DNA strand exchange activity of rice recombinase
OsDmc1 monitored by fluorescence resonance energy
transfer and the role of ATP hydrolysis
Chittela Rajanikant
1
, Manoj Kumbhakar
2
, Haridas Pal
2
, Basuthkar J. Rao
3
and Jayashree K. Sainis
1
1 Molecular Biology Division, Bhabha Atomic Research Center, Mumbai, India
2 Radiation Chemistry and Chemical Dynamics Division, Bhabha Atomic Research Center, Mumbai, India
3 Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India
Homologous recombination is a fundamental process
by which two DNA molecules physically interact with
each other. This process is important for repairing the
double strand breaks (DSBs) induced during mitosis,
meiosis and other stages where chromosomal break-
ages ensue. There are several sequential biochemical
Keywords
Dmc1; FRET; renaturation; rice; strand
exchange
Correspondence
J. K. Sainis, Molecular Biology Division,
Bhabha Atomic Research Centre,
Mumbai 400 085, India
Fax: +91 22 25505326
Tel : +91 22 25595079
events where ATP hydrolysis seems to critically decide the rates of the reac-
tion system. These studies open up new facets of a plant recombinase func-
tion in relation to the role of ATP hydrolysis.
Abbreviations
AMP-PNP, adenosine 5¢-(b,c-imido) triphosphate; ATP-c-S, adenosine 5¢-O-(3-thio triphosphate); Dmc1, disrupted meiotic cDNA1; DS, double
stranded; DSBs, double strand breaks; FRET, fluorescence resonance energy transfer; OsDmc1, Oryza sativa disrupted meiotic cDNA1;
SS, single stranded; RecA, DNA recombinase A; RPA, replication protein A.
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1497
reactions that prepare the DNA molecules for repair
via homologous recombination. These sequential reac-
tions involve identification of DSBs, processing the
broken DNA at the damage site by resecting the ends,
facilitating homology search ⁄ synapses, strand exchange
between the paired chromosomes, followed by resolu-
tion of the Holliday junction. Specific proteins required
for each of these steps have been identified mainly
from Escherichia coli and now also from yeast and
mammalian systems. The proteins implicated in
homology search and pairing activities are called
strand exchange proteins or DNA recombinases.
DNA recombinase A (RecA) from E. coli has been
extensively investigated both at the biochemical and
molecular level [1]. These studies revealed that RecA
protein binds to single strand overhangs generated as a
result of processing at the DSB site. In this presynaptic
complex, RecA protein coats single stranded DNA
(ssDNA) as a helical filament (three nucleotides per
protein monomer) resulting in stretching of DNA by
1.5 times its original length. This conformational
change in DNA is hypothesized to facilitate homology
sterile, showing reduced reproductive organ sizes and
asynapsis or random segregation of chromosomes
[6,7]. In the case of plants, the DMC1 knockout in
Arabidopsis resulted in sterile plants and showed
asynapsis in meiosis [8].
As a sequel to identification of recA homologues in
eukaryotes, attempts were made to clone and overex-
press these genes for biochemical characterization. The
biochemical properties of Dmc1 proteins from yeast,
Coprinus and human systems have emerged recently.
Dmc1 proteins from S. cerevisiae and Coprinus cenere-
us were shown to catalyze strand assimilation of radio-
labeled oligonucleotides into homologous duplex DNA
in a reaction promoted by ATP and ATP analogues
[9,10]. Coprinus cenereus Dmc1 protein interacts homo-
typically and mediates a homology dependent strand
exchange reaction [11]. Using fluorescence resonance
energy transfer (FRET), hDmc1 was shown to catalyze
the strand exchange and strand assimilation in a
homology dependent manner [12]. Recent studies on
hDmc1 showed that it was able to mediate the strand
exchange reaction at least up to several kilobase pairs
(5.4 kb) in vitro in cooperation with a heterotrimeric
protein, namely replication protein A (RPA) [13].
Though eukaryotic RecA homologues have been
well characterized from yeast and animal model sys-
tems, the information from plants is still in its infancy.
Previously, homologues of DMC1 and RAD51 have
been reported from Lilium longiflorum [14,15], Arabid-
opsis thaliana [16,17] and Oryza sativa [18–21]. It is
that stable changes are associated with homologous
strands in the native state of the reaction and involve
no protein removal steps.
Results
Strand exchange activity of several recombinases have
been investigated in vitro, typically using agarose gel
assays with radiolabeled oligonucleotides as substrates
[1,9,10,12]. Though commonly used because of its sim-
plicity, this assay has drawbacks because it involves
removal of DNA bound proteins and hence does not
score the reaction at its equilibrium state. An assay
using FRET, involving fluorophore labeled oligo-
nucleotides as substrates, is not only sensitive but also
scores the reaction without perturbing its equilibrium
state, as it involves no sample deproteinization and
can be carried out in real time. Therefore, in the pre-
sent study we have used FRET for measuring recombi-
nation activities of OsDmc1 in vitro.
Design of the assay
Two complementary oligonucleotides (Phi-W and Phi-
C, Fig. 1A), were labeled with fluorescein and rhodam-
ine at their 5¢ and 3¢ ends, respectively. The assay is
based on nonradiative fluorescence resonance energy
transfer from fluorescein (donor) to rhodamine (accep-
tor). FRET, being highly distance dependent between
donor and acceptor dyes, will therefore unveil the sta-
tus of physical union and separation of complementary
strands during renaturation and strand exchange,
respectively, and thereby assesses the recombinase
activity of OsDmc1, as has been shown for other rec-
Renaturation activity of OsDmc1
Renaturation was measured at a fixed concentration of
protein using Phi-C⁄ Phi-W strands tagged with fluores-
cence labels (Fig. 1A) in the presence of ATP, as a func-
tion of time (Fig. 2A). OsDmc1 was presynapsed with
Phi-C oligonucleotide, followed by the addition of com-
plementary strands (Phi-W). As expected, strand anneal-
ing led to a time dependant drop in fluorescein emission
Fig. 1. Schematic representation of the renaturation (A) and strand
exchange (B) reactions mediated by OsDmc1 protein. Phi-C and
Phi-W represent rhodamine and fluorescein carrying strands,
respectively, at their 3¢ and 5¢ ends. The assays were based on
nonradiative energy transfer from fluorescein to rhodamine when
fluorescein was excited at 490 nm, followed by measurement of
emission intensity at 522 nm, due to the two dyes being in close
proximity. Renaturation activity was measured as the decrease in
fluorescein emission intensity and strand exchange was monitored
as the increase in fluorescein emission intensity at 522 nm.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1499
intensity (Fig. 2). The rate of renaturation catalyzed by
OsDmc1 was rather high; within 200 s the reaction
reached steady state level (Fig. 2A, line 3). Under the
same assay conditions, a control with no protein revealed
much slower spontaneous renaturation reaction (Fig. 2A,
line 2). Even after several minutes of incubation sponta-
neous renaturation did not seem to have reached its
steady state level. The rate of OsDmc1 catalyzed renatur-
ation was much faster at higher concentration of protein
(more than 1.25 lm; data not shown). The protein to
(Phi-C) as a function of its concentration (Fig. 2B, his-
togram 2 and 3). On the other hand, no significant
change in FRET efficiency was observed when unlabe-
led heterologous (M13C) strand was added to the
renaturation mixture (Fig. 2B, histograms 4 and 5). In
these sets, FRET efficiency was highly comparable to
that where no competitor was present (Fig. 2B, histo-
gram 1). This experiment revealed that OsDmc1 cata-
lyzed renaturation as measured by FRET change was
homology dependent.
Effect of ATP and its hydrolysis on renaturation
activity
We also examined the effect of ATP on renaturation
catalyzed by OsDmc1. Interestingly enough, in the
Fig. 2. (A) Time course of renaturation reaction as monitored by
decrease in fluorescein emission intensity at 522 nm expressed as
arbitrary units normalized to one. (1) Reaction containing Phi-W
oligonucleotide with 1.25 l
M of OsDmc1. (2) Reaction containing
Phi-W oligonucleotide and Phi-C oligonucleotide without OsDmc1.
(3) Reaction containing Phi-W oligonucleotide and Phi-C oligonucleo-
tide with 1.25 l
M of OsDmc1. (B) Homology dependent renatura-
tion reaction mediated by OsDmc1. Renaturation reaction of
OsDmc1 (1) without competitor; (2) with 27.5 l
M unlabeled of Phi-
C along with 27.5 l
M of rhodamine labeled Phi-C; (3) with 55.0 lM
unlabeled of Phi-C along with 27.5 lM of rhodamine labeled Phi-C;
(4) with 27.5 l
(Fig. 3, line 4). However, it is intriguing to note that
the initial rate of renaturation in the presence of
ATP-c-S was similar to that of ATP, but the reaction
rate suddenly plummeted after about 50 s of the reac-
tion. There is no simple explanation for this observa-
tion. These results demonstrated that in contrast to
ScDmc1, where renaturation was not dependent on
ATP [9], OsDmc1 protein requires not only the pres-
ence of ATP, but also perhaps its hydrolysis, for
mediating the maximum renaturation activity (see
below).
Strand exchange activity of OsDmc1
Protein concentration dependence
OsDmc1 was shown to have the ability to mediate
homology dependent D-loop formation activity [22]. In
the present study, we extended our analyses further,
and the strand exchange property of OsDmc1 was
monitored by pairing an unlabeled Phi-C single strand
with duplex oligonucleotide formed by complementary
annealing of FRET dye labeled strands (Phi-W and
Phi-C; Fig. 1B). Interestingly enough, the three stran-
ded pairing reaction exhibited OsDmc1 concentration
dependent increase in fluorescein emission intensity at
522 nm as a function of reaction time (Fig. 4A). This
was in stark contrast to the renaturation reaction,
where the emission intensity at the same wavelength
had decreased as a function of time (Figs 2 and 3).
The observed increase in fluorescein emission intensity
is consistent with strand exchange as detected by
FRET. It should be noted that no emission increase
taining reaction (Fig. 4B, lines 2 and 3). At this point,
Fig. 3. Renaturation activity mediated by OsDmc1 protein in the
presence of ATP and slowly hydrolysable ATP analogues as monit-
ored by the decrease in fluorescein emission intensity at 522 nm
expressed as arbitrary units normalized to one. Reaction contained
fluorescein labeled Phi-W and rhodamine labeled Phi-C (1) with
1.25 l
M of OsDmc1 in absence of ATP; (2) with 1.25 lM of
OsDmc1 in presence of 2.0 m
M of AMP-PNP; (3) with 1.25 lM
of OsDmc1 in presence of 2.0 mM ATP-c-S; (4) with 1.25 lM of
OsDmc1 in presence of 2.0 m
M of ATP.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1501
one of the sets was treated with deproteinization steps
(shown by arrow in Fig. 4B, line 3) and the other reac-
tion set continued with OsDmc1 action (Fig. 4B, line
2). The fluorescence emission changes remained stable
to deproteinization treatment. This was evidenced by
fluorescence values that were similar in deproteinized
and nondeproteinized samples, suggesting that the
steady state changes were stable (Fig. 4B, lines 2 and
3). Under the conditions of the assay, deproteinizing
agents SDS, EDTA and proteinase K had no effect on
the emission intensity of fluorescein as evidenced by
the set where OsDmc1 was omitted in the sample
(Fig. 4B, line 1). In order to confirm that the increase
in the fluorescence signal is specific to the emission
maximum of fluorescein, the donor dye in the FRET
Fig. 4. (A) Time course and OsDmc1 protein concentration depend-
ence of strand exchange reaction monitored by increase in fluo-
rescein emission intensity at 522 nm in arbitrary units. (1) Without
OsDmc1 protein; (2) 1.25 l
M; (3) 2.5 lM; (4) 5.0 lM; (5) 10.0 lM;
and (6) 12.5 l
M of OsDmc1 protein. (B) Effect of deproteinization
on strand exchange reaction mediated by OsDmc1. Fluorescence
was monitored at 522 nm in arbitrary units. Reaction mixture (1)
without OsDmc1 deproteinized after 15 min; (2) with 5.0 l
M
OsDmc1 protein without deproteinization; and (3) with 5.0 lM
OsDmc1 protein with deproteinization after 15 min as indicated in
figure with arrow.
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1502 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS
expected, when OsDmc1 was omitted or homologous
single strand oligonucleotide was replaced with non-
complementary sequence M13C as heterologous con-
trol, no increase in fluorescence intensity was observed,
re-establishing the veracity of the assay to an ongoing
homologous strand exchange activity dependent on
OsDmc1 function (Fig. 6, lines 1 and 6). The results
indicated that the strand exchange activity catalyzed by
OsDmc1 is homology dependent and is facilitated by
ATP and its hydrolysis at kinetic level.
Discussion
We have been studying the biochemistry of OsDmc1
where we have shown earlier [22] that the rice enzyme
exhibits many hallmarks typical of recombinases. In
hydrolysable analogues is much weaker compared to
ATP (lines 2 and 3 versus 4, Fig. 3). This result seems
to suggest that the protein binding mode ⁄ dynamics are
significantly different in these diverse conditions.
OsDmc1 was found to promote strand exchange in a
protein concentration dependent manner. The rate of
strand exchange was highest in ATP and lowest in
conditions that had either no nucleotide cofactor or
had slowly hydrolysable analogues of ATP. The rate
enhancement by the presence of ATP was in the order
of about 15-fold (Fig. 6), strongly suggesting that the
hydrolysis of ATP somehow overcomes the rate limit-
ing barriers in the reaction pathway. The FRET chan-
ges observed were indeed related to stable changes
associated with DNA in the strand exchange reaction
as they were stable to the steps of protein removal
(Fig. 4B). OsDmc1 mediated strand transfer was not
observed when homologous ssDNA oligonucleotide
was replaced with a heterologous sequence oligonucleo-
tide in the assay mixture. From this result we conclu-
ded that the OsDmc1 mediated strand exchange
reaction is homology dependent and is not related to
any contaminating helicase activity spuriously associ-
ated with the purified OsDmc1 preparation. It is rele-
vant to point out that OsDmc1 protein is somewhat
distinct as compared to either human or yeast Dmc1
proteins: while human protein requires ATP to
promote pairing and strand exchange [12] the same is
not true with either OsDmc1 (this study) or yeast
Dmc1 [9]. However, unlike yeast Dmc1 which does not
Our results on renaturation and strand exchange
activities of OsDmc1 showed interesting differences in
protein requirement for optimal activity. As renatura-
tion is an inherent property of complementary strands,
it may not require complete coating of ssDNA with
OsDmc1. Therefore, a protein to nucleotide ratio of as
low as 1 : 20 promoted the complete renaturation. In
contrast, the strand exchange reaction required one
monomer of OsDmc1 for two to three nucleotides,
suggesting that strand exchange probably needs
ssDNA filament saturated with OsDmc1 whereas for
renaturation partially coated ssDNA was sufficient for
optimal activity. These results are in agreement with
the results reported for ScDmc1 [9].
Passy et al. [25] and Masson et al. [26] have demon-
strated that human Dmc1 forms octameric ring like
structures on ssDNA. Recent atomic force microscopy
studies have shown that ScDmc1 forms 90% octameric
ring-like structures as well as 10% helical filaments
upon binding to ssDNA. The helical forms were hypo-
thesized to represent the active form responsible for
recombination reactions [27]. The presence of ATP
was found to result in the formation of helical fila-
ments on ssDNA, whereas in the absence of ATP there
was a preponderance of octameric rings [13]. Recent
studies showed that Ca
2+
enhances the strand
exchange activity of human Dmc1 protein by increas-
ing the affinity of Dmc1 protein to ATP, mediated by
no nucleotide control or slowly hydrolysable analogues
of ATP. The assays that simply measure the steady
state levels of products formed after several minutes of
the reaction will fail to detect these important changes,
which sometimes contribute to conflicting results on
strand exchange versus nucleotide cofactor effects.
Nevertheless, the kinetic assay described here is a sim-
ple and generally applicable one that will be used in
our future studies to understand the mechanistic
details of OsDmc1 function compared to ATP hydro-
lysis rates as well as OsDmc1 changes in the presence
of its functional interactors.
Experimental procedures
Materials
Oligonucleotides (55-mers) for strand exchange assay were
synthesized by Metabion (Martinsreid, Germany) with the
following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA
AAATAATCAGCGTGACATTCAGAAGGGTAATAAG
AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA
TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢
and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA
CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. Phi-C
and Phi-W were complementary to each other. Phi-C was
labeled with rhodamine at the 3¢ end and Phi-W was labe-
led with fluorescein at the 5¢ end. M13C was used as the
heterologous strand in the strand exchange assay.
cDNA for OsDmc1 protein was obtained from rice anthers
by RT-PCR and was cloned previously in pET28a, intro-
duced into E. coli BL21(DE3) expression cells. Protein was
overexpressed by 1.0 mm isopropyl thio-b-d-galactoside [21].
some assays as mentioned in figure legends.
To show that the observed renaturation activity was
homology dependent, we carried out the following compet-
itive FRET assay. In the standard renaturation assay,
oligonucleotide Phi-W (27.5 lm of nucleotides) labeled with
fluorescein at the 5¢ end was preincubated with 1.25 lm of
OsDmc1 at 37 °C for 5 min. Phi-C oligonucleotide
(27.5 lm of nucleotides) labeled with rhodamine at the 3¢
end was premixed with either unlabelled Phi-C as homolog-
ous competitor (0, 27.5, 55.0 lm of nucleotides) or unla-
belled M13C as heterologous competitor (27.5, 55.0 lm),
followed by its addition to the reaction mixture. The extent
of homologous versus heterologous competition in FRET
was monitored by the decrease in the fluorescein emission
intensity at 522 nm after 5 min. FRET efficiencies were cal-
culated by subtracting the fluorescence value obtained at
5 min from that of 0 min. Therefore the measured efficien-
cies stem from direct readouts of fluorescence emission.
Strand exchange assay
Strand exchange activity was monitored essentially accord-
ing to the procedure mentioned by Gupta et al. [12]. A
reaction mixture (100 lL) containing 20 mm HEPES
(pH 7.9), 2 mm ATP, 10.0 mm MgCl
2
, 3.0% (w ⁄ v) gly-
cerol, 1.0 mm dithiothreitol and different concentration of
OsDmc1 was preincubated with unlabeled Phi-C oligo-
nucleotide (27.5 l m of nucleotides) for 5 min at 37 °C.
Duplex 55-mer made from fluorescein labeled Phi-W and
rhodamine labeled Phi-C was added (27.5 lm of nucleo-
References
1 Kowalczykowski SC, Dixon DA, Eggleston AK,
Lauder SD & Rehrauer WM (1994) Biochemistry of
homologous recombination E. coli. Microbiol Rev 58,
401–465.
2 Masson JY & West SC (2001) The Rad51 and Dmc1
recombinases: a non-identical twin relationship. Trends
Biochem Sci 26, 131–136.
3 Sung P, Krejci L, Van Komen S & Sehorn MG (2003)
Rad51 recombinase and recombination mediators.
J Biol Chem 278, 42729–42732.
4 Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K,
Sekiguchi M, Matsushiro A, Yoshimura Y & Morita T
(1996) Targeted disruption of the Rad51 gene leads to
lethality in embryonic mice. Proc Natl Acad Sci USA
93, 6236–6240.
5 Bishop DK, Park D, Xu L & Kleckner N (1992)
DMC1: a meiosis-specific yeast homolog of E. coli recA
required for recombination, synaptonemal complex for-
mation, and cell cycle progression. Cell 69, 439–456.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1505
6 Yoshida K, Kondoh G, Matsuda Y, Habu T, Nishi-
mune Y & Morita T (1998) The mouse RecA-like gene
Dmc1 is required for homologous chromosome synopsis
during meiosis. Mol Cell 1, 707–718.
7 Pittman DL, Cobb J, Schimenti KJ, Wilson LA, Cooper
DM, Brignull E, Handel MA & Schimenti JC (1998)
Meiotic prophase arrest with failure of chromosome
synapsis in mice deficient for Dmc1, a germline-specific
characterization of a yeast gene that is homologous with
a meiosis specific cDNA from a plant. Mol Gen Genet
237, 225–232.
15 Kobayashi T, Kobayashi E, Sato S, Hotta Y, Miyajima
N, Tanaka A & Tabata S (1994) Characterization of
cDNAs induced in meiotic prophase in lily microsporo-
cytes. DNA Res 1, 15–26.
16 Sato S, Hotta Y & Tabata S (1995) Structural analysis
of a recA-like gene in the genome of Arabidopsis thali-
ana. DNA Res 2, 89–93.
17 Doutriaux MP, Couteau F, Bergounioux C & White C
(1998) Isolation and characterisation of the RAD51 and
DMC1 homologues from Arabidopsis thaliana. Mol Gen
Genet 257, 283–291.
18 Shimazu JC, Matsukura M, Senda R, Ishikawa S,
Akada T, Harada T & Niizeki M (2001) Characteriza-
tion of a DMC1 homologue, RiLIM15, in meiotic pani-
cles, mitotic cultured cells and mature leaves of rice
(Oryza sativa L.). Theor Appl Genet 102, 1159–1163.
19 Ding Z, Wang T, Chong K & Bai S (2001) Isolation
and characterization of OsDMC1, the rice homologue
of the yeast DMC1 gene essential for meiosis. Sex Plant
Reprod 13, 285–288.
20 Kathiresan A, Khush GS & Bennett J (2002) Two rice
DMC1 genes are differentially expressed during meiosis
and during haploid and diploid mitosis. Sex Plant
Reprod 14, 257–267.
21 Metkar SS, Sainis JK & Mahajan SK (2004) Cloning
and characterization of the DMC1 genes in Oryza
sativa. Curr Sci 87, 353–357.
recognition and triplex formation promoted by RecA
protein between duplex oligonucleotides and single-
stranded DNA. J Mol Biol 229, 328–343.
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1506 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS