes a conformation-
al change upon fiber protein binding, with helix 7
kinking almost 45° to form a binding cleft for the
N-terminus of the fiber protein [20]. Structural align-
ments of the hAd2 ⁄ 12pb chimera with the hAd2pb
fiber peptide bound and unbound structures reveal a
high degree of overall conservation (Figs 3B and 4).
Surprisingly, the hAd2 ⁄ 12pb structure most closely
resembles the fiber peptide-bound form of hAd2pb;
however, no fiber peptide was present during crystal-
lization, and the fiber-binding site is empty.
A possible explanation for the observed conforma-
tion of helix 7 is the effect of the solvent environment,
specifically high concentrations (50%) of MPD, favor-
ing a conformation mimicking the fiber protein-bound
state. HAd2pb and the hAd2pb ⁄ fiber peptide complex
were both crystallized from ammonium sulfate ⁄ diox-
ane solutions, not MPD solutions [20]. The use of high
concentrations of a small organic alcohol will affect

resolu-
tion of the hAd2 ⁄ 12pb crystal structure precludes the
location of any ordered MPD molecules within the
fiber protein-binding site, this is a likely possibility.
A second hypothesis for the observed conformation
of helix 7 entails conformational coupling of the hyper-
variable loop to the fiber protein-binding region. It has
been shown that the fiber protein is shed from the virus
upon integrin binding by the penton base hypervariable
loop and most likely before endocytosis [13,17–19].
Upon addition of soluble RGD peptides that interfere
with penton base binding to integrin, the virion exhib-
ited impaired endocytosis. Interestingly, in this experi-
ment, the fibers were not shed from the virus [19].
These data raise the possibility of coupling of fiber
release to binding of the RGD motif of the hypervaria-
ble loop to cellular integrins. Alterations in hypervaria-
ble loop topology, in this case engendered by
shortening the loop to the Ad12pb sequence, could
have allosteric effects on the fiber-binding site. In order
to investigate this possibility, we performed fluores-
cence-based binding assays of the wild-type hAd2pb
and the hAd2 ⁄ 12 chimera with a fiber protein mimetic
to determine whether fiber binding or fiber release was
coupled to changes in the hypervariable loop.
Binding assays
Owing to difficulties in expressing and purifying the
full-length fiber protein, a 75 amino acid ‘minifiber’
construct was used as a fiber protein mimetic. Previous
structural studies of hAd2pb with a 22 amino acid


! P
with the formation of P being virtually irreversible. The
apparent K
d
measured here is the K
d
for the initial bind-
ing of minifiber. The fluorescence emission of the TMR
was assumed to be independent of the binding of the
minifiber to the penton base, because it is attached at
the C-terminal extremity of the foldon domain and is
remote from the penton base-binding region.
The system was particularly amenable to this tech-
nique, due to the relatively small size of the minifiber
( 24 kDa for the trimer) in conjunction with the large
size of the penton base ( 300 kDa for the pentamer).
K
d
values for minifiber binding to wild-type hAd2pb
B
A
Fig. 5. Sequence alignment and binding data for the minifiber–pen-
ton base complex. (A) Alignment of the N-terminal region of hAd2
fiber (accession number CAJ29207), hAd12 fiber (accession num-
ber CAJ29196), and minifiber. The residues known to interact with
the penton base are in yellow and the T4 fibritin foldon domain of
the minifiber is in red. Derivatization with 2-methyl-2,4-pentanediol
(TMR) was performed on the C-terminal cysteine residue of the
minifiber. (B) Left: fluorescence anisotropy measurement for wild-

To address these observations, we performed competi-
tion experiments using unlabeled minifiber. Unlabeled
minifiber was titrated into samples of TMR-labeled
minifiber bound to wild-type and chimeric penton
base. No decrease in fluorescence anisotropy was
observed even upon addition of 50-fold excess of un-
labeled minifiber over the calculated K
d
(Fig. 5B).
These data support the hypothesis that after fiber
binding, the conformational change occurring in the
penton base locks the fiber protein into place. Thus, as
noted previously, a full representation of the binding
equilibrium of the interaction is
F þ PB $ P

! P
where F is the fiber or minifiber protein, PB is the pen-
ton base, P* is the initial penton, and P is the penton
after conformational change. The stability of the com-
plex results from the effect of the crystallographically
observed cooperative conformational change in the
fiber protein-binding site. Based on the structure of
hAd2pb with an N-terminal fiber peptide, conforma-
tional changes will occur in the penton base upon
interaction of the fiber protein, essentially locking in
the fiber [20].
Studies with adenovirus 2 have shown that fiber loss
occurs at the cell surface and prior to endocytosis [19].
Although the mechanism of fiber dissociation from the

virion. In this structural study, the fiber-binding site
was in a ‘bound’ conformation, although no fiber was
present. The most likely explanation for this observa-
tion is that the switch from the fiber ‘bound’ to
‘unbound’ states of the penton base (or vice versa) is
not only dependent on the presence or absence of the
fiber itself but can also be triggered by solvent envi-
ronment effects. Owing to the cooperativity of this
switch [19], all penton bases will be in the same con-
formation. Triggering the switch to the unbound state
would clearly favor fiber release. Our results suggest
that this is not dependent on the hypervariable loop
directly, but could be due to other interactions with
the bound integrin or the particular solvent environ-
ment of the virion at the cell surface or in the initial
stages of endocytosis.
Experimental procedures
For baculovirus expression, the SF21 and Hi5 cell lines and
the Bac-to-Bac expression system and vectors were from
Invitrogen (Carlsbad, CA, USA). Protease inhibitors were
from Roche (Basel, Switzerland) and Ni-NTA resin was
obtained from Bio-Rad (Hercules, CA, USA). The minifiber
construct was a gift from the Laboratory of Glen Nemerow
at The Scripps Research Institute (TSRI) in La Jolla, CA,
USA. An MOS450 fluorimeter (Biologic, SA, Claix, France)
was used in the fluorescence anisotropy assays.
Protein expression and purification
cDNA encoding a 49-residue N-terminal truncation of
hAd2pb was cloned into a pFastbac vector as described
Human adenovirus 2 ⁄ 12 penton base chimera C. Zubieta et al.

pelleted at 43 000 g for 45 min at 4 °C using an Avanti J-25
centrifuge with a JA25.50 rotor (Beckman Coulter, Fuller-
ton, CA, USA), and the supernatant collected. The protein
was precipitated with 30% ammonium sulfate and the
precipitant collected. After resuspension in 25 mm Tris
(pH 7.5) ⁄ 100 mm NaCl, the protein was dialyzed overnight
against the same buffer. The protein solution was concentra-
ted to 5mgÆmL
)1
and applied to a MONO Q column
(Pharmacia, Uppsala, Sweden) with a linear gradient of
100 mm to 1 m NaCl in 25 mm Tris (pH 7.5). The protein
eluted at approximately 220 mm NaCl. Fractions of interest
were buffer exchanged, concentrated to 5–10 mgÆmL
)1
and
stored at ) 80 °C.
The minifiber construct was cloned into a pEtM11 expres-
sion vector between the Kpn1 and Nco1 sites using a forward
oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG
CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT
CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG
CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys
sequence was introduced at the C-terminus using oligomers
5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA
TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG
CAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21
cells were transformed with the pETM11 construct and
grown until a D of 0.8 (600 nm) in Terrific Broth supple-
mented with phosphate b uffer and kanamycin at 37 °C.

cence anisotropy of a 33 nm solution of labeled minifiber
was measured at an emission wavelength of 575 nm perpen-
dicular to the excitation vector. Either wild-type hAd2pb or
hAd2 ⁄ 12pb was titrated into the solution in  200–300 lm
increments. Anisotropy values were recorded for 60 points
over 60 s, and an average value was taken as a data point.
Titrations were continued until a stable anisotropy value
was obtained.
Fluorescence anisotropy, A, is defined as
A ¼ðI
V
 I
H
Þ=ðI
V
þ 2I
H
Þ
where I
V
and I
H
refer to the parallel and perpendicular
components of the polarized fluorescence emission. The
changes in anisotropy are a linear function with
A ¼ A
F
þðA
B
 A

ð4½PB
tot
½Lig
tot
ÞÞ
1=2
g=2½Lig
tot
Þ
where a ¼ ([PB]
tot
+ [Lig]
tot
+ K
d
), DA ¼ (A
B
) A
F
), and
[PB] is the concentration of the penton base. Fitting the
anisotropy data to the previous equation gives a value for the
K
d.
Binding curves were generated in kaleidagraph and fit-
ted to the above equation. All measurements were done in
triplicate with at least eight data points per experiment.
Crystallization
Crystals were grown in hanging drops against 50%
MPD ⁄ 0.2 m ammonium phosphate⁄ 0.1 m Tris (pH 7.5) at

and scaled with xds.
molrep [38] was used to find a molecular replacement
solution with the hAd2 pentamer as a search model (pdb
code 1X9P). Based on the unit cell dimensions and Mat-
thews coefficient, three pentamers were expected per asym-
metric unit, with the full dodecahedral particle formed from
the space group symmetry operators. A clear solution with
three pentamers was found and used to generate initial
maps. Subsequent 15-fold NCS averaging and gradual
phase extension from 15 A
˚
to 3.6 A
˚
with rave [39] allowed
the generation of high-quality electron density maps. Model
building was performed in o [40] and refinements carried
out with refmac. Initially, strict NCS restraints were
applied to the model; however, in the later stages of refine-
ment, tight NCS constraints were only applied to the back-
bone, and the side chains were refined using medium
restraints. Unaveraged maps were examined to locate devia-
tions between monomers.
According to procheck [41] (Table 1), only three (Thr66,
Glu172, and His237) residues were in disallowed regions of
the Ramachandran plot. These generally lie in poorly
ordered loop regions. Residues 507–508 (C-terminus) and
residues 297–317 of the hypervariable loop were disordered
and not modeled. All figures were generated using pymol
[42]. Coordinates and structure factors have been deposited
in the RCSB Protein Data Bank under accession code 2C6S.

10 Fabry CM, Rosa-Calatrava M, Conway JF, Zubieta C,
Cusack S, Ruigrok RW & Schoehn G (2005) A quasi-
atomic model of human adenovirus type 5 capsid.
EMBO J 24, 1645–1654.
11 Saban SD, Nepomuceno RR, Gritton LD, Nemerow
GR & Stewart PL (2005) CryoEM structure at 9A reso-
lution of an adenovirus vector targeted to hematopoietic
cells. J Mol Biol 349, 526–537.
12 Cohen CJ, Shieh JT, Pickles RJ, Okegawa T, Hsieh JT
& Bergelson JM (2001) The coxsackievirus and adeno-
Human adenovirus 2 ⁄ 12 penton base chimera C. Zubieta et al.
4344 FEBS Journal 273 (2006) 4336–4345 ª 2006 The Authors Journal compilation ª 2006 FEBS
virus receptor is a transmembrane component of the tight
junction. Proc Natl Acad Sci USA 98, 15191–15196.
13 Wickham TJ, Mathias P, Cheresh DA & Nemerow GR
(1993) Integrins alpha v beta 3 and alpha v beta 5 pro-
mote adenovirus internalization but not virus attach-
ment. Cell 73, 309–319.
14 Li E, Stupack D, Bokoch GM & Nemerow GR (1998)
Adenovirus endocytosis requires actin cytoskeleton reor-
ganization mediated by Rho family GTPases. J Virol
72, 8806–8812.
15 Li E, Brown SL, Stupack DG, Puente XS, Cheresh DA
& Nemerow GR (2001) Integrin alpha(v)beta1 is an
adenovirus coreceptor. J Virol 75, 5405–5409.
16 Chiu CY, Mathias P, Nemerow GR & Stewart PL
(1999) Structure of adenovirus complexed with its inter-
nalization receptor, alphavbeta5 integrin. J Virol 73,
6759–6768.
17 Greber UF, Willetts M, Webster P & Helenius A (1993)

internalization recruits ubiquitin-protein ligases.
Biochemistry 41, 14299–14305.
26 Chelvanayagam G, Heringa J & Argos P (1992) Anat-
omy and evolution of proteins displaying the viral cap-
sid jellyroll topology. J Mol Biol 228, 220–242.
27 Anand K, Pal D & Hilgenfeld R (2002) An overview on
2-methyl-2,4-pentanediol in crystallization and in crys-
tals of biological macromolecules. Acta Crystallogr D
Biol Crystallogr 58, 1722–1728.
28 Guthe S, Kapinos L, Moglich A, Meier S, Grzesiek S &
Kiefhaber T (2004) Very fast folding and association of
a trimerization domain from bacteriophage T4 fibritin.
J Mol Biol 337, 905–915.
29 Papanikolopoulou K, Forge V, Goeltz P & Mitraki A
(2004) Formation of highly stable chimeric trimers by
fusion of an adenovirus fiber shaft fragment with the
foldon domain of bacteriophage t4 fibritin. J Biol Chem
279, 8991–8998.
30 Green M & Pina M (1963) Biochemical studies on ade-
novirus multiplication. IV. Isolation, purification, and
chemical analysis of adenovirus. Virology 20, 199–207.
31 Pettersson U, Philipson L & Hoglund S (1968) Struc-
tural proteins of adenoviruses. II. Purification and char-
acterization of the adenovirus type 2 fiber antigen.
Virology 35, 204–215.
32 Boudin ML, Moncany M, D’Halluin JC & Boulanger PA
(1979) Isolation and characterization of adenovirus type
2 vertex capsomer (penton base). Virology 92, 125–138.
33 Pettersson U & Hoglund S (1969) Sructural proteins of
adenoviruses. 3. Purification and characterization of the

42 DeLano WL (2002) The PyMOL Molecular Graphics
System. DeLano Scientific, San Carlos, CA.
C. Zubieta et al. Human adenovirus 2 ⁄ 12 penton base chimera
FEBS Journal 273 (2006) 4336–4345 ª 2006 The Authors Journal compilation ª 2006 FEBS 4345