An engineered right-handed coiled coil domain imparts
extreme thermostability to the KcsA channel
Zhiguang Yuchi
1
, Victor P. T. Pau
2
, Bridget X. Lu
1
, Murray Junop
1
and Daniel S. C. Yang
1
1 Department of Biochemistry and Biomedical Sciences, Faculty of Health Sciences, McMaster University, Hamilton, Canada
2 Department of Biochemistry, Temple University School of Medicine, Philadelphia, PA, USA
Introduction
Tetrameric architecture is a common character shared
by cation channels, including potassium, sodium, cal-
cium, nonselective, glutamate gated, cyclic nucleotide
gated (CNG), transient receptor potential channels,
and other ion channels [1,2]. Although they differ from
each other in terms of selectivity and physiological
activator, they all have to organize to a tetrameric
arrangement in order to be functional. The ion con-
ducting function is fulfilled by a central ion conducting
pore composed of selectivity filters and a-helices
arranged in four-fold or pseudo four-fold symmetry.
Most potassium channels form homo- or heterotet-
ramers. Several different cytoplasmic tetramerization
domains have been found to be important for proper
channel assembly. For example, T1, an N-terminal
tetramerization domain, is used by the Kv channel,

replace the C-terminal domain of KcsA. The hybrid channel exhibited a
higher expression level than the wild-type and is extremely thermostable.
Surprisingly, this stable hybrid channel is equally active as the wild-type
channel in conducting potassium ions through a lipid bilayer at an acidic
pH. We suggest that a similar engineering strategy could be applied to
other ion channels for both functional and structural studies.
Structured digital abstract
l
MINT-7260032: kcsA (uniprotkb:P0A334) and kcsA (uniprotkb:P0A334) bind (MI:0407)by
molecular sieving (
MI:0071)
l
MINT-7260022: kcsA (uniprotkb:P0A334) and kcsA (uniprotkb:P0A334) bind (MI:0407)by
circular dichroism (
MI:0016)
Abbreviations
cdKcsA, C-terminal deleted KcsA; CNG, cyclic nucleotide gated; EAG, ether-a-go-go; GFC, gel filtration chromatography; Kir, potassium
inwardly rectifying; LDAO, N,N-dimethyldodecylamine-N-oxide; NPo, nominal open probability; RHCC, right-handed coiled coil; T
m,
temperature at which half the tetrameric channels dissociate into monomers; wtKcsA, wild-type KcsA; RMS, root mean square.
6236 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS
same cell type, they seldom mix with each other to
form heterotetramers [12,13]. This important intra-
family recognition is also carried out by the tetramer-
ization domains. For example, the specificity of T1
determines the compatibility of channels from different
families during Kv channel assembly [3,5,13–19]. It has
also been shown that the replacement of the T1
domain of DRK1 channel with the corresponding
domain from a distantly related Drosophila Shaker B

As expected, this hybrid channel was expressed at a
higher level than the wild-type channel in Escherichia
coli and exhibited extreme in vitro thermostability. It
remained mainly as a tetramer, even after prolonged
treatment at 100 °C in the presence of SDS. Surpris-
ingly, this stable hybrid channel without the native pH
sensor domain could still sense pH change and
conduct potassium ions.
One of the reasons for the scarcity of structural data
on channels is their relatively low protein expression
level. Because tetramer stabilities of Kv and KcsA had
been found to correlate with their expression level
[22,25], a better tetramerizing construct by protein engi-
neering may assist channel expression. Apart from
protein expression level, interdomain flexibility is
another reason for the scarcity of structural data,
because of their negative effects on the diffraction qual-
ity of protein crystals. Therefore, replacement of the ori-
ginal flexible interdomain linker by a rigid continuous
coiled coil should facilitate structure determination of
ion channels. We propose that similar engineering
effort may be applicable to other ion channels to assist
their expression, as well as structural and functional
studies.
Results
Computational design of KcsA–RHCC
The hybrid channel KcsA–GCN4 previously reported
by our laboratory is composed of a transmembrane
domain of KcsA (residues 1–120) linked to a left-
handed coiled coil GCN4-LI (pdb code: 1GCL) [23]

observed, we suspected that the linker between the
transmembrane domain and the tetramerization domain
may impair the co-operative effect on the assembly of
these two domains. Thus, new attempts were made to
Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel
FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6237
build a continuous coiled coil structure without an
intervening flexible linker. As the crystal structures of
KcsA and all selected tetramerization domains are
available, the inner helices of KcsA were structurally
aligned with the foreign coiled coils. Among the four
tetramerization domains, RHCC displayed the smallest
root mean square (RMS) deviation when compared
with the other three coiled coils (Table 1). The top
ranking hybrid structures of KcsA–RHCC (Fig. 2) were
modelled and Monte Carlo minimized using the pro-
gram zmm-mvm. The result showed that RHCC (resi-
dues 16–55) could be best spliced on to KcsA (residues
23–115) (Fig. 1A,B). This chimeric channel was cloned
with N-terminal his-tag and named KcsA–RHCC.
Expression and purification of KcsA–RHCC
Recombinant KcsA–RHCC was expressed in E. coli.
The yield of purified protein was  1.5 mgÆL
)1
. Previ-
ously it was found that deletion of the C-terminal
domain (residues 121–160) almost completely abolished
the expression of wtKcsA, but the addition of an artifi-
cial tetramerization domain GCN4 rescued the expres-
sion to wild-type level. KcsA–RHCC can reach a

is in Angstrom.
Coiled coils
RMS ranking NSP4(95–137) RH4B VASP TD RHCC
1 1.859 1.143 0.862 0.619
2 1.929 1.202 0.891 0.709
3 2.032 1.221 0.894 0.774
4 2.095 1.259 0.898 0.838
5 2.12 1.274 0.911 0.871
Fig. 2. Splicing of KcsA and RHCC. The left picture shows the
model of KcsA–RHCC. Only two subunits are shown for clarity.
The area enclosed by the square is where different splicing motifs
were tested in silico. It is displayed on the right in enlarged format
showing overlaps of different spliced structures.
RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al.
6238 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS
that of wtKcsA (Fig. 3A). The protein was purified to
homogeneity using a HisTrap
TM
HP column (Fig. 3B).
Biophysical characterization
The secondary and quaternary structures of KcsA–
RHCC were characterized by CD and gel filtration
chromatography (GFC), respectively. The CD data
showed that KcsA–RHCC is slightly more a-helical
than wtKcsA (64% versus 62%, respectively; Fig. 4A).
This is not surprising because RHCC existed predomi-
nantly as an a-helix in its crystallized form. The GFC
data showed that the majority of KcsA–RHCC is in a
tetrameric form, whereas a very small portion of it is
in a higher oligomeric form. This is very similar to that

80
60
50
40
30
20
B
0 mM Imidazole gradient 500 mM
kDa
55
35
27
15
KcsA–RHCC
Fig. 3. (A) Western blot analysis of KcsA constructs. The same
number of E. coli cells (quantified by D
600
) expressing different
KcsA constructs were analysed using 15% SDS ⁄ PAGE. KcsA was
then identified by immunoblotting using an anti-his-tag IgG. WT:
KcsA 1–160; 125: KcsA 1–125; 120: KcsA 1–120; GCN4: KcsA–
GCN4; RHCC: KcsA–RHCC. (B) Purification of KcsA–RHCC by
HisTrap
TM
HP column. Proteins samples were run on a 4–12%
SDS ⁄ PAGE and stained with Commassie Blue. There was an
increasing amount of imidazole for the elution of protein samples
from the column present in the lanes from left to right. The arrow
indicates the position of purified KcsA–RHCC protein.
0

2
/decimole)
Wavelength (nm)
KcsA–RHCC
wtkcsA
Fig. 4. Biophysical characterization of KcsA–RHCC. (A) CD spectra
of tetrameric wtKcsA and KcsA–RHCC in LDAO. Estimated a-heli-
cal contents for wtKcsA and KcsA–RHCC are 62 and 64%, respec-
tively. (B) Elution profile of wtKcsA and KcsA–RHCC from the GFC
column. The estimated molecular mass of the tetrameric LDAO–
wtKcsA and LDAO–KcsA–RHCC micelles are 114 and 149 kDa,
respectively.
Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel
FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6239
cdKcsA and RHCC, were tested individually, both
of them displayed relatively low T
m
, suggesting that
the high stability of KcsA–RHCC is the result of
a co-operative effect. At pH 4, the order of
thermostability was KcsA–RHCC > cdKcsA >
KcsA–GCN4 > wtKcsA > RHCC (Fig. 5C,D). All
constructs except cdKcsA showed a decrease in T
m
upon pH change from 8 to 4, showing that all three
tetramerization domains are somewhat sensitive to pH
change. The pH effect on wtKcsA is well documented;
however, the acid labile nature of wild-type RHCC has
not been known until this investigation. The acid
labilities of GCN4 and RHCC may be due to the

Tetramer
A
B
C
D
Dimer
Monomer
0
10
20
30
40
50
60
70
80
90
100
30 40 50 60 70 80 90 100
% of KcsA in tetrameric form
Temperature (°C)
pH8
wtKcsA
cdKcsA
KcsA–GCN4
KcsA–RHCC
RHCC
0
10
20

30.0
40.0
50.0
60.0
70.0
80.0
90.0
100.0
pH8 pH4
Temperature (°C)
Tm at different pH

wtKcsA
cdKcsA
KcsA–GCN4
KcsA–RHCC
RHCC
Fig. 5. Thermostability determination of KcsA constructs. (A) Representative SDS ⁄ PAGE used in thermostability analyses (KcsA–RHCC at
pH 8). The tetramer, dimer and monomer bands of KcsA–RHCC are indicated on the left-hand side of the gel. The specific temperatures for
heat treatment are indicated above the gel. (B, C) Comparison of stability of wtKcsA, cdKcsA, KcsA–GCN4, KcsA–RHCC and RHCC at differ-
ent temperatures at (B) pH 8 and (C) pH 4. The fractional tetramer content in each sample was determined from the densitometry scans of
SDS ⁄ PAGE. The results shown in (B) and (C) are given as mean ± standard derivation (n = 3). (D) Comparison of T
m
values of three KcsA
constructs at pH 8 and pH 4. Each curve in (B) and (C) was fitted into the sigmoidal dose responsive (variable slope) model with R
2
> 0.97
using
GRAPHPAD PRISM software (La Jolla, CA, USA). The T
m

hybrid channel (Fig. 1B, right).
Previously we proposed a model of in vivo channel
assembly describing the correlation between channel
stability and protein expression level [22]. The results
reported in this study are consistent with this model.
A
B
C
Open
Close
10 pA
15 sec
pH 4
pH 8
pH 4
pH 4
pH 8
Current (pA)
0 2 4 6 8 10
Count (N)
0
100 000
200 000
Current (pA)
0 2 4 6 8 10
Count (N)
0
40 000
80 000
120 000

for total proteins encompassing all oligomeric forms,
but not with the tetrameric form!
The coiled coil motif is a commonly found structure
in proteins. A statistical study from a genomic analysis
suggested that 5–10% of all protein sequences are in
coiled coils of various oligomeric states [34]. Typically
two to six a-helices wind around each other to form a
supercoil [35,36]. They are widely found in a diverse
array of proteins, such as transcription factors and
extracellular matrix proteins [37,38]. Because of its
simple and predictable folding properties, coiled coils
have been used as temperature regulators, antibody
stabilizers, anticancer drugs, purification tags, hydro-
gels and linker systems, etc [36].
In this study, we intended to fuse a right-handed
tetrameric coiled coil to KcsA to form a continuous
coiled coil. The multiplicity of coiled coil candidates
and the multiple possible splice junctions render
exhaustive experimental testing intractable. In silico
selection was therefore used to identify the optimal
splice variants. Both RHCC and left-handed coiled
coils were used as target candidates and our algorithm
easily identified the RHCC as better candidates. The
robustness of our computational algorithm was later
confirmed by the extreme thermostability of the
selected hybrid channel. This selection algorithm is
applicable to the design of other chimeric channels.
Regulation of ion channels by non-native domains
has been achieved in a large number of chimera experi-
ments. Most of these experiments involved intrafamily

also be applied to other ion channels as they all proba-
bly possess a RHCC structure at their respective
bundle crossing [1,47–51]. Functional minimal ion con-
ducting modules composed of S5–S6 helices from vari-
ous channels have been produced [52–55]. We envisage
that the expression of minimal channels may be facili-
tated by appropriate tetramerization domains and the
success of this effort will certainly open up the possi-
bilities in structural and functional characterization of
ion channels.
Materials and methods
Computational design of KcsA–RHCC
A comprehensive search of the Protein Data Bank [56] for
RHCC or parallel coiled coil structures that have four-fold
rotational symmetry retrieved four candidates. The pro-
gram fithelices (Doc. S1) was used to determine the
optimal splicing positions for joining the coiled coil fusion
candidate to KcsA. The indicator used by the program is
the root mean square deviation of the overlapping atoms
at the spliced site. The coordinates of the best spliced
structure for each fusion candidate were then Monte
Carlo minimized by program zmm-mvm (http://www.
zmmsoft.com/). The PDB file of the best minimized
structures can be found in Doc. S1.
Molecular cloning
The DNA sequence encoding residues Ala23-Val115 of
KcsA was amplified from pET28–KcsA [22], which con-
tains the wtKcsA gene of S. lividans, by PCR using Pfu
DNA polymerase (Fermentas, Burlington, Canada) with a
forward primer 5¢-GATTC

100 min. Protein expression was induced by the addition of
isopropyl b-d-thiogalactopyranoside to a final concentra-
tion of 1 mm. Cells were pelleted after 3 h of incubation at
37 °C, resuspended in lysis buffer (20 mm Tris, pH 8,
150 mm KCl and 1 mm phenylmethanesulfonyl fluoride)
and subsequently lysed by French Press at 10 000 psi. The
cell lysate was centrifuged at 100 000 g for 1 h and the pel-
let was solubilized in 20 mL of 20 mm Tris, pH 8, 150 mm
KCl, 1 mm phenylmethanesulfonyl fluoride and 1% v ⁄ v
N,N-dimethyldodecylamine-N-oxide (LDAO) overnight at
4 °C. The resuspended mixture was centrifuged at
100 000 g for 1 h and the supernatant was loaded on to a
HisTrap
TM
HP column (GE Healthcare, Piscataway, NJ,
USA). Protein was purified using an FPLC system
(Pharmacia, Uppsala, Sweden) with a linear gradient of
0–500 mm imidazole. Purified proteins were analysed using
a NuPAGE Novex 4–12% Bistris midi gel (Invitrogen,
Carlsbad, CA, USA) with Coomassie Blue staining.
wtKcsA, KcsA–GCN4 and RHCC were expressed and
purified in a similar manner except the absence of detergent
during RHCC purification. cdKcsA was generated by
chymotrypsin digestion of wtKcsA [22].
Thermal stability determination
Protein of KcsA–RHCC was dialysed overnight against a
solution containing 150 mm KCl, 0.1% v ⁄ v LDAO, 20 mm
Tris, pH 8 (or 15 mm potassium citrate, pH 4) in dialysis
bags with a molecular mass cut-off of 3500 Da. The dialy-
sed sample was mixed with a loading solution containing

Electrophysiology
Channel recordings were performed in a horizontal planar
lipid bilayer of 1-palmitoyl-2-oleoyl-phosphatidylethanol-
amine (POPE) and 1-palmitoyl-2-oleoyl-sn-phosphatidylgly-
cerol (POPG) (15 and 5 mgÆmL
)1
, respectively) at room
temperature. Both cis and trans chambers were filled with
solution at pH 4 (150 mm KCl, 20 mm potassium acetate)
at the start, which was changed to pH 8 (150 mm KCl,
20 mm Tris) when needed. Current records were acquired
at a sampling frequency >10 kHz and filtered to 1 kHz.
Acknowledgements
We thank Dr Richard Kammerer, University of Man-
chester, for providing us with the plasmid,
Table 2. DNA sequence of the synthesized rhcc gene.
ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT
Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel
FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6243
pET15b ⁄ RHCC. We also thank Drs Richard M. Epand,
Raquel Epand and Vettai S. Ananthanarayanan,
McMaster University, for usage of CD spectrometers;
Dr Brad Rothberg, Temple University, for usage of
electrophysiological equipment and critical reading of
this manuscript. This work was supported by Microstar
Biotech Inc. and NSERC (DY).
References
1 Doyle DA, Morais Cabral J, Pfuetzner RA, Kuo A,
Gulbis JM, Cohen SL, Chait BT & MacKinnon R
(1998) The structure of the potassium channel:

Kohler M, Kaczorowski GJ et al. (2005) Role of the
C-terminus of the high-conductance calcium-activated
potassium channel in channel structure and function.
Biochemistry 44, 10135–10144.
11 Zhou L, Olivier NB, Yao H, Young EC & Siegelbaum
SA (2004) A conserved tripeptide in CNG and HCN
channels regulates ligand gating by controlling C-termi-
nal oligomerization. Neuron 44, 823–834.
12 Wei A, Jegla T & Salkoff L (1996) Eight potassium
channel families revealed by the C. elegans genome
project. Neuropharmacology 35, 805–829.
13 Covarrubias M, Wei AA & Salkoff L (1991) Shaker,
Shal, Shab, and Shaw express independent K+ current
systems. Neuron 7, 763–773.
14 VanDongen AM, Frech GC, Drewe JA, Joho RH &
Brown AM (1990) Alteration and restoration of K+
channel function by deletions at the N- and C-termini.
Neuron 5, 433–443.
15 Schulteis CT, Nagaya N & Papazian DM (1998)
Subunit folding and assembly steps are interspersed
during Shaker potassium channel biogenesis. J Biol
Chem 273 , 26210–26217.
16 Hopkins WF, Demas V & Tempel BL (1994) Both
N-and C-terminal regions contribute to the assembly
and functional expression of homo- and heteromulti-
meric voltage-gated K+ channels. J Neurosci 14,
1385–1393.
17 Deal KK, Lovinger DM & Tamkun MM (1994) The
brain Kv1.1 potassium channel: in vitro and in vivo
studies on subunit assembly and posttranslational

tetramer. Nat Struct Biol 7, 772–776.
25 Zerangue N, Jan YN & Jan LY (2000) An artificial
tetramerization domain restores efficient assembly of
functional Shaker channels lacking T1. Proc Natl Acad
Sci USA 97, 3591–3595.
RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al.
6244 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS
26 Bowman GD, Nodelman IM, Levy O, Lin SL, Tian P,
Zamb TJ, Udem SA, Venkataraghavan B & Schutt CE
(2000) Crystal structure of the oligomerization domain
of NSP4 from rotavirus reveals a core metal-binding
site. J Mol Biol 304, 861–871.
27 Sales M, Plecs JJ, Holton JM & Alber T (2007) Struc-
ture of a designed, right-handed coiled-coil tetramer
containing all biological amino acids. Protein Sci 16,
2224–2232.
28 Kuhnel K, Jarchau T, Wolf E, Schlichting I, Walter U,
Wittinghofer A & Strelkov SV (2004) The VASP tetra-
merization domain is a right-handed coiled coil based
on a 15-residue repeat. Proc Natl Acad Sci USA 101,
17027–17032.
29 Cortes DM, Cuello LG & Perozo E (2001) Molecular
architecture of full-length KcsA: role of cytoplasmic
domains in ion permeation and activation gating.
J Gen Physiol 117, 165–180.
30 Perozo E, Cortes DM & Cuello LG (1999) Structural
rearrangements underlying K+-channel activation
gating. Science 285, 73–78.
31 Cordero-Morales JF, Cuello LG, Zhao Y, Jogini V,
Cortes DM, Roux B & Perozo E (2006) Molecular

a lipid membrane-like environment. Nature 450,
376–382.
40 Nishida M, Cadene M, Chait BT & MacKinnon R
(2007) Crystal structure of a Kir3.1-prokaryotic Kir
channel chimera. EMBO J 26, 4005–4015.
41 Zhao X, Bucchi A, Oren RV, Kryukova Y, Dun W,
Clancy CE & Robinson RB (2009) In vitro character-
ization of HCN channel kinetics and frequency
dependence in myocytes predicts biological pacemaker
functionality. J Physiol 587, 1513–1525.
42 Urquhart W, Gunawardena AH, Moeder W, Ali R,
Berkowitz GA & Yoshioka K (2007) The chimeric cyc-
lic nucleotide-gated ion channel ATCNGC11 ⁄ 12 consti-
tutively induces programmed cell death in a Ca2+
dependent manner. Plant Mol Biol 65
, 747–761.
43 Varshney A & Mathew MK (2003) Inward and outward
potassium currents through the same chimeric human
Kv channel. Eur Biophys J 32, 113–121.
44 Cao Y, Crawford NM & Schroeder JI (1995) Amino
terminus and the first four membrane-spanning
segments of the Arabidopsis K+ channel KAT1 confer
inward-rectification property of plant–animal chimeric
channels. J Biol Chem 270, 17697–17701.
45 Lu Z, Klem AM & Ramu Y (2001) Ion conduction
pore is conserved among potassium channels. Nature
413, 809–813.
46 Ohndorf UM & MacKinnon R (2005) Construction of
a cyclic nucleotide-gated KcsA K+ channel. J Mol Biol
350, 857–865.

forms a toxin-activatable ionophore. J Biol Chem 277,
24653–24658.
55 Santos JS, Grigoriev SM & Montal M (2008) Molecular
template for a voltage sensor in a novel K+ channel.
III. Functional reconstitution of a sensorless pore
module from a prokaryotic Kv channel. J Gen Physiol
132, 651–666.
56 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat
TN, Weissig H, Shindyalov IN & Bourne PE (2000)
The Protein Data Bank. Nucleic Acids Res 28, 235–242.
57 Dong H, Nilsson L & Kurland CG (1996) Co-variation
of tRNA abundance and codon usage in Escherichia
coli at different growth rates. J Mol Biol 260, 649–663.
58 Shevchuk NA, Bryksin AV, Nusinovich YA, Cabello
FC, Sutherland M & Ladisch S (2004) Construction of
long DNA molecules using long PCR-based fusion of
several fragments simultaneously. Nucleic Acids Res 32,
e19.
59 Zhou Y, Morais-Cabral JH, Kaufman A & MacKinnon
R (2001) Chemistry of ion coordination and hydration
revealed by a K+ channel-Fab complex at 2.0 A
resolution. Nature 414, 43–48.
Supporting information
The following supplementary material is available:
Doc. S1. Program fithelices (in FORTRAN) and the
PDB coordinates of KcsA–RHCC.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied