Fatty acid synthesis
Role of active site histidines and lysine in Cys-His-His-type
b-ketoacyl-acyl carrier protein synthases
Penny von Wettstein-Knowles
1
, Johan G. Olsen
2
, Kirsten A. McGuire
1
and Anette Henriksen
2
1 Genetics Department, Molecular Biology and Physiology Institute, Copenhagen University, Denmark
2 Biostructure Group, Carlsberg Laboratory, Copenhagen, Denmark
The formation of carbon–carbon bonds is a funda-
mental biochemical reaction. A number of enzymes
involved in various biosynthetic pathways accomplish
this by different means. Among these is a large family
of enzymes involved in synthesis of fatty acids, waxes,
flavins, natural drugs, and antibiotics making carbon–
carbon bonds by use of the Claisen condensation prin-
ciple. Initially, an active site nucleophile induces a
transesterification by nucleophilic attack on an acyl-
thioester substrate. In the second step, a b-carbanion
thioester is generated by either proton abstraction or
decarboxylation. This strong nucleophile then attacks
the carbonyl carbon of the first ester, resulting in a
b-keto product (Scheme I). b-Ketoacyl-acyl carrier
protein (ACP) synthase {3-oxoacyl-[acyl-carrier-pro-
tein] synthase (E.C. 2.3.1.41)} I (KAS I) and KAS II
from Escherichia coli represent a set of decarboxylating
condensing enzymes, which we refer to as the CHH
rial b-ketoacyl-ACP synthase, bacterial plus plastid b-ketoacyl-ACP
synthases I and II, and a domain of human fatty acid synthase, have a
Cys-His-His triad and also a completely conserved Lys in the active site.
To examine the role of these residues in catalysis, H298Q, H298E and six
K328 mutants of Escherichia coli b-ketoacyl-ACP synthase I were construc-
ted and their ability to carry out the trans thioesterification, decarboxyla-
tion and ⁄ or condensation steps of the reaction was ascertained. The crystal
structures of wild-type and eight mutant enzymes with and ⁄ or without
bound substrate were determined. The H298E enzyme shows residual
decarboxylase activity in the pH range 6–8, whereas the H298Q enzyme
appears to be completely decarboxylation deficient, showing that H298
serves as a catalytic base in the decarboxylation step. Lys328 has a dual
role in catalysis: its charge influences acyl transfer to the active site Cys,
and the steric restraint imposed on H333 is of critical importance for
decarboxylation activity. This restraint makes H333 an obligate hydrogen
bond donor at N
e
, directed only towards the active site and malonyl-ACP
binding area in the fatty acid complex.
Abbreviations
ACP, acyl carrier protein; KAS, b-ketoacyl-ACP synthase; WT–C8, KAS I–octanoyl complex.
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 695
group because of the cysteine and two histidine active-
site residues [1–3]. Another group of decarboxylating
condensing enzymes called CHN (N for asparagine),
represented by KAS III and certain polyketide synth-
ases [4–6], catalyze a similar three-step reaction with
an active site composed of a cysteine nucleophile, a
histidine and an asparagine. Although CHN enzymes
have a substantially altered active site structure and
exact role of the conserved residues in CHH enzymes
has not emerged [1–5,8,9,12].
In recent years, condensing enzymes have enjoyed
substantial commercial interest. The efficiency and pre-
cision with which these various enzymes carry out syn-
thesis of rather complicated molecules such as ring
systems [13] and wax components [14] are attractive
properties for drug synthesis research. The fatty acid
condensing enzymes have also come into focus as
targets for new antibiotics [6,15–18] and in cancer
treatment [19,20]. A description of the exact role, elec-
trostatic properties, and hydrogen bonding potentials
of active site residues provides an optimized model of
the ligand-binding potential of the active site, enabling
differentiation between the active site properties of
target enzymes to be made. This study probes the roles
of the active site histidines and lysine in the CHH con-
densing enzyme KAS I from E. coli by use of crystal
structures of active site mutants and biochemical
characterization of the acyl transfer, decarboxylation
and ⁄ or condensation steps of the reaction performed
by these mutants.
The results establish that the CHH reaction mechan-
ism is different from that of the CHN enzymes. They
reveal that: (a) K328 imposes steric restraints on H333
that are necessary for maintenance of the hydrogen
bond network required for decarboxylation, and that
its positive charge influences acyl transfer to the active-
site cysteine; (b) H298 functions as a catalytic base in
the decarboxylation reaction, and (c) H333 stabilizes
leprae KAS I and II [23,24]).
Scheme 1.
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
696 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS
The two subunits of the KAS I homodimer have
slightly larger than average discrepancies in the atomic
positions in the segments 318–323 (r.m.s.d. ¼ 0.7 A
˚
)
and 367–373 (r.m.s.d. ¼ 0.8 A
˚
) in an overall super-
imposition (overall average r.m.s.d. ¼ 0.3 A
˚
). In this
respect the subunit pairs AC and BD have smaller
r.m.s.d. values between backbone atoms than other
combinations of subunit pairs. The two segments of
the AC and BD dimer are involved in crystal packing
at the AC interface, and the observed structural diver-
sity is unlikely to be of biochemical significance. The
same is true for the mutated KAS I structures.
The distance between H333 N
e
and C163 S
c
is 3.2 A
˚
and 3.1 A
˚
), and the other to the O
c
atom
of T300 (2.9 A
˚
). T300 is reoriented (Fig. 3C,D,E) and
cannot contribute to malonyl-ACP binding as proposed
on the basis of the C163S structure [3]. T302 does not
change orientation (Fig. 3D). The orientation of the
conserved active site residues H333 and K328 are not
affected by the H298E mutation (Fig. 3C). H333 is
hydrogen bonded to the backbone N of L335, making it
a potential hydrogen bond donor to the active site, and
probably lowers its pK
a
considerably. K328 shares a
bidentate hydrogen bond with E342 and is within
hydrogen bond distance of the E298 backbone O
(Fig. 3D).
The H298E–C12 structure (Fig. 3E) is the same as
that of H298E except that an extra water molecule
appears well defined in the active site. A water mole-
cule in this position is also present in some of the sub-
units in the H298E structure, which is of considerably
poorer quality (R ⁄ R
free
¼ 21.7 ⁄ 27.2; Table 1 [26]). The
formation of the acyl–thioester bond in the H298E–
C12 structure has no impact on the orientation of
T300 (Fig. 3D versus Fig. 3E).
cant variations in orientations, but the position of the
390–394 backbone is shifted. The largest effect is seen
for residue F390, which is shifted by 0.9 A
˚
(Fig. 3H).
The formation of the H298Q–C12 complex
(Fig. 3G) induces side-chain reorientation of residue
298Q (Fig. 3H), a shift in the position of the 390–394
backbone (Fig. 3H) to that found in the H298E ⁄
H298E–C12 structures, and a side-chain reorientation
Fig. 3. The active sites of the wild-type KAS I, its H298 mutants and their acyl complexes. (A) Wild-type. (B) WT–C8. (C) Superimposition of
the wild-type (white, light colors) and H298E (orange, dark colors). (D) H298E. (E) H298E–C12. (F) H298Q. (G) H298Q–C12. (H) Superimposi-
tion of H298Q and H298Q–C12. In (A, B) and (D–G), water molecules (red spheres) within hydrogen bonding distance are indicated with
dashed lines. (H) Superimposition of H298Q (orange, dark colors) and H298Q–C12 (white, light colors) not including water molecules. Figure
prepared using
PYMOL [42].
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
698 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS
of T300 to that resembling the orientation found in
the structure of the native enzyme and the WT–C8
complex (Fig. 3A,B,G). A water molecule is found
between H333 N
e
and F390 N in three of the four sub-
units of H298Q–C12 (Fig. 3G). It is not possible to
unambiguously determine the hydrogen bonding
pattern in the active site of the H298Q complex, but
dotted lines have been included to atoms within hydro-
gen bonding distance in Fig. 3G.
Structure of KAS I K328A
and C163 S
c
(3.2 A
˚
) in the
mutant is very similar to the 3.3 A
˚
found in the wild-
type and infers that H333 N
e
donates a hydrogen bond
to the nucleophile, although the Cys163 C
b
–Cys163
S
c
–His333 N
e
angle (79°) is less favorable than in the
wild-type (87°) [25]. Thus, we have introduced an
ammonium ion at this solvent site in our model, an
assignment that is further justified by the fact that the
crystals were obtained in the presence of 1.9 m
(NH
4
)
2
SO
4
.
8.6 (25.0)
b
6.5 (19.8)
b
9.2 (19.3)
b
6.1 (14.3)
b
Average I ⁄ rI 8.4 4.4 9.5 6.8 5.0 6.6 10.3 6.1 11.2
Average redundancy 6.6 2.2 4.3 4.5 2.9 5.8 2.7 4.3 3.5
Completeness 91.2 (80.3)
b
89.9 (60.8)
b
96.1 (75.2)
b
94.8 (80.7)
b
88.2 (72.7)
b
98.1 (96.9)
b
96.8 (86.8)
b
98.1 (92.8)
b
90.8 (90.1)
b
R
factor
c
R
factor
¼ S(|Fo|–|Fc|) ⁄S|Fo|.
d
R
free
is the same as R
factor
, but calculated with the 5% of the total number of observations not used in the refinement.
e
As determined from a Luzzati plot [26]. WT, wild-type.
P. von Wettstein-Knowles et al. Histidines and lysine in KAS I ⁄ KAS II catalysis
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 699
cule as in the unbound K328A structure. Interest-
ingly, the water ⁄ ion structure around H298 changes
when the fatty acid is bound to K328A (Fig. 4B), in
contrast with the wild-type case (Fig. 3B). Contrary
to the situation in K328A (Fig. 4A), any suggestions
as to the nature of the solvent molecule found
between E342 and H333 cannot be justified, because
position and potential hydrogen bonds are shifted
(Fig. 4B). A water molecule has been included in the
model at this position.
Structure of KAS I K328R
Four subunits arranged in two dimers, AB and CD,
form the KAS I asymmetric unit in the P2
1
2
1
g1
rather than via N
e
(Fig. 5B). The
H333 rotamer falls between the wild-type orientation
and the orientation observed in K328A, with N
d
being oriented more towards the backbone N of resi-
due 335 (on average the H333 N
d
–L335 N distance
is 3.9 A
˚
in subunit A and C versus 3.5 A
˚
in subunit
B and D). Nevertheless, the shortest interatomic dis-
tance from H333 N
d
to R328 N
g1
is on average
2.9 A
˚
with the average H333 N
e
–C163 S
c
distance
being 3.2 A
by red spheres.
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
700 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS
Decarboxylation of malonyl-ACP by wild-type
and mutant KAS I proteins
The ability of the wild-type and mutant KAS I proteins
to form acetyl-ACP from malonyl-ACP (Scheme 1) was
measured by visualizing the decarboxylation of
[2-
14
C]malonyl-ACP to [2-
14
C]acetyl-ACP. In the assay,
the substrate is synthesized from radiolabeled malonyl-
CoA and ACP by malonyl-CoA–ACP transacylase
before the addition of the KAS protein to be tested.
The amount of labeled substrate generated was inde-
pendent of pH over the tested range (3–8), generating
adequate substrate for the decarboxylation reaction, as
illustrated in Fig. 6A for pH 6.8 and 4, lanes 1 and 10,
respectively. Figure 6A (lanes 2–5) illustrates for the
wild-type enzyme the rapid decrease in the malonyl-
ACP substrate and the much slower appearance of the
product acetyl-ACP at pH 6.8 in assays from 1 to
30 min in length. Analogous results were obtained at
pH 6 and 8. Reducing the pH to 5 results in slower loss
of the malonyl-ACP substrate (compare Fig. 6A, lanes
2 and 6), and only at 30 min can the acetyl-ACP prod-
uct be detected (Fig. 6A, lanes 6–9). At pH 4 loss of the
malonyl-ACP substrate was first visible in the 30 min
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 701
periods observed between malonyl-ACP disappearance
and acetyl-ACP appearance in the present experiments
rule out the triacetic acid lactone hypothesis, as triace-
tic acid lactone cannot breakdown to give acetyl-ACP.
Either the acetyl carbanion has a significant lifetime in
the absence of an acyl acceptor or it is transferred to
an unknown, nonprecipitable intermediate before for-
mation of acetyl-ACP. Additional studies will be
required to unravel this unexpected phenomenon. In
the present experiments, loss of substrate gives an
unambiguous picture of the enzyme’s ability to decarb-
oxylate the extender substrate.
At pH 6.8 in 30 min assays, the H298E mutant
evinced only a slight decrease in the malonyl-ACP sub-
strate unaccompanied by formation of acetyl-ACP
(Fig. 6B, lanes 4 and 5), which can be compared with
the wild-type activity (lanes 2 and 3). The H298E
activity is about the same as that exhibited by the
wild-type enzyme at pH 5 in assays approaching
30 min in length (Fig. 6A, lanes 8 and 9), or better
than the wild-type activity at pH 4 in 30 min assays
(Fig. 6A, lane 14). At and below pH 5, H298E was
inactive even in 60 min assays, as was H298Q in the
pH range tested (pH 6–8; Fig. 6B, lanes 6 and 7).
Thus, H298E is able to decarboxylate at pH 6.8, albeit
with a much reduced efficiency compared with the
wild-type, whereas H298Q appears to be totally inhib-
ited.
The decarboxylase assays with the K328 mutants
A
B
Fig. 6. Decarboxylation activities of the wild-type KAS I and H298 mutants. Reactions were carried out as detailed in Experimental proce-
dures. (A) Time courses (0–30 min) of [2-
14
C]malonyl-ACP (Mal-ACP) decarboxylation to acetyl-ACP (Ac-ACP) by 5 lM wild-type at pH 6.8, 5
and 4. The amount of labeled malonyl substrate generated at pH 6.8 and 4 and present at the start of the reactions are shown at time 0 in
lanes 1 and 10, respectively. (B) Decarboxylation at pH 6.8 by two different amounts of wild-type, H298E and H298Q proteins in 30 min
assays. The amount of labeled substrate present at the start of the reactions is shown in the first lane. C is a standard consisting of malo-
nyl-ACP and acetyl-ACP (lane 8). WT, wild-type.
0.1
2.2 4.38.6 4.94.3 2.2 2.20 9.7 8.70.8
Mal-ACP
Ac-ACP
154311121028769
A
µM
WT
30
K328H
30
K328R
30
C163A
10
min
10
B
8.7
3.6 4.32.2 4.37.1 2.2 2.24.3 8.7 8.70
K328R, and the bulky mutant, K328F, evinced some
activity (Fig. 7A, lanes 7–12, and Fig. 7B, lanes 2–4).
By comparison, the acidic mutant K328E and to a les-
ser extent the bulky mutant K328I appear totally
decarboxylation deficient (Fig. 7B, lanes 5–10), which
is characteristic for K328A (lanes 11–13) as shown pre-
viously in 10 min assays [9]. Only trace amounts of
label are seen in the position characteristic of acetyl-
ACP in the K328I and K328E lanes. That more sub-
strate appeared to be present in some of the assay
lanes than at the start of the assay (Fig. 7B, lane 1)
results from the continued activity of the malonyl-
CoA–ACP transacylase.
To summarize, the K328 isoleucine, glutamic acid
and alanine mutants appear to totally lack decarboxy-
lation activity, whereas the histidine, arginine and phe-
nylalanine mutants are active, although less efficient
than the wild-type.
Transfer of fatty acid from ACP to the wild-type
and K328 mutant KAS I protein
The initial step in the Claisen condensation carried out
by a CHH group enzyme is transfer of the acyl sub-
strate from the phosphopantetheine arm of ACP to its
active site cysteine (Scheme 1). With the use of ACP
carrying
3
H-labeled myristate (C
14
fatty acid), this
transfer can be readily monitored with the aid of a
K328I are similar to the wild-type (91% and 117%).
Increasing the assay time resulted in an increase in
transfer to the acidic and bulky mutants, so that by
120 min all three were somewhat more efficient than
the wild-type (130–145%). That the acidic and basic
mutant enzymes accept myristate more readily than
the wild-type is in accord with the observation that
they, like K328A, are insensitive to ACP inhibition.
This infers that the bulky mutants are unlikely to be
inhibited by ACP as they also accept more myristate
than the wild-type. Detailed analyses of the bulky
mutants revealed apparent sigmoidal kinetics for trans-
fer (data not shown), but with much lower slopes than
that characterizing the K328A mutant [9]. In these
assays, when maximum transfer was reached, the
transfer efficiencies were similar to that of the wild-
type (99% and 118%).
Whereas carrying out the assays on ice had no effect
on the wild-type, the transfer efficiencies of the mutant
proteins were impeded at the lower temperature
(Table 2). Although the K328H and K328R mutants
had considerable activity at 4 °C (142% and 82% of
Table 2. Transfer of [
3
H]myristate from ACP to wild-type and
Lys328 mutant KAS I proteins. The percentage myristic acid (C
14
)
transferred from C
14
c
7.5 8.5 9.3 tr
a
Sensitive to ACP;
b
not sensitive to ACP;
c
sensitivity to ACP not
determined.
P. von Wettstein-Knowles et al. Histidines and lysine in KAS I ⁄ KAS II catalysis
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 703
that of the wild-type), this was only 58% and 35% of
their activity at 22 °C. At best, a trace of activity
(< 0.1% of that of the wild-type) was detected for the
other four mutants. For all six mutants, adding of
additional KAS protein to the assay resulted in
increased transfer, albeit with lower efficiencies. For
example, 12 lg K328F and K328I gave 7.3% and
17.9% transfer, respectively. The K328A mutant
exhibited only 4% transfer with 15.7 lg protein in a
30 min assay, and K328E 10% with 68 lgina2h
assay. Combined, these results indicate that a posi-
tively charged residue at position 328 is an important
factor for efficient transacylation activity, especially at
4 °C.
Elongation activity of the wild-type and K328
mutant KAS I proteins
The transfer and decarboxylation partial reactions
characterizing the six K328 mutants, as described
above, differ from their respective wild-type partial
ive site. This binding site is unaffected by the H298
mutations and is conserved in all published KAS I and
KAS II sequences. The nature of the bound cation has
been determined based on the refined B-factors, the
electron density level, and the hydrogen bond distan-
ces. Models of NH
4
+
,Na
+
and K
+
were constructed,
and the NH
4
+
model best fitted the observed electron
density. The cation site can be detected in all published
CHH class structures [2,3], but has only been described
as a cation site in the crystal structure of Streptococcus
pneumoniae KAS II [30] and in the structure of mito-
chondrial KAS from Arabidopsis thaliana [31]. The
crystals of S. pneumoniae KAS II were grown in the
presence of 250 mm magnesium acetate and revealed a
magnesium ion in this site, whereas the cation in the
mitochondrial KAS structure grown in 1.6 m
(NH
4
)
2
Fig. 8. Ability of the wild-type and mutant K328 KAS I proteins to
enable synthesis of fatty acyl-ACPs by soluble protein extracts of the
E. coli mutant strain CY244 under restrictive conditions. The reaction
was carried out as described in Experimental procedures for 30 min
at 42 °C with 0.015–1.11 lg KAS protein per assay. After resolution
of the ACP species by electrophoresis on conformationally sensitive
13.3% polyacrylamide ⁄ 4
M urea gels, the proteins were blotted to a
poly(vinylidene difluoride) membrane followed by autoradiography.
Addition of up to 1.11 lg K328F, K328I, K328E and K328A mutant
proteins gave the same result as when no KAS protein (O) was
added. M ¼ marker,
14
C
16
-ACP. WT, wild-type.
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
704 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS
sensitivity of KAS I to ACP. Thus far, the last of these
is the only factor identified that can explain why not all
of the wild-type enzyme in an assay actually reacts with
acyl-ACP to form the fatty acid–enzyme complex [9].
The reaction is irreversible under the present conditions
[9]. Interestingly, all the K328 mutants exhibited a
higher efficiency of transfer than the wild-type. The sig-
nificance of this observation is not immediately appar-
ent, as transfer by the four tested lysine mutants (Ala,
His, Arg, Glu) is not influenced by free ACP whereas
transfer by the wild-type is. A future introduction of
analogous mutants in KAS II, a CHH group enzyme
the carbanion intermediate. The conserved K328 was
thought to play a structural rather than functional
role. Moche and coworkers [2] later found that the
proximity between the conserved lysine and the H298
equivalent in the 1.5 A
˚
resolution structure of KAS II
from Synechocystis sp., in which no water molecule is
found between H298 and K328, indicated that H298
was unsuitable as proton acceptor. Olsen et al. [3] sug-
gested that K328 was functional in catalysis through
its interaction with H298. This model hypothesized
that hydroxide ion like properties of the solvent mole-
cule, found between K328 and H298 N
d
in KAS I and
most KAS II structures, enabled His298 to function as
a general base in decarboxylation. Price et al. [12] pro-
posed that decarboxylation followed similar mecha-
nisms in CHH and CHN enzymes, and that both
active site histidines donated a hydrogen bond to the
malonyl-ACP thioester oxo group, hence no acid-base
catalysis. Subsequently, Witkowski and coworkers [8]
proposed a decarboxylation mechanism whereby the
rat fatty acid synthase equivalent of KAS I H333 is
protonated and acts as a catalytic acid in decarboxyla-
tion, whereas the KAS I H298 equivalent donates a
hydrogen bond to the malonate carboxylate group in
the same process. This mechanism includes a nucleo-
philic attack by a water molecule on C3 of the malonyl
plexes and the critical influence that the orientation of
H333 has on decarboxylation shows that H333 is an
obligate hydrogen bond donor at N
e
, directed only
towards the active site and malonyl-ACP binding area
in the fatty acid complex. The hydrogen bond between
the L335 backbone nitrogen and H333 N
d
makes it
unlikely that H333 participates in catalysis as an acid
or base.
Compared with the role of H333, that of H298
has been an enigma, especially in decarboxylation.
P. von Wettstein-Knowles et al. Histidines and lysine in KAS I ⁄ KAS II catalysis
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 705
Recently, bioinformatics and biochemical studies have
substantiated the notion that the two active site histi-
dines in CHH condensing enzymes have chemically dif-
ferent roles in catalysis [8,34]. H298Q mimics the
nonprotonated state of H298 by having the ability to
both donate and accept a hydrogen bond, but does not
mimic its ability to act as a Brønsted base at physiologi-
cal pH values. H298E mimics the nonprotonated state
of H298 by having the ability to act as a base. That
H298E appears to be totally lacking in decarboxylase
activity below pH 6 as does the H298Q enzyme at all
investigated pHs, whereas the wild-type enzyme retains
a vestige of activity at pH 4 demonstrates that decarb-
oxylase activity depends on the presence of a base at
H298. Possibly the positive charge of K328 is of signi-
ficance for optimal decarboxylation efficiency through
the interactions with conserved E342 and the cation
site, but the present combined structural and kinetic
study only identifies an effect of a positive charge at
the K328 position on the transfer reaction.
An interesting aspect of the H298E mutation is the
orientation of the T300 ⁄ T302 side chains. Both have
been implicated in the binding of ACP [2], probably
by donating hydrogen bonds to one of the carbonyl
oxygens in malonyl-ACP, thereby stabilizing charge
relocalization during catalysis [3]. One reason for the
low decarboxylation activity of H298E could well
be the reorientation of T300 in both the native and the
acyl-bound enzyme, resulting in a lower affinity for the
substrate and inadequate stabilization of charge relo-
calization for decarboxylation.
Experimental procedures
Cloning
The pQE30-fabB plasmid used for mutagenesis and expres-
sion of E. coli KAS I has been described. The mutagenesis
procedure for making the K328 mutant detailed previously
[9] was used to construct seven additional mutants using
the following primers plus their complements:
H298E, CGATTACCTGAACTCCGAGGGTACTTCGA
CTCCG
H298Q, CGATTACCTGAACTCCCAGGGTACTTCGAG
TCCG
K328H, (5¢-GGCGATTTCTGCAACCCACGCCATGAC
CGGTCAC-3¢)
is 42, and increasing the concentration beyond 6 lg wild-type
KAS I per assay does not increase the percentage transfer. In
the present experiments, a molecular ratio of 10 : 1 KAS to
acyl-ACP was used. Previous work has shown that transfer is
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
706 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS
not an equilibrium reaction, i.e. the bound acyl chain is not
released from the enzyme. One of the factors contributing to
this phenomenon is inhibition by the free ACP released [9].
The reaction mixture was resolved into [
3
H]myristoyl-ACP
and [
3
H]KAS by size-exclusion chromatography, and the
fractions subjected to liquid scintillation using either a Beck-
man L#1701 or an LKB-Wallac 1219 Rackbeta instrument.
Sensitivity of the transfer reaction to ACP was tested by add-
ing 0.17 lm (10 pmol per assay) ACP before addition of
KAS as described previously [9]. Assays were carried out in
triplicate, and the mean values in the presence and absence of
ACP compared. (b) The decarboxylase assay measures the
ability of KAS protein to decarboxylate the donor substrate
malonyl-ACP, forming the acceptor primer acetyl-ACP.
[
14
C]Malonyl-ACP was generated from 12 lm ACP and
10.1 lm [
14
C]malonyl-CoA (10 000 dpmÆnmol
fied KAS protein. After 30 min at 42 °C, the acyl-ACPs were
precipitated and analyzed as described above except that 4 m
urea ⁄ polyacrylamide gels were used. [1-
14
C]Palmitoyl-ACP
(1250 cpm) was included on the gels as standard.
Expression, purification and crystallization
After induction the cells were opened by five freeze ⁄ thaw
cycles. The insoluble fraction was sedimented by centrifuga-
tion at 4000 g for 90 min, and the supernatant loaded on to
a 1-mL HiTrap chelating column (Amersham-Pharmacia) in
buffer A containing 30 mm sodium phosphate, 500 mm
NaCl, and 50 mm imidazole (pH 7.4). The protein was elut-
ed in a linear gradient of 0–100% buffer B (as buffer A plus
500 mm imidazole) in 10 column volumes. The protein was
eluted as a single peak at 25–30% buffer B. The peak frac-
tion was desalted into buffer C containing 25 mm Trizma,
2mm EDTA and 1 mm dithiothreitol, pH 8.0, using a Hi-
Prep 26 ⁄ 10 Sephadex G-25 column. After this, the protein
was loaded on to an anion-exchange column, Mono Q
10 ⁄ 10, in buffer C and eluted in a linear gradient of 0–100%
buffer D (as buffer C with 1 m NaCl). The protein was elut-
ed as two peaks at 12% and 16% buffer D, of which the
earliest (low salt) peak was two to three times as large as the
other. The low salt peak was desalted into buffer C and
concentrated to 14.0 mg proteinÆmL
)1
, as calculated from
the theoretical extinction coefficient (e
280
mutants was collected at the MAXLAB, Lund, Sweden at
beam line I711. A D/ ¼ 0.2 ° was used. The data collection
strategy option in Mosflm [37] was used to determine the
optimal / angle span. K328A crystal diffraction data were
collected at the ESRF in Grenoble, France at the ID14.4
beam line (k ¼ 0.97 A
˚
) on a single crystal. The crystal to
detector distance was 150 mm (D/ ¼ 0.25 °). With these
settings spot overlap was not a problem. The K328A–C12
complex data were recorded from a single crystal at the
ESRF ID29 beam line (k ¼ 0.91 A
˚
). The crystal was trans-
lated vertically three times during data collection to avoid
the radiation damage that was readily observable in the dif-
fraction pattern. The data were collected using D/ ¼ 0.50 °
for the first and last run and 0.3 ° for the second run.
Wild-type and WT–C8 complex data were collected on sin-
gle crystals on an in-house Rigaku RU300 generator with
rotating Cobber anode, osmic mirrors, and an R-AXIS
IV++ image plate system. These data were collected with
a crystal to detector distance of 150 mm and a D/ ¼ 0.2 °.
Before data collection, the crystals were cooled to 100 K in
a stream of gaseous N
2
after a 1 min incubation in a
P. von Wettstein-Knowles et al. Histidines and lysine in KAS I ⁄ KAS II catalysis
FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 707
cryo-protectant containing 28% (v ⁄ v) glycerol, 2% (w⁄ v)
derived from the KAS I K328A model, again excluding
water molecules and ions. Noncrystallographic symmetry
matrices were determined after rigid body refinement in cns
version 1.1 [26], and the relevant amino acid substitutions
made according to the resulting 2|F
o
|–|F
c
| electron density.
Water molecules were added to the models using the auto-
mated procedure in cns. The peak search was performed in
a2|F
o
|–|F
c
| map using a 1.2 r peak height cut-off and dis-
tance constraints based on hydrogen bonding distance
potential. Water molecules were then inspected individually
by eye in the graphics program O [40]. Additional refine-
ment was performed in cns using maximum likelihood
refinement on amplitudes with simulated annealing and
restrained individual B factor refinement. A noncrystallo-
graphic symmetry restraint value of 50 kcalÆmol
)1
ÆA
˚
)2
gave
the lowest value for R
free
1 Huang W, Jia J, Edwards P, Dehesh K, Schneider G &
Lindqvist Y (1998) Crystal structure of b-ketoacyl-acyl
carrier protein synthase II from E. coli reveals the
molecular architecture of condensing enzymes. EMBO J
17, 1183–1191.
2 Moche M, Dehesh K, Edwards P & Lindqvist Y (2001)
The crystal structure of b-ketoacyl-acyl carrier protein
synthase II from Synechocystis sp. at 1.54 A
˚
resolution
and its relationship to other condensing enzymes. J Mol
Biol 305, 491–503.
3 Olsen JG, Kadziola A, von Wettstein-Knowles P, Sigg-
aard-Andersen M & Larsen S (2001) Structures of
b-ketoacyl-acyl carrier protein synthase I complexed
with fatty acids elucidate its catalytic machinery. Struc-
ture 9, 233–243.
4 Qiu X, Janson CA, Konstantinidis AK, Nwagwu S,
Silverman C, Smith WW, Khandekar S, Lonsdale J &
Abdel-Meguid SS (1999) Crystal structure of b-ketoa-
cyl-acyl carrier protein synthase III. A key condensing
enzyme in bacterial fatty acid biosynthesis. J Biol Chem
274, 36465–36471.
5 Davies C, Heath RJ, White SW & Rock CO (2000) The
1.8 A
˚
crystal structure and active site architecture of
b-ketoacyl-acyl carrier protein synthase III (FabH) from
Escherichia coli. Structure 8, 185–195.
6 Scarsdale JN, Kazanina G, He X, Reynolds KA &
11 Olsen JG, Kadziola A, von Wettstein-Knowles P, Sigg-
aard-Andersen M, Lindquist Y & Larsen S (1999) The
X-ray crystal structure of b-ketoacyl [acyl carrier pro-
tein] synthase I. FEBS Lett 460, 46–52.
12 Price AC, Choi K-H, Heath RJ, Li Z, White SW &
Rock CO (2001) Inhibition of b-ketoacyl-acyl carrier
protein synthases by thiolactomycin and cerulenin.
Structure and mechanism. J Biol Chem 276 , 6551–6559.
13 Shen B (2003) Polyketide biosynthesis beyond the type
I, II and III polyketide synthase paradigms. Curr Opin
Chem Biol 7, 285–295.
14 Kunst L & Samuels AL (2003) Biosynthesis and secre-
tion of plant cuticular wax. Prog Lipid Res 42, 51–80.
15 Mdluli K, Slayden RA, Zhu Y, Ramaswamy S, Pan X,
Mead D, Crane DD, Musser JM & Barry CE III (1998)
Inhibition of a Mycobacterium tuberculosis b-ketoacyl
ACP synthase by isoniazid. Science 280, 1607–1610.
16 Heath RJ, White SW & Rock CO (2001) Lipid bio-
synthesis as a target for antibacterial agents. Prog Lipid
Res 40, 467–497.
17 Jones AL, Herbert D, Rutter AJ, Dancer JE & Har-
wood JL (2000) Novel inhibitors of the condensing
enzymes of the type II fatty acid synthase of pea (Pisum
sativum). Biochem J 347, 205–209.
18 Schaeffer ML, Agnihotri G, Volker C, Kallender H,
Brennan PJ & Lonsdale JT (2001) Purification and bio-
chemical characterization of the Mycobacterium tubercu-
losis b-ketoacyl-acyl carrier protein synthases KasA and
KasB. J Biol Chem 276, 47029–47037.
19 Rendina AR & Cheng D (2005) Characterization of the
26 Bru
¨
nger AT, Adams PD, Clore GM, DeLano WL, Gros
P, Grosse-Kunstleve RW, Jiang J-S, Kuszewski J, Nilges
M, Pannu NS, et al. (1998) Crystallography & NMR sys-
tem: a new software suite for macromolecular structure
determination. Acta Crystallogr D 54, 905–921.
27 von Wettstein-Knowles P, Olsen JG, McGuire KA &
Larsen S (2000) Molecular aspects of b-ketoacyl
synthase (KAS) catalysis. Biochem Soc Trans 28,
601–607.
28 Yalpani M, Willecke K & Lynen F (1969) Triacetic acid
lactone, a derailment product of fatty acid biosynthesis.
Eur J Biochem 8, 495–502.
29 Eckermann S, Schro
¨
der G, Schmidt J, Strack D, Edrada
RA, Helariutta Y, Elomaa P, Kotilainen M, Kilpela
¨
inen
I, Proksch P, Teeri TH & Schro
¨
der J (1998) New path-
way to polyketides in plants. Nature 396, 387–390.
30 Price AC, Rock CO & White SW (2003) The 1.3-Ang-
strom-resolution crystal structure of b-ketoacyl-acyl car-
rier protein synthase II from Streptococcus pneumoniae.
J Bacteriol 185, 4136–4143.
31 Olsen JG, Rasmussen AV, von Wettstein-Knowles P &
Henriksen A (2004) Structure of the mitochondrial
CCP4 suite: programs for protein crystallography. Acta
Crystallogr D 50, 760–763.
39 Navaza J (2001) Implementation of molecular replace-
ment in AMoRe. Acta Crystallogr D 57, 1367–1372.
40 Jones A, Zou JY, Cowan SW & Kjeldgaard M (1991)
Improved methods for building protein models in elec-
tron density maps and the location of errors in these
maps. Acta Crystallogr A 47, 110–119.
41 Kraulis PJ (1991) MOLSCRIPT: a program to produce
both detailed and schematic plots of protein structures.
J Appl Crystallogr 24, 946–950.
42 DeLano WL (2002) The PyMOL molecular graphics
system. .
Histidines and lysine in KAS I ⁄ KAS II catalysis P. von Wettstein-Knowles et al.
710 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS