Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents - Pdf 10

Domain IV of mouse laminin b1 and b2 chains
Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue
contents
Takako Sasaki
1
, Karlheinz Mann
1
, Jeffrey H. Miner
2
, Nicolai Miosge
3
and Rupert Timpl
1
1
Max-Planck-Institut fu
È
r Biochemie, Martinsried, Germany;
2
Renal Division and Department of Cell Biology and Physiology,
Washington University School of Medicine, St Louis, MO, USA;
3
Center of Anatomy, Department of Histology, University
of Go
È
ttingen, Germany
Domain IV, consisting of abo ut 230 residues, represents a
particular protein module so far found only in l aminin b1
and b2 c hains. Both domains were obtained by r ecombi-
nant production in mammalian cells. They showed a
globular structure, as expected from electron microscopic
examination of laminins. Fragment b1IV w as obtained as a

tions. Fifteen different isoforms are so far known, laminin-1
to laminin-15, based on the assembly of different a1toa5,
b1tob3andc1toc3 chains [1±3]. These chains share a 600-
residue domain II,I which oligomerizes into a rod-like
coiled-coil structure forming the long arm of laminins. The
N-terminal short arms and C-terminal G domains, however,
are composed of laminin-type LE, L4, LN and LG
modules, which form rod-like or globular structures in
various combinations [1,4]. Most of these modules are also
shared by seve ral other extracellular proteins s uch as t he
proteoglycans perlecan and agrin. A few other domains are
so far unique to laminins and include domain IV of the b1
and b2 chain. Only b1IV h as so fa r been obt aine d as a
proteolytic fragment [5].
Ten of the laminin isoforms contain either the b1or
b2 chain in combination with c1 and one of the ®ve a chains
[6±8]. These two b chains consis t o f about 1760 residues,
have an identical modular structure, and show about 50%
sequence identity [9,10]. Their mRNAs are expressed at
different levels in a large number of tissues [10,11], produced
by a variety of cultured cells, and, as shown by antibody
staining, encode proteins found in various basement mem-
branes [12±16]. Their distribution can change during
embryonic development, particularly in aorta, kidney and
skeletal mu scle. The b2 chain was actually discovered in a
search for proteins that are speci®c for neuromuscular
synapses [9] and this restriction has been con®rmed in
subsequent studies of mouse [15] but not human tissues
[17±19].
Little evidence is, however, available on potential func-

readily explained by sequence differences. This also allowed
development of sensitive and speci®c immunological assays
for both b chains that are useful for quantitative analyses
and examination of their distrib ution in tissue s.
MATERIALS AND METHODS
Sources of proteins
Laminin-1, in complex with nidogen-1 and its elastase
fragment E10, were obtained from a mouse tumor basement
membrane [5,25]. Other recombinant fragments of mouse
laminins included a1IVa [26], b1VI//V and b3VI/V (unpub -
lished) which were prepared by established procedures [27].
Construction of expression vectors and cell transfections
The templates used were a complete mouse b1 cDNA
(plasmid no. 1609) provided by Y. Yamada (NIDR,
Bethseda, MD, USA), and for b2IV we used RNA from
embryonic mouse endothelial cells provided by A. Hatzo-
poulos (GSF, Munich, Germany). T he sense and antisense
primers for b1 were GTCAGCTAGCTAACGAGGTGG
AGTCCGGTTAC and GTCACTCGAGCTAAAGGCC
CGTCTGGTGAATCAAG, respectively, and for b2GTC
AGCTAGCCCGTCCCTGTGACTGTGATG and GTC
ACTCGAGCTAGGCTTGACAGCCTGCAGGG,
respectively. They were used for ampli®cation by PCR and
RT-PCR, respectively. These primers introduced at the 5¢
end an NheIsiteandatthe3¢ end a stop codon followed by
an XhoI site to allow insertion into the episomal expression
vector pCEP-Pu containing the BM-40 signal peptide [28]. A
Ser721Ala mutation was introduced into b1IV by fusion
PCR [29].These vectors were used to t ransfect 293-EBNA
cells, and serum-free medium was collected from these cells

Superdex Peptide column (Amersham-Pharmacia; HR 10/
30) in 0.1% tri¯uoroacetic acid/25% acetonitrile. Further
cleavage at enzyme/substrate ratios of 1 : 100 with trypsin
or endoproteinase Lys-C in 0 .2
M
NH
4
HCO
3
or with pepsin
in 0.1
M
glycine/HCl, pH 1.9 (23 °C, 15 h) was followed by
Superdex chromatography and/or HPLC on a C
18
column
[31]. Differential alkylation with 4-vinylpyridine or iodoac-
etate after partial and complete reduction with dithioth reitol
in 0.05
M
Tris/HCl, pH 8.5, and 6
M
guanidinium hydro-
chloride/0.05
M
Tris/HCl, pH 8.5, respectively, followed a
previously used procedure [32]. Digestion with chondroitin-
ases ABC, AC or B (Sigma) followed a previous protocol
[33].
Analytical methods

folllowed previously used procedures [8,15]. Gold p articles
(16 n m) were used to label af®nity-puri®ed rabbit antibodies
as described [40]. Tissue s ections on nickel grids w ere
incubated for 15 min with NaCl/P
i
,pH7.2,andthen
labeled gold diluted 1 : 200 for 16 h at room temperature.
Sections were rinsed with water, stained with uranyl acetate
(15 m in) and lead citrate (5 min), and examined with a Zeiss
EM 109 electron microscope. Controls included colloidal
gold alone or samples coated with goat anti-(rabbit Ig) IgG
or anti-(rat Ig) IgG and were all negative.
RESULTS
Expression and puri®cation of recombinant domain IV
from mouse laminin b1 and b2 chain
Domain IV of t he b1 (position 541±771) and b2 (position
556±782) chains correspond to the central globular domain
432 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
in the short arm of these laminin chains [2] (Fig. 1B). They
are of similar size and share 41% identical residues including
four out of ®ve cysteines and 2 9% conservative replace-
ments (Fig. 1A). Features unique to b1IV are single
potential acceptor sites for N-glycosylation and glycosami-
noglycan attachment, respectively. Episomal expression
vectors were prepared for both domains in order to obtain
them as recombinant fragments from serum-free culture
medium of transfected human kidney 293-EBNA cells.
Production and secretion of fragment b1IV occurred at h igh
rates (150±170 lgámL
)1

(top) and b2 (bottom) chains and domain structure of the laminin b1 and
b2 chains (B). (A) Both sequences show 41% identity (bars) and 29%
conservative changes (dots). Cysteines are numbered 1±5 in b1 and 1±4
in b2, and carbohydrate attachment motifs (SGD, N YT) are high-
lighted in bold. Asterisks mark corrections to the pub lished genomic
sequence of mouse b2 [43]. An arrowhead indicates the start of frag-
ment E10 [5]. The numbering includes the signal peptides. (B) Laminin
b1andb2 chains have the same domain structures consisting of LN
and LE (circles) modules, domain IV, and a coiled-coil (cc) domain
II,I.
Fig. 2. SDS/PAGE of puri®ed recombinant fragments c ontaining
domain IV of b1orb2 chain under nonreducing (A) and reducing (B)
conditions. Lanes were loaded with equal amounts of b1IV monomer
(1), b2IV (2), b1IV dimer (3), b1IV substituted with chondroitin sulfate
before (4) and after (5) digestion with chondroitinase ABC, and b1IV
mutant S721A monomer form (6). Positions of calibrating proteins are
showninkDaontheleft.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 433
indicating the presence of a proteoglycan. The correspond-
ing b1IV fragment was eluted in front of the b1IV dimer
from a molecular sieve and showed a broad electrophoretic
band mainly in the range 70±110 kDa, which could be
converted into the monomer and dimer bands after
treatment with chondroitinase ABC (Fig. 2, lanes 4 and 5).
Recombinant fragment b2IV did not bind to DEAE-
cellulose and s howed, after molecular s ieve chromatogra-
phy, a single band of 33 kDa (Fig. 2, lanes 2), indicating its
monomeric nature and lack of glycosaminoglycan mod i®-
cation. Edman degradation of the puri®ed recombinant
fragments showed a major single N-terminal sequence,

Hexosamine analysis of b1IV monomer and dimer
showed 5±6 residues of glucosamine and less than one
galactosamine. That Edman degradation of various prote-
olytic peptides (see below) failed to identify Asn677,
indicating full occupation of the single N-linked a cceptor
site. The proteoglycan form of b1IV showed the same
glucosamine content, b ut a large increase in galactosamine
content (48 residues), which corresponds to about 19 kDa
of a glycosaminoglycan chain. Furthermore, digestion with
chondroitinases ABC (Fig. 2) and A,C but not by ch on-
droitinase B or heparitinase ( not shown) yielded t he b1IV
monomer and dimer bands, demonstrating the exclusive
substitution by chondroitin sulfate. The mean (SD) length
of the side chain was estimated from electron micrographs
of 30 particles to be 40 ( 10 nm), which is in good
agreement w ith a molecular m ass o f 20 k Da. M utation of
Ser721 to Ala did not interfere with recombinant produc-
tion of b1IV monomers (Fig. 2, lane 6) and dimers but
prevented completely the modi®cation by glycosaminogly-
cans, consistent with the a bsence of any oth er strong
acceptor site w ithin the b1IV sequence (Fig. 1). Fragment
b2IV lacked any of thes e substantial post-tr anslational
modi®cations, as d etermined b y M S, which yielded a
molecular m ass of 34 369 Da, in g ood agreement with a
mass of 34 357 calculated from the sequence.
The odd number of cysteines in b1IV indicated the
presence of a free thiol group, which is probably responsible
for dimerization. The native b1IV dimer was therefore ®rst
modi®ed b y partial reduction and p yridylethylation to
protect the thiol followed by complete reduction under

[2,16]). Several of the monoclonal antibodies against
b2chainweregeneratedinmiceandfailedtoreactwith
the corresponding mouse antigens [9]. To circumvent these
limitations and to allow quantitative assays, we generated
rabbit antisera against recombinant mouse b1IV and b2IV.
These antisera had high titers (half-maximal binding) at
dilutions of 1 : 4000 (anti- b1) and 1 : 20 000 (anti-b2) in
ELISA and radioimmunoassays and did not cross-react
(titer less than 1 : 100) with the homologous (b2orb1IV)
antigen or recombinant N-terminal fragments b1VI/V and
b3VI/V of mouse l aminin. T hey were also c learly distin-
guishable in immunoblots of several biological samples,
with anti-b1 reacting mainly with a 220-kDa band and anti-
b2 with a 190-kDa band after electrophoresis under
reducing conditions (data not shown).
The antisera allowed the development of speci®c and
sensitive radioimmuno-inhibition assays, with half-maximal
inhibition being achieved at 0.1±0.2 n
M
b1IV and b2IV,
respectively (Fig. 5). The b1IV assay was inhibited in nearly
identical manner by m onomeric and dimeric b1IV and the
proteoglycan form and by laminin-1 (a1b1c1) derived from
the mouse EHS tumor (Fig. 5A). Laminin-1 fragment E10
showed a less steep and incomplete i nhibition pro®le,
indicating the loss of some antigenic epitopes. A more t han
1000-fold excess of b2IV showed no inhibition (Fig. 5A),
and the same was found for recombinant laminin fragments
b1VI/V, b3VI/V and a1IVa (data not shown). Similarly, the
assay for b2IV could not be inhibited by a large excess of

extracted w ith EDTA a nd detergent only and examined by
these three assays (Table 1). A variable content of laminin
b1 chain [17±422 pmolá(g wet tissue)
)1
] and lower amounts
of b2 chain (4±20% of b1) were found. As expected, the
highest amounts of b1 chain were found in the EHS tumor,
while t he content of b2 chain did not exceed 0.2%. T he
amounts of c1 c hain were within the u sual range of
Fig. 5. Radioimmuno-inhibition assays speci®c for laminin b1 (A) and b2
(B) chains. The assay consisted of 1 ng
125
I-labeled fragment b1IV
monomer or b2IV and ®xed amounts of the corresponding antiserum.
Inhibitors used were b1IV monomer (n), chondroitin sulfate-sub sti-
tuted b1IV (,), b2IV ( m), mouse laminin-1 (s) and its E10 fragment
(h) at the concentrations shown at the bottom. E DTA extracts of
mouse heart (d) and kidney (j) were used at the dilutions shown at
the top.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 435
analytical error ( 20%) of such inhibition assays [36], in
most cases in good agreement with the sum of b1and
b2 chains. It served therefore as an internal control for the
quality of t he data. Tissue extracts of mice being de®cient in
the laminin b2 chain [23,24] were used as further controls
and failed to inhibit the b2 assay (content less than
0.5 p molág
)1
). Interestingly, these extracts s howed a twofold
increase in the b1 chain content when compared with

One r eason f or the discrepancies between published
reports showing a restricted distribution of b2 and our
results showing a more widespread distribution could be
that the antiserum used here cross-reacts with another
laminin chain in immunohistochemical assays. To investi-
gate this possibility, we immunostained tissues from Lamb2
mutantmice(Fig.7).Thesemicehaveamutationthathas
been shown to prevent any accumulation of laminin b2in
basement membranes [23,24]. No signi®cant ¯uorescence
was f ound on staining mutant tissues with the a nti-b2IV
serum, whereas tissues from a littermate c ontrol w ere w ell
stained. This demonstrates that the antiserum reacts with
laminin b2 but with no other laminin chain and no other
basement membrane component.
Results from immunohistochemical assays using anti-b1
serum (data not shown) were mostly consistent with
previously published reports showing a widespread
(although not ubiquitou s) expression pattern for laminin
b1. For example, in skeletal muscle, b1 was detected in the
extrasynaptic muscle ®be r basement m embranes and in
endoneurial basement membranes. It was not observed at
synapses or in the perineurium, sites where b2 is known to
be concentrated [12]. In kidney, b1 was detected in all
tubular basement membranes and in the glomerular
mesangium. In addition, it was detected at a low level in
the glomerular basement membrane, a s ite where b2is
concentrated (Fig. 6). Together with ou r b2 immunohisto-
chemical results, these data suggest that many basement
membranes contain both laminin b1andb2chains.How-
ever, in most cases one appears to be much more prevalent

mous folding unit and was produced at high rate. This was
Table 1. Contents [pmolá(g wet tissue)
)1
] of laminin c1, b1 and b2chains
in tissue extracts from normal adult and mutant (b2+/±;b2±/±)miceas
determined by radioimmuno-inhibition assays. Tissues were extracted
with EDTA-contain ing bu er and detergent and analyzed by assays
speci®c for recombin ant frag ments c1III3-5, b1IV and b2IV.
Tissue c1 b1 b2
EHS tumor 6935 6647 14
Placenta 510 422 14
Heart 567 343 35
Skeletal muscle 133 117 23
Intestine 97 104 4
Stomach 143 125 20
Thymus 44 66 6
Skin 16 17 3
Lung 225 176 12
Lung, b2 +/± 169 153 11
Lung, b2 ±/± 313 348 < 0.5
Kidney 84 106 8
Kidney, b2 +/± 101 140 9
Kidney, b2 ±/± 205 244 < 0.4
436 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
surprisingly not the case f or b2IV which needed two
additional LE modules for reasonable expression and
secretion. Similar observations have been reported for the
N-terminal globular LN module (domain VI) of the
laminin a1 chain, which could o nly be produced in
mammalian cells after it had been joined to a tandem of

recombinant b2IV. Yet an SGG site in perlecan domain V
[44] and three SGD sites in domain I [33,45] can serve as
acceptor sites for heparan sulfate/chondroitin sulfate, and
more remote sequences may regulate their complete or
partial occupation [45]. Special features of such regulations
may now be unravelled by site-directed mutagenesis of the
corresponding regions in b1IV and b2IV domains. O ur data
also indicate that tissue laminins containing b1chainsmay
Fig. 7 . Antiserum to laminin b2IV does not react with basement membranes in Lamb2 mutant tissues. Kidney (A and B) and skeletal muscle (C and D)
from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum. In the control, basement membranes throughout the kidney and
skeletal muscle were stained. Basement membranes at neuromuscular junctions (arrows in C) were more immunoreactive than were extrasynaptic
basement membranes. No immunoreactivity was detected in mutant tissues, demonstrating the speci®city of the antiserum. Neuromuscular
junctions were iden ti®ed by do uble lab eling with rho damine- a-bungarotoxin (C¢ and D¢). Bar, 100 lm.
438 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
be, at l east in part, converted i nto proteoglycans. This is
underscored by conservation of the SGD sequence in the
human laminin b1 chain [46], whereas the laminin b chains
of Drosophila [47] and Caenrhabditis elegans (accession no.
AAB 94193) lack this sequence and also differ in cysteine
patterns. Preliminary unpublished studies to identify such
forms in t issue extracts h ave, however, f ailed so f ar and
indicated only a low level of substitution or a speci®c
restriction to a few tissue sites. Yet we do not think that the
partial modi®cation of b1IV is an a rtefact o f r ecombinant
production because a similar low rate of substitution of
recombinant perlecan domain V correlated well with a
comparable low rate of modi®cation of two tissue forms of
perlecan [44].
An extra cysteine (C3 at position 710) in domain b1IV
not conserved i n b2IV w as a candidate to explain the

the previous data and to e stablish more qu antitative and
sensitive assays. The rabbit antisera obtained showed a high
speci®city for b1andb2 chains, respectively, as demon-
strated by ELISA, radioimmunoassay, and immunoblot.
This was underscored by the failure to show any reactivity
of antibodies to b2 with tissues d erived from b2-de®cient
mice. Speci®c radioimmuno-inhibition assays of high sen-
sitivity (IC
50
 0.1±0.2 n
M
) were developed and showed
both b chains and equivalent levels of laminin c1chainsin
EDTA/detergent extracts of various mouse tissues. The
content of b1 chains in these extracts exceeded the conten t
of b2 by a factor of 5±20. The relative amounts of b2were
particularly high in skeletal muscle, consistent, a s shown
here and previously, f or developing and adult human
muscle [17], by distinct staining of extrasynaptic areas of
muscle basement membranes. The radioimmunoassay data
are also inconsistent with restriction to synapses, as shown
in rats by monoclonal antibodies [9,15], considering the low
density of s ynaptic junction s (usually accoun ting for less
than 0.1% of the total basement membranes). The radio-
immunoassays also indicated a twofold higher content of b1
chain in lung and kidney of b2-de®cient mice compared with
littermate controls. Such upregulation was previously
predicted from immunostaining of kidneys, but it did not
lead to functional compensation [24].
This is the ®rst extensive examination of b2 distribu-

b2 protein that was detectable on immunoblots but not in
immunohistochemical assays, suggesting that a subset of
b2 in tissue cannot be recognized by some antibodies
known to react with b2. However, in retina, b2hasbeen
shown to have a more widespread distribution than we
observed here, as it was also found in the interphotore-
ceptor matrix and in the outer plexiform layer [3,51]. As
these layers do not contain basement membranes, it is
possible that our anti-b2IV serum did not recognize b2in
these layers because o f a speci®c supramolecular organi-
zation which may mask most of the antigenic epitopes of
domain b2IV.
We have also extended the tissue localization of laminin
b1andb2 chains to t he ultrastructural level b y using
immunogold staining, which has not been examined in
previous studies. This was particularly important for
skeletal muscle, which showed immunogold staining for
the laminin a2 chain in muscle and c apillary basement
membranes, whereas most of the laminin a4chainwas
localized to adjacent interstitial regions of the endomysium
[52]. A similar restriction to basement membran es o f muscle
and capillaries was h ere found for t he b1andb2chain.
Comparable staining for both b chains was also found for
tubular, glomerular, and s ome other renal basement mem-
branes. An interesting ®nding was that staining for b2was
distinctly more intense at the junctional folds of synapses
than at the extrasynaptic basement membranes. This
indicates a higher epitope density or accessibility an d may
explain why certain monoclonal antibodies against b2 show
restricted synaptic staining [9,15]. A higher synapse-speci®c

AmB1sB2e ) from h uman pla centa . J. Cell Sci. 107, 329±338.
7. Brandenberger, R. & Chiquet, M. (1995) Distinct h eparin-binding
and n eurite-promoting properties of laminin isoforms isolated
from chick heart. J. Cell Sci. 108, 3099±3108.
8. Miner, J.H., Patton, B .L., Lentz, S.I., Gilbert, D.J., Snider, W.D.,
Jenkins, N.A., Copeland, N.G. & Sanes, J.R. (1997) The laminin a
chains: expression, developmental transitions, an d chromosomal
locations of a1±5, identi®cation o f heterotrimeric laminins 8±11
and cloning of a novel a3 isoforms. J. Cell Biol. 137, 685±701.
9. Hunter, D .D., Shah, V., Merlie, J.P. & Sanes, J.R. (1989) A
laminin-like adhesive protein concentrated in the synaptic cleft of
the neuromuscular junction. Nature (London) 338, 229±234.
10. Iivanainen, A., Vuolteenaho, R., Saino, K., Eddy, R., Shows,
T.B., Sariola, H. & Tryggvason, K. (1994) The human laminin b2
chain ( s-laminin): structure, expression in fetal tissues and
chromosomal assignment of the LAMB2 gene. Matrix Biol. 14,
489±497.
11. Wewer, U.M., Gerecke, D.R., Durkin, M.E., Kurtz, K.S., Mattei,
M G., Champliaud, M.F., Burgeson, R.E. & Albrechtsen, R.
(1994) Human b2 chain of laminin (formerly s chain): cDNA
cloning, chromosomal localization, and expression in carcinomas.
Genomics 24, 243±252.
12. Sanes, J.R., Engvall, E., Butkowski, R. & Hunter, D.D. (1990)
Molecular heterogeneity of basal laminae: isoforms of laminin and
collagen IV at the neuromuscular j unctio n and elsewhere. J. Cell
Biol. 111, 1685±1699.
13. Wewer, U .M., Engvall, E., Paulsson, M., Yamada, Y. & Albr-
echtsen, R. (1992) Laminin A, B1, B2, S and M subunits in the
postnatal rat liver development and after partial hepatectomy.
Lab. Invest. 66 , 378±389.

23. Noakes, P.G., Gautam, M., Mudd, J., Sanes, J.R. & Merlie, J.P.
(1995) Aberrant dierentiation of neuromuscular junctions in
mice lacking s-laminin/laminin b2. Nature (London) 374, 258±262.
24. Noakes, P.G., Mine r, J.H., Gautam, M., Cunningham, J.M.,
Sanes, J.R. & Merlie, J.P. (1995) The renal glomerulus of m ice
lacking s-laminin/laminin b2: nephrosis despite molec ular com-
pensation by laminin b1. Nat. Genet. 10, 400±406.
25. Paulsson, M., Aumailley, M., Deutzmann, R., Beck, K. & Engel, J.
(1987) Laminin±nidogen complex: extraction with chelating agents
and structural characterizatio n. Eur. J. Biochem. 16 6, 11±19.
26. Schulze, B., Mann, K., Po
È
schl, E., Yamada, Y. & Timpl, R. (1996)
Structural and functional analysis of the globular domain IVa of
the laminin a1 chain and its impact on an adjacent RGD site.
Biochem. J. 314, 847±851.
27. Ettner, N., Go
È
hring, W., Sasaki, T., Mann, K. & Timpl, R. (1998)
The N-terminal globular domain of the laminin a1 chain binds to
a1b1anda2b1 integrins and the h eparan sulfate-containing
domains of perlecan. FE BS Lett. 43 0, 217±221.
28.Kohfeldt,E.,Maurer,P.,Vannahme,C.&Timpl,R.(1997)
Properties of the e xtracellular calcium binding module of the
proteoglycan testican. FEBS L ett. 414, 557±561.
29. Vallejo, A.N., Pogulis, R.J. & Pease, L.R. (1994) In vitro synthesis
of novel genes: mutagenesis and recombination by PCR. PCR
Methods Applic. 4, 123±130.
30. Bitter, T. & M uir, H. (1962) A modi®ed uronic acid carbazole
reaction. Anal. Biochem. 4, 330±334.

12, 1879±1885.
38. Sasaki,T.,Wiedemann,H.,Matzner,M.,Chu,M L.&Timpl,R.
(1996) Expression of ®bulin-2 by ®broblasts and deposition with
®bronectin into a ®brillar matrix. J. Cell Sci. 109, 2895±2904.
39. Miosge, N., Sasaki, T. & Timpl, R. (1999) Angiogenesis inhibitor
endostatin is a d istinct co mponent of elastic ®bers in vessel walls.
FASEB J. 13, 1743±1750.
40. Miosge, N., Quondamatteo, F., Klenczar, C. & Herken, R. (2000)
Nidogen-1: expression and ultrastructural loc aliza tion during
the onset of mesoderm formation in the early mouse embryo.
J. Histochem. Cytochem. 48, 229±237.
41. Stetefeld, J., Mayer, U., Timpl, R. & Huber, R. (1996) Crystal
structure of three consecutive laminin-type epidermal growth
factor-like (LE) modules of laminin c1 chain harbor ing the nid-
ogen binding site . J. Mol. Biol. 257, 644±657.
42. Tisi, D., Talts, J.F., Timpl, R. & Hohenester, E. (2000) Structure
of the C-terminal LG domain pair of the laminin a2 chain har-
bouring binding sites for a-dystroglyc an and heparin. EMBO J.
19, 1432±1440.
43. Durkin, M.E., Gantam, M., Loechel, F., Sanes, J.R., Merlie, J.P.,
Albrechtsen, R. & Wewer, U.M. (1996) Structural organization of
the human and mouse laminin b2 chain genes, and alternative
splicing at the 5¢ end of the human transcript. J. Biol. Chem. 271,
13407±13416.
44. Friedrich, M.V.K., Go
È
hring, W., Mo
È
rgelin, M., Brancaccio, A.,
David, G. & Timpl, R . (1999) Structural basis of glycosamino-

52. Talts, J.F., S asaki, T., M iosge, N., Go
È
hring, W., Mann, K .,
Mayne, R. & T impl, R. (2000) Structural and functional analy-
sis of the recombinant G domain of the laminin a4chainand
its proteolytic processing in tissues. J. Biol. Chem. 275, 35192±
35199.
442 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status