Amino acid limitation regulates the expression of genes
involved in several specific biological processes through
GCN2-dependent and GCN2-independent pathways
Christiane Deval, Ce
´
dric Chaveroux, Anne-Catherine Maurin, Yoan Cherasse, Laurent Parry, Vale
´
rie
Carraro, Dragan Milenkovic, Marc Ferrara, Alain Bruhat, Ce
´
line Jousse and Pierre Fafournoux
Unite
´
de Nutrition Humaine, Equipe Ge
´
nes-Nutriments, Saint Gene
`
s Champanelle, France
In mammals, amino acids exhibit two important char-
acteristics: (a) nine amino acids are essential for health
in adult humans, and (b) amino acids are not stored,
which means that essential amino acids must be
obtained from the diet. Consequently, amino acid
homeostasis may be altered in response to malnutrition
[1,2] with two major consequences: (a) a large varia-
tion in blood amino acid concentrations, and (b) a
negative nitrogen balance. In these situations, individu-
als must adjust several physiological functions involved
in the defense ⁄ adaptation response to amino acid limi-
tation. For example, after feeding on an amino acid-
imbalanced diet, an omnivorous animal recognizes the

control of gene expression are not yet completely understood in mammals:
(a) the target genes and biological processes regulated by amino acid avail-
ability, and (b) the signaling pathways that mediate the amino acid
response. Using large-scale analysis of gene expression, the objective of this
study was to gain a better understanding of the control of gene expression
by amino acid limitation. We found that a 6 h period of leucine starvation
regulated the expression of a specific set of genes: 420 genes were up-regu-
lated by more than 1.8-fold and 311 genes were down-regulated. These
genes were involved in the control of several biological processes, such as
amino acid metabolism, lipid metabolism and signal regulation. Using
GCN2) ⁄ ) cells and rapamycin treatment, we checked for the role of
mGCN2 and mTORC1 kinases in this regulation. We found that (a) the
GCN2 pathway was the major, but not unique, signaling pathway involved
in the up- and down-regulation of gene expression in response to amino
acid starvation, and (b) that rapamycin regulates the expression of a set of
genes that only partially overlaps with the set of genes regulated by leucine
starvation.
Abbreviations
ARE, A ⁄ U-rich element; aRNA, amplified RNA; Asns, asparagine synthetase; ATF4, activating transcription factor 4; CAT-1, cationic amino
acid transporter-1; Chop, CCAAT ⁄ enhancer binding protein homologous protein; Cy, cyanine; Dusp16, dual specificity phosphatase 16; Egr1,
early growth response 1; GO, gene ontology; Hmgcs1, 3-hydroxy-3-methylglutaryl-CoA synthase 1; Idi1, isopentenyl-diphosphate delta
isomerase 1; Ifrd1, interferon-related developmental regulator 1; MEF, mouse embryonic fibroblast; Ndgr1, N-myc downstream-regulated
gene 1; Sqstm1, sequestosome 1; Trb3, tribbles homolog 3.
FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works 707
mammals regulate several physiological functions to
adapt their metabolism to the amino acid supply. It
has been shown that nutritional and metabolic signals
play an important role in controlling gene expression
and physiological functions. However, currently, the
mechanisms involved in this process are not completely

[7,18]. Once activated, GCN2 phosphorylates the trans-
lation initiation factor, eukaryotic initiation factor 2a,
thereby impairing the synthesis of the 43S preinitiation
complex and thus strongly inhibiting translation initia-
tion. Under these circumstances, activating transcrip-
tion factor 4 (ATF4) is translationally up-regulated as a
result of the presence of upstream ORFs in the 5¢-UTR
of its mRNA [19,20]. ATF4 then binds the amino acid
response element and induces the expression of target
genes [18,21,22]. It has also been shown that mTORC1
inhibition by amino acid starvation affects gene expres-
sion, but the molecular mechanisms involved in this
process have not been described [23].
Two components of the amino acid control of gene
expression are not yet completely understood in mam-
mals: (a) the genes and biological processes regulated
by amino acid availability, and (b) the signaling path-
ways that mediate the amino acid response. In this
study, using transcriptional profiling, we identified a
set of genes regulated by amino acid depletion. We
also showed that the GCN2 pathway is the major, but
not unique, signaling pathway involved in the up- and
down-regulation of gene expression in response to
amino acid starvation.
Results
Amino acid starvation triggers changes in gene
expression
In order to identify amino acid-regulated genes, mouse
embryonic fibroblast (MEF) cells were starved of leu-
cine. A 6 h incubation was chosen in order to capture

The expression of a set of genes is regulated by
amino acid starvation independent of the GCN2
pathway
In mammals, the GCN2 pathway is the only mecha-
nism described at the molecular level that is involved
Regulation of gene expression by amino acid limitation C. Deval et al.
708 FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works
in the regulation of gene expression in response to
amino acid starvation. However, comparison of the
regulatory mechanisms involved in the control of gene
expression by amino acid availability between yeast
and mammals suggests that one or more control pro-
cesses other than the GCN2 pathway could be
involved in mammalian cells (see introduction). To
address this question, we used MEF cells either
expressing or not expressing GCN2 (GCN2+ ⁄ + and
GCN2) ⁄ ) cells).
In GCN2) ⁄ ) cells, 108 genes were regulated by
amino acid starvation: 88 genes were induced and 20
genes were repressed by more than 1.8-fold in response
to amino acid starvation (Fig. 1 and Table S1). Focus-
ing on the effect of GCN2, we considered that a gene
was GCN2 dependent when it was not regulated in
GCN2) ⁄ ) cells, and GCN2 independent when more
than 75% of its induction (or repression) in response
to amino acid starvation was maintained in GCN2) ⁄ )
cells. A gene was considered to be partially GCN2
dependent if its induction ratio was decreased but
remained higher than 1.8-fold in GCN2) ⁄ ) cells.
Among the genes regulated by amino acid starvation,

Number of genes
(311)
Fig. 1. Global behavior of gene expression on leucine starvation in
GCN2+ ⁄ + and GCN2) ⁄ ) MEF cells. The number of genes exhibit-
ing changes in their expression level after 6 h of leucine starvation.
Filled bars, expression level increased by more than 1.8-fold;
hatched bars, expression level decreased by more than 1.8-fold.
The details of the experiment are given in Table S1.
Table 1. Distribution of leucine starvation-responding mRNA cate-
gorized across GO biological processes. For each GO term, the
number of genes up- or down-regulated in response to amino acid
starvation is given.
Ontology ID Ontology terms
Up
regulated
genes
Down
regulated
genes
GO: 0045449 Regulation of transcription 49 19
GO: 0006952 Defense response 41 8
GO: 0006810 Transport 25 14
GO: 0007145 Signal transduction 23 19
GO: 0006412 Translation 20 9
GO: 0008283 Cell proliferation 17 4
GO: 0006508 Proteolysis 16 9
GO: 0016310 Phosphorylation 14 16
GO: 0006418 tRNA aminoacylation for
protein translation
11 2

GO: 0006333 Chromatin assembly ⁄
disassembly
12
GO: 0006732 Coenzyme metabolic
process
12
GO: 0006260 DNA replication 0 2
GO: 0006069 Glycolysis 0 5
GO: 0006936 Muscle contraction 0 2
Other 12 13
Biological process
unclassified (EST
and Riken)
112 102
C. Deval et al. Regulation of gene expression by amino acid limitation
FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works 709
We measured the enrichment of the amino acid-
responding genes in both cell lines, and the results are
shown in Table 2. It is noticeable that the biological
processes regulated by amino acid starvation in
GCN2) ⁄ ) cells differed clearly from those regulated in
wild-type cells. For example, the genes involved in
amino acid metabolism were not regulated by amino
acid starvation in GCN2) ⁄ ) cells, whereas enrichment
for the genes involved in cholesterol biosynthesis pro-
cesses remained high in these cells. These results dem-
onstrate that GCN2 may be involved in the regulation
of particular physiological functions (such as amino
acid metabolism) when there is insufficient amino acid
availability.

Table 2. Enrichment of the amino acid-regulated genes according to the biological process in which they are involved. Enrichment was
determined using
FATIGO software. (A) and (B) show the significantly enriched GO categories calculated from GCN2+ ⁄ + and GCN2) ⁄ ) cells,
respectively. In (B), the GO terms already present in (A) are not shown. For each cell line, only the most relevant and non-redundant terms
were reported. The FatiGO level is indicated for each GO category. A given GO category was considered to be significantly enriched when
its enrichment was higher than 1.8 and P < 0.05 (indicated in bold). The enrichment for a given GO category was computed as the ratio of
the distribution of the amino acid-regulated genes* versus the distribution of the genes spotted onto the microarray**. *Percentage of the
representation of one GO term among all the amino acid-regulated genes. **Percentage of the representation of one GO term among all
the genes present on the micro-array.
Ontology ID Ontology terms
GO
level
Gcn2+ ⁄ +
enrichment
Gcn2+ ⁄ +
P value
Gcn2) ⁄ )
enrichment
Gcn2) ⁄ )
P value
A
GO: 0009070 Serine family amino acid biosynthetic process 8 15 3.39e-02 0 1
GO: 0006695 Cholesterol biosynthetic process 9 8.5 2.20e-02 13.2 4.23e-01
GO: 0006418 tRNA aminoacylation for protein translation 9 6.3 1.12e-04 2.1 1
GO: 0007005 Mitochondrion organization and biogenesis 5 6.3 2.44e-02 15.9 1.31e-01
GO: 0006469 Negative regulation of protein kinase avtivity 8 4.8 3.76e-02 12.5 5.00e-02
G0: 0051094 Positive regulation of developmental process 5 4.6 4.45e-02 10.3 2.23e-01
GO: 0044262 Main pathways of carbohydrate metabolic
process
6 4.3 1.45e-02 6.7 4.04e-01

2
–2
2
4
81
(h)
IDI1
HMGCS1
–4
–6
–8
–10
6
9
Sqstm1
2
3
Asns
–1
–2
3
5
Fold change
Fold change
Fold change
Fold change
Fold change
Fold changeFold change
Fold change
1

+/+
–/–
GCN2
+/+ –/–
GCN2
+/+
–/–
GCN2
+/+ –/–
GCN2
+/+ –/–
GCN2
+/+
1
3
Egr1
6
Control 6 h
Amino acid
Starved 6 h
1
2
3
Dusp16
Fig. 2. Induction by amino acid starvation of
selected genes. (A) Time course analysis of
the mRNA content of Egr1, Ndgr1, Idi1 and
Hmgcs1 in response to leucine starvation.
The gene expression level was quantified by
quantitative RT-PCR. The results are given

tion rate of one gene, the level of unspliced pre-
mRNA was measured. Given that introns are rapidly
removed from heterogeneous nuclear RNA during
splicing, this procedure is considered to be a means of
measuring transcription [27,28]. Quantitative RT-PCR
analysis with specific primers spanning an intron–exon
junction was used to amplify a transient intermediate
of the mRNA, whereas primers located in two differ-
ent exons were used to amplify the mature mRNA.
We chose to study the regulation of chemokine (C-X-
C motif) ligand 10 (Cxcl10), Egr1 (partially GCN2
independent) and Dusp16 (GCN2 independent)
because the structures of these genes were known. In
order to avoid any interference with the GCN2 path-
way, we performed this experiment in GCN2) ⁄ )
cells.
Figure 3 shows that both the pre-mRNA and
mature mRNA of Egr1 and Cxcl10 are similarly regu-
lated by amino acid starvation, suggesting that the reg-
ulation occurs mainly at the transcriptional level. By
contrast, the amount of pre-mRNA of Dusp16 is not
affected by amino acid starvation, but the amount of
mature transcript is increased. These results suggest
that the Dusp16 transcript is probably regulated at a
post-transcriptional level, such as mRNA stabilization,
splicing or nucleocytoplasmic transport. These results
show that the mechanisms responsible for the amino
acid regulation of gene expression in GCN2) ⁄ ) cells
involve both transcription and ⁄ or mRNA stabilization
and ⁄ or processing. However, we cannot exclude the

Fig. 3. Regulation of unspliced mRNA of
CxCl10, Dusp16 and Egr1 in response to
amino acid starvation. GCN2) ⁄ ) cells were
incubated for 4 and 6 h in either a control
medium or a medium devoid of leucine.
Quantitative RT-PCR analyses were per-
formed using specific primers in order to
detect both primary transcripts and mature
mRNA (see Materials and methods for
details). Three independent experiments
were performed.
Regulation of gene expression by amino acid limitation C. Deval et al.
712 FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works
gories such as regulation of transcription, transport
and signal transduction.
A comparison of the transcriptional profile induced
by rapamycin and amino acid deprivation revealed
that only 20 genes were regulated by both treatments
(Table S3). Rapamycin treatment and amino acid star-
vation had similar effects on the expression of 12 genes
and opposite effects on the regulation of eight genes.
These results suggest that rapamycin inhibition of
TORC1 modifies the expression of a set of genes that
only partially overlaps with the set of genes regulated
by amino acid deprivation.
Discussion
There is growing evidence that amino acids play an
important role in controlling gene expression. Using
transcriptional profiling, the objective of this work was
to gain a better understanding of the amino acid con-

100
200
300
400
Genes repressed by rapamycin treatment
100
200
Number of genes
(178)
Ontology ID Ontology Terms Up regulated
genes
Down regulated
genes
GO : 0045449 Regulation of transcription
GO : 0006810 Transport
GO : 0007165 Signal transduction
GO : 0006508 Proteolysis
GO : 0016310 Phosphorylation
GO : 0007155 Cell adhesion
GO : 0006952 Defense response
GO : 0030154 Cell differentiation
GO : 0006412 Translation
GO : 0006629 Lipid metabolic process
GO : 0005975 Carbohydrate metabolic process
GO : 0006397 mRNA processing
GO : 0006915 Apoptosis
GO : 0007242 Intracellular signaling cascade
GO : 0009117 Nucleotide metabolic process
GO : 0007049 Cell cycle
GO : 0006259 DNA metabolic process

1
1
1
1
0
50
200
11
16
1
9
9
4
7
2
2
4
2
1
5
0
1
4
0
4
1
0
1
1
2

described for the amino acid-dependent regulation of
several genes, including Chop, Atf3, Cat-1 and insulin-
like growth factor binding protein 1 (Igfbp1), making
it possible that amino acid availability may affect a
mechanism regulating transcript stability of a larger set
of genes [15,25,26,30,31]. Based on an analysis of the
literature, the regulation of mRNA half-life has mainly
been studied by focusing on the A ⁄ U-rich element
(ARE) instability determinant of certain mRNAs. In
particular, there has been much discussion of a link
between ARE-dependent mRNA degradation and the
inhibition of protein synthesis [31,32]. However, the
universality of such a translation-coupled ARE-medi-
ated decay has been discussed and remains unclear
[33,34]. The most plausible hypothesis to explain
mRNA stability would be that many factors contribute
to these multistep processes, including the metabolic
conditions of the cell, nature of the stimulus, RNA
binding factors and the sequence of the target mRNA
[35].
Another amino acid sensing mechanism involves
mTORC1. Therefore, it is tempting to speculate that
the mTORC1 pathway could be involved in the
GCN2-independent regulation of gene expression. Our
results show that rapamycin, an inhibitor of mTORC1,
regulates the expression of a set of genes almost as
large as the set of genes regulated by amino acid depri-
vation (622 versus 731 genes). However, only 12 genes
are regulated by both rapamycin and amino acid star-
vation, whereas both of these stimuli are known to

sion by amino acid starvation and ⁄ or rapamycin [24].
Further investigations are needed to understand the
role of mTORC1 kinase in the regulation of gene
expression by amino acid availability.
The enrichment of amino acid-regulated genes
according to their biological processes reveals that
amino acid limitation regulates groups of genes that
are involved in amino acid and protein metabolism,
lipid and carbohydrate metabolism and various pro-
cesses related to the stress response. These adaptive
responses enable the cell to become accustomed to low
amino acid availability. It is conceivable that, in vivo,
animals modulate their metabolism in order to adapt
to a diet partially or totally devoid of a given essential
amino acid.
Our data suggest that the GCN2 pathway is directly
involved in the regulation of amino acid and protein
metabolism, as many of the genes involved in these
processes are not regulated in GCN2) ⁄ ) cells. These
results are in good agreement with those of Harding
et al. [18], who showed that the transcription factor
ATF4 (downstream of GCN2) regulates the transport
and metabolism of amino acids. Taken together, these
results demonstrate that amino acids can regulate their
own metabolism as a function of their availability.
In this process, GCN2 is the sensor for amino acid
limitation.
A previous study has shown that amino acid starva-
tion can regulate lipid metabolism [6]. Our results rein-
force these data, as they show that amino acid

physiological functions of individuals living under con-
ditions of restricted or excessive food intake.
Materials and methods
Cell cultures and treatment conditions
GCN2+ ⁄ + and GCN2) ⁄ ) MEF cells were kindly pro-
vided by D. Ron (New York University, NY, USA). For
amino acid starvation experiments, cells were starved of
leucine. F12 ⁄ DMEM without amino acids was used. The
medium was supplemented with individual amino acids at
the concentration of the control medium. In all experiments
involving amino acid starvation, dialyzed serum was used.
RNA extraction
Total RNA was prepared using the RNeasy total RNA
Mini kit (Qiagen France, Les Ulis, France). RNA concen-
tration and integrity were assessed using the Agilent 2100
Bioanalyzer (Agilent Technologies, Massy, France). High-
quality RNAs with an A
260
⁄ A
280
ratio above 1.9 and intact
ribosomal 28S and 18S bands were utilized for microarray
experiments and real-time RT-PCR.
Oligo microarray
A mouse oligonucleotide microarray containing 25 000
genes and expressed sequence tags were used to profile the
change in gene expression of different cultured cells starved
of essential amino acids. Microarray chips were obtained
from RNG (Re
´

software (Biodiscovery) and controlled by M–A plot repre-
sentation. Statistical analyses were performed using free
r 2.1 software. The log ratios between the two conditions
(with two independent experiments conducted for each cell
line) were analyzed using a standard Student’s t-test to detect
differentially expressed genes. P values were adjusted using
the Bonferroni correction for multiple testing to eliminate
false positives. Differences were considered to be significant
at adjusted P < 0.01 and a cut-off ratio of > 1.8 or < 0.55
to identify genes differentially expressed by amino acid star-
vation. All the genes given in the figures and Supporting
Information (using GCN2+ ⁄ + cells) were regulated with a
fold change of greater than (±)1.8 in all independent experi-
ments. The genes that were found to be regulated in only one
experiment were not taken into account. This occurred
mainly for genes either having an induction ratio close to 1.8
or expressed at a low basal level.
These genes were then classified according to their bio-
logical process ontology determined from the QuickGO
gene ontology browser [QuickGO GO Browser (online
database), European Bioinformatics Institute, available
from: />C. Deval et al. Regulation of gene expression by amino acid limitation
FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works 715
Enrichment rate calculation
To calculate the enrichment rate and to determine the func-
tional interpretation of the data, we analysed the regulated
genes with fatigo s oftwar e fr om t he B abelom ics suite web tool
() [36]. fatigo software calcu lates
the distribution of GO terms for biological processes between
the regulated genes obtained from microarray experiments and

reverse, CACCTGGGTAAAGGGGAGTGA
Dusp16 forward, GCTCCGCCACTATTGCTATT
reverse, AGGTGCAGCAGCTTCAGTTT
Dusp16
pre-mRNA
forward, CAGTGCTGGAATTGTACGTGA
reverse, AGTCCATGAGTTGGCCCATA
Egr1 forward, CCTATGAGCACCTGACCACA
reverse, AGGCCACTGACTAGGCTGAA
Egr1
pre-mRNA
forward, GAGCAGGTCCAGGAACATTG
reverse, GGGATAACTCGTCTCCACCA
Ndrg1 forward, ACCTGCTACAACCCCCTCTT
reverse, TGCCAATGACACTCTTGAGC
Idi1 forward, GGGCTGACCAAGAAAAAC
reverse, TCGCCTGGGTTACTTAATGG
Acknowledgements
We thank Dr D. Ron (New York University, NY,
USA), for providing us with GCN2)/) cells.
References
1 Jackson AA & Grimble MS (1990) The Malnourished
Child. Raven Press, Vevey.
2 Baertl JM, Placko RP & Graham GG (1974) Serum
proteins and plasma free amino acids in severe malnu-
trition. Am J Clin Nutr 27, 733–742.
3 Gietzen DW (1993) Neural mechanisms in the responses
to amino acid deficiency. J Nutr 123, 610–625.
4 Maurin AC, Jousse C, Averous J, Parry L, Bruhat A,
Cherasse Y, Zeng H, Zhang Y, Harding HP, Ron D

ated translation of a mammalian mRNA is regulated by
amino acid availability. J Biol Chem 12, 12.
13 Yaman I, Fernandez J, Liu H, Caprara M, Komar AA,
Koromilas AE, Zhou L, Snider MD, Scheuner D,
Kaufman RJ et al. (2003) The zipper model of transla-
tional control: a small upstream ORF is the switch
that controls structural remodeling of an mRNA leader.
Cell 113, 519–531.
14 Barbosa-Tessmann IP, Chen C, Zhong C, Siu F, Schus-
ter SM, Nick HS & Kilberg MS (2000) Activation of
the human asparagine synthetase gene by the amino
acid response and the endoplasmic reticulum stress
response pathways occurs by common genomic
elements. J Biol Chem 275, 26976–26985.
Regulation of gene expression by amino acid limitation C. Deval et al.
716 FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works
15 Bruhat A, Jousse C, Wang XZ, Ron D, Ferrara M &
Fafournoux P (1997) Amino acid limitation induces
expression of CHOP, a CCAAT ⁄ enhancer binding pro-
tein-related gene, at both transcriptional and post-tran-
scriptional levels. J Biol Chem 272, 17588–17593.
16 Jousse C, Averous J, Bruhat A, Carraro V, Mordier S
& Fafournoux P (2004) Amino acids as regulators of
gene expression: molecular mechanisms. Biochem Bio-
phys Res Commun 313, 447–452.
17 Bruhat A, Jousse C, Carraro V, Reimold AM, Ferrara
M & Fafournoux P (2000) Amino acids control mam-
malian gene transcription: activating transcription fac-
tor 2 is essential for the amino acid responsiveness of
the CHOP promoter. Mol Cell Biol 20, 7192–7204.

Biochimie 90, 1716–1721.
25 Pan YX, Chen H & Kilberg MS (2005) Interaction of
RNA-binding proteins HuR and AUF1 with the human
ATF3 mRNA 3¢-untranslated region regulates its amino
acid limitation-induced stabilization. J Biol Chem 280,
34609–34616.
26 Yaman I, Fernandez J, Sarkar B, Schneider RJ, Snider
MD, Nagy LE & Hatzoglou M (2002) Nutritional con-
trol of mRNA stability is mediated by a conserved AU-
rich element that binds the cytoplasmic shuttling protein
HuR. J Biol Chem 277, 41539–41546.
27 Chen H, Pan YX, Dudenhausen EE & Kilberg MS
(2004) Amino acid deprivation induces the transcription
rate of the human asparagine synthetase gene through a
timed program of expression and promoter binding of
nutrient-responsive bZIP transcription factors as well as
localized histone acetylation. J Biol Chem 279, 50829–
50839.
28 Lipson KE & Baserga R (1989) Transcriptional activity
of the human thymidine kinase gene determined by a
method using the polymerase chain reaction and an
intron-specific probe. Proc Natl Acad Sci USA 86,
9774–9777.
29 Karpinski BA, Morle GD, Huggenvik J, Uhler MD &
Leiden JM (1992) Molecular cloning of human CREB-
2: an ATF ⁄ CREB transcription factor that can nega-
tively regulate transcription from the cAMP response
element. Proc Natl Acad Sci USA 89, 4820–4824.
30 Jousse C, Bruhat A, Ferrara M & Fafournoux P (1998)
Physiological concentration of amino acids regulates

37 Jousse C, Deval C, Maurin AC, Parry L, Cherasse Y,
Chaveroux C, Lefloch R, Lenormand P, Bruhat A &
Fafournoux P (2007) TRB3 inhibits the transcriptional
activation of stress-regulated genes by a negative
feedback on the ATF4 pathway. J Biol Chem 282,
15851–15861.
C. Deval et al. Regulation of gene expression by amino acid limitation
FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works 717
Supporting information
The following supplementary material is available:
Table S1. Regulation of gene expression on amino acid
starvation in GCN2+ ⁄ + and GCN2) ⁄ ) MEF cells.
Table S2. Regulation of gene expression on rapamycin
treatment in MEF cells.
Table S3. Genes regulated by both amino acid starva-
tion and rapamycin treatment.
This supplementary material can be found in the
online version of this article.
Please note: Wiley-Blackwell is not responsible for
the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
Regulation of gene expression by amino acid limitation C. Deval et al.
718 FEBS Journal 276 (2009) 707–718 Journal compilation ª 2008 FEBS. No claim to original French government works