Phytoene synthase genes in tomato (Solanum
lycopersicum L.) – new data on the structures, the deduced
amino acid sequences and the expression patterns
Giovanni Giorio, Adriana Lucia Stigliani and Caterina D’Ambrosio
Metapontum Agrobios, Metaponto, Italy
Fruits are the mechanism by which angiosperms dis-
perse seeds and are the result of a tight co-evolution
between plants and their seed dispersers [1]. Tomato
(Solanum lycopersicum L.) belongs to the Solanaceae
(Nightshade) family, which contains many differenti-
ated taxa occurring worldwide. Its fruit type is the
berry: red, fleshy and with a pulpy interior rich in
seeds [2]. Among the 12 wild relatives of tomato, there
is only one (Solanum pimpinellifolium B. Juss.) with a
red berry and two with yellow, yellow–green or orange
fruits [Solanum cheesmaniae (L. Riley) Fosberg; Sola-
num galapagense S.C. Darwin and Peralta], whereas all
Keywords
carotenoid metabolism; chloroplast;
chromoplast; fruit colour; phytoene synthase
Correspondence
G. Giorio, Metapontum Agrobios, SS Jonica
Km 448.2, Metaponto, MT 75010, Italy
Fax: +39 0835 740204
Tel: +39 0835 740276
E-mail:
All authors contributed equally to this work
(Received 22 October 2007, revised 27
November 2007, accepted 3 December
2007)
doi:10.1111/j.1742-4658.2007.06219.x

the other species have green, yellow–green, dark green
or black fruits [3,4].
During the development of tomato fruit, the shift
from green to red colour is due to the degradation of
chlorophylls and the accumulation of the carotenoid
lycopene.
Carotenoid pathways in plants have been described
in great detail using genetic, biochemical and mole-
cular data, mainly from Arabidopsis [5,6].
The first step in the synthesis of lycopene is the
condensation of two molecules of geranylgeranyl
diphosphate to form the 15-cis-isomer of phytoene.
This two-step reaction is catalysed by the enzyme
phytoene synthase (PSY). Following four desaturations
and probably two [7] isomerization steps, the 15-cis
phytoene is converted to all-trans lycopene by phyto-
ene desaturase, f-carotene desaturase and carotene
isomerases. At this point, the pathway is branched
because the lycopene can be converted to lutein, which
appears to be the end-product of the first branch, or
to zeaxanthin, which can be further converted to
violaxanthin. In plants, carotenoids are mainly
involved in photosynthesis as accessory pigments, in
photoprotection (quenching and xanthophylls cycle)
and in the formation of abscisic acid. Moreover, many
species use them to make coloured flowers and fruits
to attract pollinators and seed dispersers. In tomato,
for example, the flower has a bright yellow–orange
corolla resulting from the combined effect of chromo-
phores of neoxanthin, violaxanthin and lutein [8],

also reanalysed in the light of these results.
Results
Isolation of tomato Psy1 and Psy2 genes
Using the sequences M8474 and L23424 reported in the
NCBI database corresponding, respectively, to tomato
Psy1 and Psy2 mRNAs, an extended database search-
ing using blast program was conducted aiming to
reconstruct the entire coding sequences of the two
genes.
The need for a reconstruction was based on the lack
of information regarding the 5¢-region in the Psy2
DNA sequence and from the conflicting evidence avail-
able in the database records of the PSY1 gene. Using
the reconstructed sequences, a set of primers was
designed and used to amplify the cDNAs derived from
fruit or leaf RNAs of tomato cultivar Red Setter
(Table 1). The Psy1 and Psy2 cDNAs were cloned in
suitable vectors, sequenced and deposited in the NCBI
database as EF534739 and EF534738. Combining
these two mRNA sequences with those of GTOM5
(X60441) and clone F (X60440), two sets of primers
were designed to amplify genomic DNA fragments
corresponding to the introns of the two genes. The
fragments were sequenced and enabled the complete
reconstruction of the Psy1 and Psy2 genes with the
annotation of introns and exons. The GenBank acces-
sion numbers of the two genes are EF534740 (Psy1)
and EU021055 (Psy2). However, the UTR regions for
both genes were only partially reconstructed.
The comparison of the two genes (Fig. 1 and

GenBank accession
number
Amplicon
(bp) Use
18SrRNA Le18SrRNA-F-118 GAAACGGCTACCACATCCAAG BH012957 61 RT-PCR
Le18SrRNA-R-179 CCCCGTGTTAGGATTGGGT
TaqMan-Le18s-140 AAGGCAGCAGGCGCGCAAA
Psy1 Psy1F312 TGACGTCTCAAATGGGACAAGT EF534739 69 RT-PCR
Psy1R381 CCTCGATGAATCAAAAAAACGG
TaqManPsy1 TCATGGAATCAGTCCGGGAGGGAA
Psy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 72 RT-PCR
Psy2R1024 GAAACAGTGTCGGATAAAGCTGC
TaqManPsy2 ACGGGCGGCCATTTGATATGCTTG
Psy1 PSY1For21 GGCCATTGTTGAAAGAGAGG EF534739 1522 Cloning
PSY1Rev1522 TCATGCTTTATCTTTGAAGAGAGG
Psy2 PSY2For27 TCTCTACGTGTATCAAAGGTAGTAAGG EF534738 1674 Cloning
PSY2Rev1674 TGGCATTTAGAAACTTCATTCA
Fig. 1. Comparison of the structures of the Psy1 and Psy2 genes.
Table 2. Structure of tomato Psy1 and Psy2 genes.
Gene
DNA (nt)
a
mRNA (nt)
a
Protein
Exon Intron
Length 5¢-UTR CDS 3¢-UTR Length
Integral cTP
b
Mature

the PSY1 protein. In this case, a mature PSY1 in the
plastids would have a predicted size of 38.5 kDa,
which is agreement with previous experimental evi-
dence [17]. targetp failed to predict a subcellular
localization for PSY2 when the entire sequence was
submitted. However, when the query sequence con-
tained residues 1 to 91–95 of PSY2 protein, the soft-
ware always detected a chloroplastic transit peptide of
86 amino acids. This may be due to the presence of
specific motifs beyond the first 95 residues that inter-
fere with the prediction.
Transcription analysis in tomato tissues
Psy1 and Psy2 transcript contents were estimated in
RNA samples derived from root, leaf, petal, anther,
ovary and fruit at three developmental stages (Mature
Green, Pink and Ripe) using quantitative RT-PCR
(qRT-PCR) with gene-specific fluorescent probes
(Fig. 3).
Since the estimates of Psy1 and Psy2 relative tran-
script contents were normalized onto the 18S rRNA
(endogenous reference) transcript contents and com-
pared to normalised petal transcript content (calibra-
tor), it is possible for each gene to make an easy
comparison of the relative transcript contents among
the nine tissues (Figs 4 and 5). Psy1 transcript was
absent in root RNA, whereas it could be detected in
leaf, sepal, ovary and in the fruit at mature green
stage. However, in these tissues, Psy1 transcript con-
tent ranged between 2% and 3% of the content in the
petal. This organ appeared to contain a considerable

(D) Fruit developmental stages: MG, Mature
Green; P, Pink; R, Ripe.
Fig. 4. Transcription analysis of tomato Psy1 gene carried out using
qRT-PCR with gene-specific fluorescent probes on transcripts from
nine different tissues. At least two RNA samples were assayed for
each tissue. Three replicated reactions were performed for each
sample, both in the construction of standard curve and in the quanti-
tation of samples. The estimates are expressed as the mean ± SD.
Fig. 5. Transcription analysis of tomato Psy2 gene carried out using
qRT-PCR with gene-specific fluorescent probes on transcripts from
nine different tissues. For details, see Fig. 4.
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 531
of the threshold cycle means of the two genes for each
tissue were used as the exponent in the formula 2
(DCt)
.
Accordingly, and assuming that the efficiency of the
amplification of the two genes was equal, it is possible
to obtain an estimate for each tissue of the transcript
content of Psy1 relative to Psy2 (Fig. 6). In green tis-
sues (i.e. in leaf, sepal and ovary), the content of Psy1
transcript was 0.4-fold lower than that of Psy2 tran-
script. Conversely, in pigmented tissues, such as petal,
anther and fruit at Pink and Ripe stages, the content
of Psy1 was shown to be much greater than that of
Psy2 transcript. The estimates ranged between 5.2-fold
greater in the petal to 213.3-fold greater in the fruit at
the Pink stage.
Discussion

pletely clarified, although extensive studies have been
carried out in tomato [13,18,19] and in Narcissus
[20–22]. The results obtained in tomato were not
conclusive, probably because of a confounding effect
due to the two different forms of PSY. However, as
noted by Gallagher et al. [23] in grass PSYs, differ-
ences in the N-terminus as well as the C-terminus of
the two proteins may result in differences in their
plastid localization.
Transcription analysis of the two genes using qRT-
PCR clearly showed that, with the exception of Psy1
in the roots, transcripts of both genes are detectable in
all tested tomato tissues. Unexpectedly, the organ with
the highest relative content of Psy2 transcript is the
petal and not the leaf. Psy2 transcript content in the
leaf is only approximately 25% of that in the petal.
This result could not be anticipated because Psy2 was
thought to be the chloroplast-specific PSY and no pre-
vious report had addressed gene expression in this
organ using a method as sufficiently sensitive as quan-
titative real time PCR. The high content of Psy2 tran-
script in tomato petals could also explain why the
flowers of yellow flesh mutants, r and r
y
, are pale or
normal, respectively, whereas, in the lines in which the
Psy1-derived transgene triggered a cosuppression of
PSY genes, the flowers were almost white [24].
In the fruit, Psy2 transcript is detectable at all tested
stages and appears to increase during ripening. Finally,

cation event. After duplication, the two genes have
been maintained in the genome owing to subfunction-
alization, which, in this case, is in the form of a
division of gene expression [27]. The recruitment of
primary carotenoid metabolism as secondary metabo-
lism has been described in maize [23] as well as in
tomato for flower and fruit pigmentation [8]. However,
in tomato, it has been hypothesised that recruitment
required duplication of all genes encoding the rate-
controlling enzymes of the pathway, namely carotene
beta-hydroxylase, lycopene cyclase and PSY, and that
the duplicated pathway was exploited originally for
flower pigmentation and only later for fruit pigmenta-
tion [8]. The latter hypothesis serves to explain why all
13 tomato species have yellow coloured flowers,
whereas only three have red, yellow, yellow green or
orange coloured fruits [4]. However, it is not known
whether the recruitment of the metabolism for fruit
pigmentation has occurred on a second occasion
because the PSY gene ancestor duplicated later or
because the subfunctionalization of the two paralogs
was more complex, thus requiring more time.
By comparing the protein sequences of the PSY par-
alogs and that of carotene beta-hydroxylase paralogs
(CrtR-b1, CAB55625; CrtR-b2, ABI23730), it is found
that a reduced similarity (73.7% residue identity and
82.6% similarity) is seen for CRTR-Bs compared to
PSYs (77.8% residue identity and 85.3% similarity)
that could indicate an early duplication of the CrtR-b
gene ancestor. However, the recruitment of PSY1 for

Rad Laboratories Inc., Hercules, CA, USA) in 20 lL reac-
tion volume. After checking the specificity of the reactions
by agarose gel electrophoresis analysis, an aliquot of the
reaction was used to produce recombinant vectors with
pCRÒ-BLUNT II-TOPOÒ (Invitrogen), which were trans-
formed into competent Escherichia coli cells. Plasmid DNA
harbouring the two genes were isolated from recombinant
cells and used for sequence analysis.
Sequencing reactions were performed with the ABI
PRISMÒ BigDyeÒ Terminator v3.1 Cycle Sequencing kit
and analysed with the Applied Biosystems 3130 Genetic
Analyzer (Applied Biosystems, Foster City, CA, USA).
Using specific software, the Psy1 and Psy2 partial mRNA
sequences were assembled.
Combining these two mRNA sequences with those of
GTOM5 (X60441) and clone F (X60440), two sets of prim-
ers were designed to amplify genomic DNA fragments cor-
responding to the introns of the two genes. After PCR, the
amplified fragments were gel purified and sequenced using
the protocols reported above.
Quantitative analysis of Psy1 and Psy2 transcript
contents (qRT-PCR)
Transcription analysis of tomato Psy1 and Psy2 genes was
carried out using qRT-PCR with gene-specific fluorescent
probes. Transcript contents were estimated in RNA sam-
ples derived from root, leaf, petal, anther, ovary and fruit
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 533
at three developmental stages (Mature Green, Pink and
Ripe).

We wish to thank all colleagues of Metapontum Ag-
robios who collaborated in the project. We are grateful
to Professor Peter Beyer (Freiburg, Germany) for valu-
able comments and helpful suggestions and Professor
Gerhard Sandmann (Frankfurt, Germany) for critical
reading of the manuscript.
References
1 Knapp S (2002) Tobacco to tomatoes: a phylogenetic
perspective on fruit diversity in the Solanaceae. J Exp
Bot 53, 2001–2022.
2 Knapp S, Bohs L, Nee M & Spooner DM (2004) Solan-
aceae – a model for linking genomics with biodiversity.
Comp Funct Genomics 5, 285–291.
3 Peralta IE, Knapp S & Spooner DM (2006) Nomencla-
ture for wild and cultivated tomatoes. Rep Tomato
Genet Coop 56, 6–12.
4 Peralta IE & Spooner DM (2007) History, origin and
early cultivation of tomato (Solanaceae). In Genetic
Improvement of Solanaceous Crops, Vol. 2: Tomato
(Razdan MK & Mattoo AK, eds), pp. 1–27. Science
Publishers, Enfield, CT.
5 DellaPenna D & Pogson BJ (2006) Vitamin synthesis in
plants: tocopherols and carotenoids. Annu Rev Plant
Biol 57, 711–738.
6 Sandmann G, Ro
¨
mer S & Fraser PD (2006) Under-
standing carotenoid metabolism as a necessity for
genetic engineering of crop plants. Metab Eng 8,
291–302.

toene synthesis from tomato. Plant Mol Biol 19, 401–
404.
15 Emanuelsson O, Brunak S, von Heijne G & Nielsen H
(2007) Locating proteins in the cell using TargetP,
SignalP and related tools. Nat Protoc 2, 953–971.
16 Small I, Peeters N, Legeai F & Lurin C (2004) Predo-
tar: a tool for rapidly screening proteomes for N-termi-
nal targeting sequences. Proteomics 4, 1581–1590.
17 Fraser PD, Truesdale MR, Bird CR, Schuch W &
Bramley PM (1994) Carotenoid biosynthesis during
tomato fruit development (evidence for tissue-specific
gene expression).
Plant Physiol 105, 405–413.
18 Fraser PD, Kiano J, Truesdale M, Schuch W & Bram-
ley PM (1999) Phytoene synthase-2 enzyme activity in
Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al.
534 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS
tomato does not contribute to carotenoid synthesis in
ripening fruit. Plant Mol Biol 40, 687–698.
19 Fraser PD, Schuch W & Bramley PM (2000) Phytoene
synthase from tomato (Lycopersicon esculentum) chlo-
roplasts – partial purification and biochemical proper-
ties. Planta 211, 361–369.
20 Kreuz K, Beyer P & Kleinig H (1982) The site of
carotenogenic enzymes in chromoplasts from Narcissus
pseudonarcissus L. Planta 154, 66–69.
21 Schledz M, Al-Babili S, Lintig JV, Haubruck H, Rab-
bani S, Kleinig H & Beyer P (1996) Phytoene synthase
from Narcissus pseudonarcissus: functional expression,
galactolipid requirement, topological distribution in

FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 535