cN-crystallin and the evolution of the bc-crystallin
superfamily in vertebrates
Graeme Wistow
1
, Keith Wyatt
1
, Larry David
2
, Chun Gao
1
, Orval Bateman
3
, Steven Bernstein
4
,
Stanislav Tomarev
1
, Lorenzo Segovia
5
, Christine Slingsby
3
and Thomas Vihtelic
6
1 National Eye Institute, National Institutes of Health, Bethesda, MD, USA
2 Oregon Health Sciences University, Portland, OR, USA
3 Department of Crystallography, Birkbeck College, London, UK
4 Department of Ophthalmology, University of Maryland School of Medicine, Baltimore, MD, USA
5IBT⁄ UNAM, Col. Chamilpa, Cuernavaca, Morelos, Mexico
6 Department of Biological Sciences, University of Notre Dame, Notre Dame, IN, USA
Much of the complexity and diversity of life arises
from the multiplication and evolution of gene famil-

G. Wistow, Section on Molecular Structure
and Functional Genomics, National Eye
Institute, Bg 7, Rm 201, National Institutes
of Health, Bethesda, MD 20892-0703, USA
Tel: +1 301 402 3452
Fax: +1 301 496 0078
E-mail:
(Received 21 January 2005, revised 23
February 2005, accepted 8 March 2005)
doi:10.1111/j.1742-4658.2005.04655.x
The b and c crystallins are evolutionarily related families of proteins that
make up a large part of the refractive structure of the vertebrate eye lens.
Each family has a distinctive gene structure that reflects a history of succes-
sive gene duplications. A survey of c-crystallins expressed in mammal, rep-
tile, bird and fish species (particularly in the zebrafish, Danio rerio) has led
to the discovery of cN-crystallin, an evolutionary bridge between the b and
c families. In all species examined, cN-crystallins have a hybrid gene struc-
ture, half b and half c, and thus appear to be the ‘missing link’ between
the b and c crystallin lineages. Overall, there are four major classes of
c-crystallin: the terrestrial group (including mammalian cA–F); the aquatic
group (the fish cM-crystallins); the cS group; and the novel cN group. Like
the evolutionarily ancient b-crystallins (but unlike the terrestrial cA–F and
aquatic cM groups), both the cS and cN crystallins form distinct clades
with members in fish, reptiles, birds and mammals. In rodents, cNis
expressed in nuclear fibers of the lens and, perhaps hinting at an ancestral
role for the c-crystallins, also in the retina. Although well conserved
throughout vertebrate evolution, cN in primates has apparently undergone
major changes and possible loss of functional expression.
Abbreviations
EST, expressed sequence tag; RPE, retinal pigment epithelium.

ages, the lens has changed its protein composition
[3,16]. This has led to considerable variability in the
content and sequence of c-crystallins in different verte-
brates, which are abundant in species with hard lenses
(such as fish and rodents) but at much lower levels or
missing in other terrestrial species. This is in contrast
with the b-crystallins which are well conserved and
have clear orthologs in all vertebrate orders (see for
examples [17–20]).
In fish and amphibians, there are multiple, divergent
c-crystallin genes that may exhibit only about 50%
identity at the protein level [17,19,21]. This is similar
to the level of divergence among the b-crystallins
[18,19,22,23] and suggests a similar antiquity of these
gene families in the vertebrate lens. In contrast, birds,
with soft accommodating lenses, lack the embryonically
expressed c-crystallins that in other vertebrates are
major components of the developing lens, and have
replaced them with the taxon-specific ‘enzyme crystal-
lins’, d and e crystallin [16,24–26].
In placental mammals there is a closely linked clus-
ter of six c-crystallin genes (cA–F) which are generally
expressed in the embryo, and these show 77–97% iden-
tity at the protein level, implying a relatively recent
origin for this family in this lineage. It has been sug-
gested that, as in birds, c-crystallins may have been on
their way to extinction in the ancestors of mammals
but were perhaps ‘reinvented’ by successive duplication
of a surviving gene as mammals adapted to principally
nocturnal, burrowing habits before the extinction of the

and their relatedness is illustrated in the phylogenetic
tree in Fig. 2, drawn using the neighbor joining option
in the program mega [30]. Some previously described
sequences are also included to illustrate the overall
distribution of the superfamily members expressed in
vertebrate lenses.
cDNA Libraries
Approximately 1500 clones were sequenced from the
un-normalized mouse whole eye ioip libraries and a
further 1000 and 1300, respectively, from the two
equalized libraries jajbjc and lglh. A total of 1000
clones (code designation mw) were sequenced from a
cDNA library made from western grey kangaroo
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2277
cN-crystallin G. Wistow et al.
2278 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
kangB
kangD
frgM1-1
frgM1-2
zfgM1
zfgM2a
zfgM2b
zfgM2c
carpgM1
carpgM2
carpgM3
zfgM3
zfgM4

91
74
66
98
99
64
92
99
40
56
100
100
100
100
89
32
71
34
57
72
90
69
61
100
100
mbB3
zfbB3
mbB2
zfbB2
zfbA2

99
45
53
50
94
29
46
Fig. 2. Phylogenetic tree of b and c crystal-
lins in vertebrates. Calculated from the align-
ment in Fig. 1 and drawn using
MEGA,by
neighbor-joining with Poisson correction.
Bootstrap values are indicted for each node.
The major clades are identified. Cartoons of
the exon structure of the motif-encoding
regions of genes in each clade are shown.
Red boxes show the typical c-crystallin exon
encoding two motifs, and blue boxes show
the single-motif exons of b-crystallin genes.
Fig. 1. Protein sequences for representative members of the bc-crystallin superfamily. Sequences are derived from the work described here,
with some examples of fish and amphibian sequences taken from GenBank. Sequence names beginning with ‘m’ are from mouse, ‘ig’ from
iguana, ‘kan’ from kangaroo and ‘zf’ from zebrafish, while carp and chick sequences are so labeled. Sequences were aligned by
CLUSTAL W.
The positions of N-terminal and C-terminal arms, the four structural motifs (I–IV) and the connecting peptide between N-terminal and C-ter-
minal domains are indicated below the alignment. Also shown are the approximate positions of the four b-strands of each motif (a–d), by
analogy with known structures. Yellow highlights show the principal conserved positions of each motif essential for correct folding. Note
that the long C-terminal arm of zfbB3 has been truncated to fit the page.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2279
(Macropus fuliginosus) lens [31]. In a small pilot survey

was obtained for a protein very similar to the iguana
lens cN. The complete coding sequence of mouse cN
(GenBank accession number AF445456) was deduced
from this clone, mouse genome sequence, from an
apparently full-length expressed sequence tag (EST) in
dbEST (CK795274), and from interspecies compari-
sons. Several other ESTs for both mouse and rat cN
eye are also present in dbEST. The mouse gene is on
chromosome 5 at about position 23.2 Mbp, cA–F are
on chromosome 1, and cS is on chromosome 16 [2].
Three full-length c-crystallins were obtained from
kangaroo lens. One was the ortholog of cS, identical
in length and 72% identical in sequence with that of
mouse (GenBank accession number AY898646). The
other two were more similar to the cA–F crystallins,
with no N-terminal arm. Based on their closest mat-
ches in blast searches, these were designated cB, with
the longer connecting peptide and a length of 175
codons (accession number AY898644), and cD, with
174 codons (accession number AY898645), although a
more systematic nomenclature will probably be needed
when all kangaroo c-crystallin sequences are known.
In this small sample, no clones for an ortholog of cN
were detected.
From zebrafish, a total of 16 distinct c-crystallins
were identified along with a b-like sequence (with a
long N-terminal arm) that had some sequence similar-
ity to c-crystallins and several b-crystallins (GenBank
accession numbers AY738742–AY738756). Nine of the
c-crystallins were generally similar to the cM-crystal-

lacks an N-arm and so far there is no evidence of
alternative splicing in this gene. A third member of the
cS family in zebrafish, zfcSc has an N-arm that is lon-
ger than in other species (although it contains three
methionines near the N-terminus that could potentially
give rise to alternative translation products), and a
fourth member, zfcSd, has a short arm of just a single
residue.
In addition to the cM and cS crystallins, two of the
zebrafish c-crystallins, zfcN1 and zfcN2, are members
of the cN family. These two proteins have N-terminal
arms identical in length with those of mouse and
iguana cN and they also exhibit the characteristic
cN-crystallin G. Wistow et al.
2280 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
insertions in the c–d loops of motifs I and III and in
the link between motifs III and IV. As shown in the
phylogenetic tree, these sequences group with other
members of the cN class in a distinct clade that is
essentially separate from both b and c crystallins. In
the tree shown, the cN branch is weakly linked to the
b-crystallin family, but overall the cN family is an
intermediate in the wider bc superfamily.
The b-crystallins are represented in the phylogenetic
tree by five members cloned from the zebrafish lens lib-
rary (zfbA1-1, zfbA2, zfbA4, zfbB2 and zfbB4) and
their orthologs from mouse. As expected, each fish
sequence is closely related to its mammalian ortholog,
in marked contrast with the relationships among cA–F
and cM crystallins. The designation of zfbA1-1 reflects

examined in detail.
Novel gene structure of cN-crystallins
Genes for cN orthologs are present in mouse, rat,
chicken, and zebrafish, and, as described below,
orthologous genes are also present in the human and
chimp genomes. The most striking feature of the crygn
gene in all these genomes, conserved across over
400 Myr of evolution, is its exon ⁄ intron structure
(Fig. 3). The first half of the gene has the typical struc-
ture of a c-crystallin gene [3], with a short first exon
encoding the start codon and the short N-terminal
‘arm’ similar to that of cS. A phase 0 intron separates
that exon from a larger exon, exon 2, which encodes
the first two structural motifs, and hence the N-ter-
minal domain of the protein, just as in the genes for
cS and cA–F. However, the second half of the gene
has the structure of a b-crystallin gene, with two exons
encoding the two motifs of the C-terminal domain.
The crygn gene is thus a hybrid of b and c crystallin
gene structures, apparently an intermediate in the evo-
lution of the c-crystallins from the b-crystallins. This
observation is concordant with the position of the cN
family in the protein sequence phylogenetic tree, where
it is an intermediate between the b and c crystallins.
cN in primates: a nonfunctional gene?
A search of the human genome for an ortholog of cN
located a highly conserved gene sequence on chromo-
some 7q36.1, and a very similar gene is present in the
chimp genome, located in an unassembled portion of
chromosome 6. This gene sequence contains a well-

coding sequence does not appear to be part of a trans-
latable ORF in this transcript. Interestingly, an EST
apparently corresponding to a similar transcript from
human hippocampus (BM548090) is present in dbEST,
suggesting that the PCR product from RPE may repre-
sent a transcript found at low levels in neural tissue,
but not one that could produce a viable protein.
Screening of available Invitrogen full-length Gene-
Trapper-ready cDNA libraries showed that cN tran-
scripts were detectable only in human testis. Two
positive clones were obtained from this tissue (Gen-
Bank accession number AF445455). The testis tran-
script included the first exon (the N-terminal arm
region) and exon 2 (the N-terminal domain). For the
C-terminal domain, however, only exon 3 (the third
motif) was included. The exon corresponding to the
fourth motif was skipped and instead an unrelated,
cryptic downstream exon was included (Fig. 4). This
exon has no similarity to the bc motif sequence and
could not produce a polypeptide capable of completing
the C-terminal domain of the protein.
Currently there is no evidence for expression of
canonical cN in primates. This leaves open the ques-
tion of whether the gene for cN retains any function
in humans. At the very least, the human gene has
clearly changed its expression and may indeed be head-
ing for extinction, joining cE and cF [15].
Recombinant mouse cN
Recombinant mouse cN was synthesized in a bacterial
host (Fig. 5A), purified and verified by MS. Initial

mer, similar to c-crystallins and in contrast with the
multimeric b-crystallins. Indeed, c-crystallins in solu-
tion tend to behave as if they were even smaller than
expected for 20-kDa monomers and cN exhibits the
most extreme version of this behavior seen so far. An
estimate of the protein oligomeric size was gained from
gel filtration using two different chemical supports. On
both columns, cN was eluted with a higher elution vol-
ume than human cD-crystallin. On preparative gel fil-
tration on Sephacryl S300, cN was eluted at 103.7 mL.
Under the same conditions, human cD-crystallin was
eluted at 98.5 mL. On analytical gel filtration on Supe-
rose 12, cN was eluted at 16.05 mL whereas human
cD-crystallin was eluted at 14.96 mL. These results
indicate that cN is eluted at a smaller apparent size
than another monomeric c-crystallin. As the two poly-
peptide chains have a similar molecular mass, these
data suggest that cN behaves even more anomalously
on gel filtration than other c-crystallins, possibly
through interactions with the column [36,37]. To pro-
vide unambiguous evidence of the oligomer size of cN,
light scattering was performed. The molecular mass of
the protein at 5 mgÆmL
)1
was evaluated by dynamic
light scattering. The average over 15 readings gave a
diffusion coefficient (D
T
) of 974.5 · 10
)13

reversible. Thus, although cN exhibits some of the
characteristics of the phase-separation-driven phenom-
enon known as ‘cold cataract’, its behavior is not con-
sistent with a simple liquid-liquid phase transition seen
for some other c-crystallins [38].
Typically, c-crystallins also exhibit very high con-
formational stability [39]. Recombinant mouse cN was
subjected to unfolding in urea under equilibrium con-
ditions and compared with human cD-crystallin
(Fig. 5B). The data show that under conditions in
which cD is unchanged, as judged by fluorescence, cN
completely unfolds, suggesting a much lower conform-
ational stability. In common with other c-crystallins,
the tryptophans of cN are more quenched when buried
in the folded protein than when exposed to the denatu-
rant [40].
cN expression in mouse eye
Eye-specific expression of cN was confirmed by Nor-
thern blotting. In mouse multi-tissue Northern blot
analysis, cN was detectable only in eye (Fig. 6A). In
Northern blot analysis of rat tissues, cN was detec-
ted only in retina (Fig. 6B). Lens was not included
on these blots. Expression of cN protein in lens was
examined by 2D gels and MS. Figure 7A shows a
Ponceau S-stained blot of soluble protein from a
newborn mouse. The identities of major crystallins
were known from earlier work [41]. After destaining,
the blot was probed with antibody to cN (Fig. 7B).
A single immunoreactive spot was observed just
below bA2. The immunoreactive spot was not visible

in fish and form a distinct branch of their own that
includes c-crystallins of similar size from amphibians
(two of which, from a frog, Rana catesbeiana [42], are
shown), and from marsupials in a ‘terrestrial’ branch
of the family. However, even on this branch, different
orders do not appear to have truly orthologous crys-
tallins, i.e. the frog sequences are not orthologs of any
gene in mammals.
Whereas most of the zebrafish c-crystallins are sim-
ilar in size to the mammalian cA–F group, with no
N-terminal arm, they too form a distinct branch of the
overall family. This branch includes the cM-crystallins
which have previously been identified in carp, so it
seems appropriate to name this subfamily the cM-crys-
tallins and to number the new zebrafish sequences
A
B
Fig. 6. Expression of cN transcripts is eye specific in rodents. (A)
Northern blot of multiple mouse tissues with probe for mouse cN.
Br, brain; Ey, eye; He, heart; Lu, lung; Li, liver; Sp, spleen; Ki,
kidney; Pa, pancreas; Sm, skeletal muscle, Th, thymus. Staining
pattern for 28S and 18S rRNA is shown below. (B) Northern blot of
multiple rat tissues with probe for mouse cN. Ret, retina (two pre-
parations); Lu, lung; Ki, kidney; Te, testis; Li, liver; Sp, spleen; Br,
brain; He, heart. The staining pattern for 28S rRNA is shown below.
Fig. 7. Expression of cN protein in newborn mouse lens. (A) Ponc-
eau S-stained blot of 2D electrophoresis gel of soluble protein from
a newborn mouse lens showing major crystallin spots. (B) Western
blot of destained 2D electrophoresis gel blot shown in (A) using
antibody to cN. A single spot is detected at the same relative posi-

either the b or c subbranches. Genes from mammals,
chicken and zebrafish all show a hybrid gene structure
with both c-like and b-like exons. Overall, the cN fam-
ily appears to be an evolutionary intermediate between
the wider b and c crystallin families.
It seems likely that the b-crystallin ⁄ AIM1 group of
genes represents the original gene organization state of
the superfamily, with genes built up by successive dupli-
cation from an ancestral gene that encoded an individ-
ual motif (although, as an individual bc motif could not
be a stable structure alone, the protein product must
have been an obligate dimer), resulting in each motif
A
B
Fig. 8. Immunofluorescence localization of cN-crystallin in mouse eye. (A) Expression of cN in the anterior segment. Left panel shows DAPI
staining for nuclei; center panel shows immunofluorescence stain (red) for cN; right panel shows a control with no primary antibody. (B)
Expression in the posterior segment. Left panel shows combined DAPI (blue) staining of cell nuclei and immunofluorescence (red) signal for
cN. GCL, Ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer, OS,
outer segments. Right panel shows control with no primary antibody. White arrows show positive stain in OPL and OS layers.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2285
being encoded by a separate exon [44]. All the protein
products of this part of the superfamily also have N-ter-
minal (and sometimes C-terminal) extensions.
The cN family represents a first step into a new spe-
cialization for the superfamily, retaining only a short
N-terminal arm at the protein level. At the same time,
perhaps with no major functional consequences, the
ancestral cN gene lost the intron dividing the exons
encoding the first domain. The next step in the evolu-

also consistent with a different role from other crystal-
lins. Although they may have multiple functions, crys-
tallins are required to exist for long periods of time
at high concentrations in order to serve as abundant,
structural components of the lens, giving the tissue its
refractive properties. The lower level of expression of
cN and its thermodynamic properties suggest that it is
not well adapted for the high concentration role of a
normal crystallin and may instead have a separate
function.
The expression of cN in the retina is particularly
interesting. There is evidence for expression of cSin
the retina and cornea, but the specific location of cN,
particularly in photoreceptors seems to be novel. It
draws an interesting parallel with a recent observation
in Xenopus laevis of a putatively c-crystallin-like pro-
tein (XAP-1) expressed in the retina and associated
with photoreceptor disc shedding [48]. In evolution,
functional retinas preceded the evolution of a focusing
lens [3,49]. The proteins of the lens arose by the recruit-
ment of genes with pre-existing functions [16,26], so it
is possible that cN recalls an ancestral function of
c-crystallins in retina that predates the lens. However,
if this attractive idea is true, it suggests that there has
been a recent change in this ancient mechanism in the
primate retina, as human (and chimp) cN appears to
have undergone major changes in its expression and
may be on its way to extinction. Evolution has given
rise to many specific adaptations in the primate visual
system (including relatively advanced color vision)

with no clear orthologs in other orders, may have
been the result of the rescue of a family heading for
extinction by reduplication of a surviving gene, fol-
lowed by another decline in expression in some line-
ages, particularly primates.
In addition to the distinctive grouping of b and c
crystallins in the phylogenetic tree, there are two outly-
cN-crystallin G. Wistow et al.
2286 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
ing sequences from the zebrafish lens. One, zfcMX, is
cM-like in terms of length and overall structure but
does not group convincingly with either cMorcA–F
subfamilies. Possibly this represents an ancestor of
both classes and a bridge between the c-crystallins with
N-terminal arms (cS and cN) and those with none.
The other unusual sequence is zfbcX. This protein
comes from a gene that is clearly of the b-type (with
individual exons for each bc motif) but, in contrast
with other members of this family, the protein is not
orthologous to any other b-crystallin. In blast
searches, this protein sequence gives a slightly closer
match to cN sequences than to others, but is essen-
tially an outlier from both b and c families.
Overall, these data show a broader and more com-
plex view of the evolution of the bc superfamily in
the vertebrate eye and the adaptive ‘choices’ made in
different lineages. This dynamic evolutionary history
of b and c crystallins is part of the remarkably varied
history of molecular modification of the lens in ter-
restrial vertebrates through the direct gene recruit-

bad, CA, USA), essentially as described previously [27,51].
The unamplified library was cloned as two sublibraries, des-
ignated io and ip, which were combined for subsequent
sequence analysis.
In addition, to reduce the content of highly abundant
clones, libraries were constructed using two PCR suppres-
sion ‘equalization’ methods. The first procedure [52] gave
rise to three subfractions (ja, jb, jc) which were similar in
content and were pooled for further analysis, while the sec-
ond procedure [53] similarly produced two pooled subli-
braries (lg, lh). All mouse libraries were constructed at
Bioserve Biotechnologies (Laurel, MD, USA).
For zebrafish (Danio rerio) a total of 500 lenses were dis-
sected from 1-year-old AB wild-type fish raised at the Uni-
versity of Notre Dame. Lenses were stabilized in RNAlater
(Ambion, Austin, TX, USA) upon dissection. RNA was
extracted and poly(A)-rich RNA was isolated as above.
From this, 490 lg total RNA and 4.7 lg poly(A)-rich
RNA were obtained. cDNA was synthesized and cloned
into pCMVSport6, as described previously [27].
For iguana (Iguana iguana), a cDNA library was con-
structed from 75 ng total RNA, extracted from two lenses
from a single adult, at Bioserve Biotechnologies. The
cDNA was synthesized according to the manufacturer’s
protocol for SMART cDNA synthesis by LD PCR (BD
Biosciences Clontech, Palo Alto, CA, USA). LD PCR was
optimized at 18 cycles using the 5¢ PCR and CDS III ⁄ 3¢
PCR primers. cDNA was digested with SFI I, run on
a Croma spin 400 column and cloned into the plasmid
pTriplEx2.

reagents from Qiagen (Valencia, CA, USA). Fragments
were amplified from these library templates using either
Taq (Roche, Indianapolis, IN, USA) or Elongase (Life
Technologies, Gaithersburg, MD, USA) polymerase sys-
tems and following the manufacturer’s protocols. PCR pri-
mers located in the second and third exons of the human
CRYGN gene were used for amplification: NgcdsA, TCTC
TATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTC
CCCGTACACCTTGATGGTGTTC. Bands were only
obtained from the RPE library template.
Northern blot
The multi-tissue mouse northern blot was purchased from
Seegene (Seoul, Korea). The multi-tissue rat northern blot
was prepared as described previously [55]. A cDNA insert
for mouse cN was obtained from the whole eye library and
labeled using the Prime-it II kit (Stratagene) and
[
32
P]dCTP. Blots were prehybridized in Hybrisol II (Oncor,
Gaithersburg, MD, USA) for 4 h, followed by hybridiza-
tion with the specific radiolabeled cDNA probe at 63 °C
for 18 h. Membranes were washed in 0.2 · NaCl ⁄ Cit ⁄ 0.1%
(v ⁄ v) SDS at 63 °C and exposed to Kodax XAR or BMR
photographic film for various lengths of time at )70 °C.
Bioinformatics
Sequence data from the EST analysis of all libraries were
processed for quality and to remove vector and other non-
cDNA sequences using phred [56], RepeatMasker (A. Smit
and P. Green) and CrossMatch (P. Green) as described pre-
viously [57]. Insert sequences were analyzed using grist

Rad) and were incubated with primary antibody (1 : 1000)
for 1 h at room temperature.
Immunofluorescence localization
Frozen sections (10 lm) from 2-day-old mouse eye were
used for immunofluorescence staining. Sections on Super-
frost ⁄ Plus slides (Daigger, Wheeling, IL, USA) were dried
at room temperature, fixed in 4% paraformaldehyde in
NaCl ⁄ P
i
for 10 min, washed, permeabilized in 0.25% Tri-
ton X-100 in NaCl ⁄ P
i
for 10 min, and incubated for 1 h at
room temperature in NaCl ⁄ P
i
⁄ 5% (v ⁄ v) goat serum block-
ing buffer. Slides were incubated with primary antibody
(1 : 300 dilution) overnight at 4 °C, washed, and incubated
with goat anti-rabbit Alexa Fluor 488 antibody (Molecular
Probes, Eugene, OR, USA; 1 : 400 dilution) for 1 h at
room temperature. After being washed, the slides were
incubated with DAPI (D-3571; Molecular Probes; 1 : 2500
dilution) for 10 min, washed, cover-slipped, and sealed.
Samples were examined under a Zeiss AxioPlan 2 micro-
scope with epifluorescence. Images were captured with a
CCD camera (Opelco, Sterling, VA, USA) with excitation
of 470 ⁄ 40 nm and emission of 525 ⁄ 50 nm. For controls, no
primary antibody was used.
MS identification of mouse lens cN
A 400 l g portion of soluble lens proteins from C57Bl ⁄ 6

run in 25 mm Tris ⁄ HCl (pH 7.5)⁄ 1mm dithiothreitol (buffer
A) and eluted with a linear gradient of buffer B (buffer
A ⁄ 1 m NaCl). Recombinant mouse cN was eluted as a single
major peak around 20% buffer B. Protein identity was
checked by electrospray MS (Micromass, Cheshire, UK).
Protein concentration was estimated from a calculated
absorption coefficient of 1.76 for a 1 mgÆmL
)1
protein solu-
tion measured at 280 nm in a 1 cm cell.
Recombinant human cD-crystallin protein was purified
by anion-exchange and cation-exchange chromatography as
described previously [64]. Protein for the unfolding study
was subjected to a supplementary gel-filtration step in order
to match the solution conditions of cN.
Size determination of mouse cN
The size was determined by two methods. After anion-
exchange chromatography, a 200-lL sample of cN
(2 mgÆmL
)1
) was subjected to analytical gel filtration on a
Superose 12 HR 10 ⁄ 30 column, with elution in buffer com-
prising 25 mm BisTris ⁄ propane, 100 mm KCl, pH 7.0, and
0.02% (w ⁄ v) NaN
3
. A 200-lL sample of human cD-crystal-
lin at 2.6 mgÆmL
)1
was eluted using the same conditions.
The size was also measured by light scattering, in which

Acknowledgements
We particularly thank Dr Robert Skurla of Bioserve
Biotechnologies, for his expertise in cDNA library con-
struction, Michael Riviere and NEI Core Grant
EY10572, for 2D electrophoresis and MS analysis of
mouse cN digests, and Drs Gerry Bouffard and Alice
Young of the NIH Intramural Sequencing Center for
expert high-throughput sequencing.
References
1 Jaworski C & Wistow G (1996) LP2, a differentiation-
associated lipid-binding protein expressed in bovine lens.
Biochem J 320, 49–54.
2 Sinha D, Esumi N, Jaworski C, Kozak CA, Pierce E &
Wistow G (1998) Cloning and mapping the mouse
Crygs gene and non-lens expression of [gamma]S-crys-
tallin. Mol Vis 4,8.
3 Wistow G (1995) Molecular Biology and Evolution of
Crystallins: Gene Recruitment and Multifunctional Pro-
teins in the Eye Lens. R.G. Landes Company, Austin, TX.
4 Lubsen NHM, Aarts HJ & Schoenmakers JGG (1988)
The evolution of lenticular proteins: the beta- and
gamma-crystallin super gene family. Prog Biophys Mol
Biol 51, 47–76.
5 Xi J, Farjo R, Yoshida S, Kern TS, Swaroop A & And-
ley UP (2003) A comprehensive analysis of the expres-
sion of crystallins in mouse retina. Mol Vis 9, 410–419.
6 Jones SE, Jomary C, Grist J, Makwana J & Neal MJ
(1999) Retinal expression of gamma-crystallins in the
mouse. Invest Ophthalmol Vis Sci 40, 3017–3020.
7 Wistow G, Summers L & Blundell T (1985) Myxococcus

99, 14682–14687.
14 Slingsby C & Clout NJ (1999) Structure of the crystal-
lins. Eye 13, 395–402.
15 Brakenhoff RH, Aarts HJ, Reek FH, Lubsen NH &
Schoenmakers JG (1990) Human gamma-crystallin
genes. A gene family on its way to extinction. J Mol
Biol 216, 519–532.
16 Wistow G (1993) Lens crystallins: gene recruitment and
evolutionary dynamism. Trends Biochem Sci 18, 301–306.
17 Gause GG Jr, Tomarev SI, Zinovieva RD, Arutyunyan
KG, Dolgilevich SM & Duncan G (1985) Crystallin
sequences of the frog Rana temporaria.InTopics in Aging
Research in Europe. The Lens: Transparency and Catar-
act, pp. 171–179. Eurage, Rijswijk, the Netherlands.
18 Wistow G (1995) Peptide sequences for beta-crystallins
of a teleost fish. Mol Vis 1,1.
19 Pan FM, Chang WC, Lu SF, Hsu AL & Chiou SH
(1995) Sequence analysis of one major basic beta-crys-
tallin (beta Bp) of amphibian lenses: evolutionary com-
parison and phylogenetic relatedness between beta- and
gamma-crystallins. Biochem Biophys Res Commun 217,
940–949.
20 Duncan MK, Banerjee-Basu S, McDermott JB & Piati-
gorsky J (1996) Sequence and expression of chicken beta
A2- and beta B3-crystallins. Exp Eye Res 62, 111–119.
21 Chang T, Lin CL, Chen PH & Chang WC (1991)
Gamma-crystallin genes in carp: cloning and characteri-
zation. Biochim Biophys Acta 1090, 261–264.
22 Chen JY, Chang BE, Chen YH, Lin CJ, Wu JL & Kuo
CM (2001) Molecular cloning, developmental expres-

transcripts and expressed sequences from the first
intron. Mol Vis 6, 79–84.
30 Kumar S, Tamura K & Nei M (1994) MEGA: Molecu-
lar Evolutionary Genetics Analysis software for micro-
computers. Comput Appl Biosci 10, 189–191.
31 Kim RY, Gasser R & Wistow GJ (1992) mu-crystallin
is a mammalian homologue of Agrobacterium ornithine
cyclodeaminase and is expressed in human retina. Proc
Natl Acad Sci USA 89, 9292–9296.
32 Chang T, Jiang YJ, Chiou SH & Chang WC (1988)
Carp gamma-crystallins with high methionine content:
cloning and sequencing of the complementary DNA.
Biochim Biophys Acta 951, 226–229.
33 Harding JJ & Crabbe MJC (1984) The lens: development,
proteins, metabolism and cataract. In The Eye (Davson
H, ed.), pp. 207–492. Academic Press, New York.
34 Treton JA, Jones RE, King CR & Piatigorsky J (1984)
Evidence against gamma-crystallin DNA or RNA
sequences in the chick. Exp Eye Res 39, 513–522.
35 van Rens GL, de Jong WW & Bloemendal H (1991) One
member of the gamma-crystallin gene family, gamma s,
is expressed in birds [letter]. Exp Eye Res 53, 135–138.
36 Bateman OA, Lubsen NH & Slingsby C (2001) Associa-
tion behaviour of human betaB1-crystallin and its trun-
cated forms. Exp Eye Res 73, 321–331.
37 Lampi KJ, Oxford JT, Bachinger HP, Shearer TR,
David LL & Kapfer DM (2001) Deamidation of human
cN-crystallin G. Wistow et al.
2290 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
beta B1 alters the elongated structure of the dimer. Exp

46 Roy SW, Fedorov A & Gilbert W (2003) Large-scale
comparison of intron positions in mammalian genes
shows intron loss but no gain. Proc Natl Acad Sci USA
100, 7158–7162.
47 Siezen RJ, Wu E, Kaplan ED, Thomson JA & Benedek
GB (1988) Rat lens gamma-crystallins. Characterization
of the six gene product and their spatial and temporal
distribution resulting from differential synthesis. J Mol
Biol 199, 475–490.
48 Wohabrebbi A, Umstot ES, Iannaccone A, Desiderio
DM & Jablonski MM (2002) Downregulation of a
unique photoreceptor protein correlates with improper
outer segment assembly. J Neurosci Res 67, 298–308.
49 Land MF & Fernald RD (1992) The evolution of eyes.
Annu Rev Neurosci 15, 1–29.
50 Wistow G, Turnell B, Summers L, Slingsby C, Moss D,
Miller L, Lindley P & Blundell T (1983) X-ray analysis
of the eye lens protein gamma-II crystallin at 1.9 A
˚
resolution. J Mol Biol 170, 175–202.
51 Wistow G, Bernstein SL, Wyatt MK, Ray S, Behal
A, Touchman JW, Bouffard G, Smith D & Peterson
K (2002) Expressed sequence tag analysis of human
retina for the NEIBank Project: retbindin, an abun-
dant, novel retinal cDNA and alternative splicing of
other retina-preferred gene transcripts. Mol Vis 8,
196–204.
52 Luk’ianov KA, Gurskaia IG, Matts MV, Khaspekov GL,
D’Iachenko LB, Chenchik AA, Il’evich-Stuchkov SG &
Luk’ianov SA (1996) [A method for obtaining the nor-

215, 403–410.
60 Kent WJ (2002) BLAT: the BLAST-like alignment tool.
Genome Res 12, 656–664.
61 Lampi KJ, Shih M, Ueda Y, Shearer TR & David LL
(2002) Lens proteomics: analysis of rat crystallin
sequences and two-dimensional electrophoresis map.
Invest Ophthalmol Vis Sci 43, 216–224.
62 Wilmarth PA, Taube JR, Riviere MA, Duncan MK &
David LL (2004) Proteomic and sequence analysis of
chicken lens crystallins reveals alternate splicing and
translational forms of beta B2 and beta A2 crystallins.
Invest Ophthalmol Vis Sci 45, 2705–2715.
63 Yates JR, 3rd Eng JK, McCormack AL & Schieltz D
(1995) Method to correlate tandem mass spectra of
modified peptides to amino acid sequences in the pro-
tein database. Anal Chem 67, 1426–1436.
64 Evans P, Wyatt K, Wistow GJ, Bateman OA, Wallace
BA & Slingsby C (2004) The P23T cataract mutation
causes loss of solubility of folded gammaD-crystallin.
J Mol Biol 343, 435–444.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2291