Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot - Pdf 11

The effects of a-secretase ADAM10 on the proteolysis of
neuregulin-1
Christian Freese
1,
*, Alistair N. Garratt
2
, Falk Fahrenholz
1
and Kristina Endres
1
1 Institute of Biochemistry, Johannes Gutenberg-University, Mainz, Germany
2 Department of Neurosciences, Max-Delbru
¨
ck-Centre, Berlin, Germany
Neuregulin-1 (NRG-1) belongs to a family of growth
factors that transduce cellular signals by binding to
ErbB receptors [1,2]. At least sixteen different gene
products of NRG-1 have been identified [3,4], which
display a wide range of functions in the developing as
well as in the adult organism. Besides organs such as
the heart [5,6] or breasts [7], certain isoforms of
NRG-1 mediate important properties in the central
and peripheral nervous system: synapse formation [8]
and transmission [9], expression of neurotransmitter
receptors [10–12] and synaptic plasticity [13]. Addi-
tionally, general features of neurones or Schwann
cells, such as proliferation, differentiation, migratory
processes and regeneration, depend on NRG-1
activity [14–17].
Although some of these functions are restricted to
the developing embryonic brain, expression of NRG-1

essential for myelination and other important neuronal functions, is
cleaved by ADAM10. Studies with b- and c-secretase inhibitors, as well
as with the metalloproteinase inhibitor GM6001, revealed an inhibition of
neuregulin-1 processing in human astroglioma cell line U373; however,
specific RNA interference-induced knockdown of ADAM10 remained
without effect. In vivo investigations of mice overexpressing either
ADAM10 or dominant negative ADAM10 showed unaltered cleavage of
neuregulin-1 compared to wild-type animals. As a consequence, the mye-
lin sheath thickness of peripheral nerves was unaffected in mice with
altered ADAM10 activity. Thus, although the b-secretase BACE-1 acts as
a neuregulin-1 sheddase, ADAM10 does not lead to altered neuregulin-1
processing either in cell culture or in vivo. Adverse reactions of an
ADAM10-based therapy of Alzheimer’s disease due to neuregulin-1 cleav-
age are therefore unlikely.
Abbreviations
APLP, amyloid precursor-like protein; APP, amyloid precursor protein; APPs, soluble APP fragment; DAPT, N-[N-(3,5-difluorophenacetyl)-
L-alanyl]-S-phenylglycine t-butyl ester; NRG-1, neuregulin-1; RNAi, RNA interference.
1568 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
cultures derived from adult murine hippocampi [21].
There is substantial genetic evidence that single nucleo-
tide polymorphisms of NRG-1 are associated with the
pathogenesis of schizophrenia [23–25]. In addition,
NRG-1 has been found to be involved in the patho-
genesis of other diseases such as multiple sclerosis
[26,27] or breast cancer [7].
How proteins derived from the gene for NRG-1 ful-
fil their different functions exactly remains elusive: iso-
forms of type I and III exist as transmembrane forms
or can be proteolytically processed [8,28–30] to release
soluble fragments. It is not known in detail whether

ques in a mouse model of the disease [40]. Moreover,
ADAM10 restores long-term potentiation and
increases cognitive function in transgenic mice [40,41]
and enhances cortical synaptogenesis [42]. Due to the
overlap of substrate specificity of BACE-1 and
ADAM10 with respect to substrates such as APP or
the APLPs and partial phenotypic overlap of
ADAM10 and NRG-1 knockout mice [43–45], it was
considered important to investigate the possible role of
ADAM10 in NRG-1 processing in cells and in the
living animal.
Results
Identification of NRG-1 isoforms expressed in the
human astroglioma cell line U373
The expression and processing of NRG-1 was
described previously in different astroglioma cell lines
[31]. Therefore, we chose the human astroglioma cell
line U373 to examine the relevance of ADAM10 for
NRG-1 shedding. The investigated cell line stably
overexpresses the human neuron specific APP isoform
695 to provide an appropriate control substrate for
a- as well as b- and c-secretases [39,46].
Recently, sixteen different isoforms of NRG-1 gen-
erated by alternative promoter usage, transcription
initiation sites or splicing [4,47,48] have been
described, and a wide variety of these isoforms are
found in brain-derived cell types [49–51]. To charac-
terize the isoforms present in the U373 cell line, we
performed RT-PCR with domain specific primers
[52,53]. Type I as well as type III specific PCR prod-

were detectable. After serum free incubation of cells
for 4 h, a band of approximately 60 kDa (N-terminal
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1569
fragment) was detected in cell supernatants using the
pan-NRG-1 antibody against the ectodomain, which
recognizes a- as well as b-isoforms (Fig. 1C). This pro-
tein reveals a slightly lower molecular weight com-
pared to the results obtained by Ritch et al. [31] where
secreted NRG-1 had a molecular mass of 70 kDa.
Because at least two Asn residues and 11 Thr ⁄ Ser resi-
dues were identified as potential sites for N- or O-gly-
cosylation of NRG-1 [54], the deviation in the size of
the soluble protein fragment may depend on different
glycosylation patterns in the investigated cell lines. In
mouse brain membranes, a panel of proteins in the
approximate range of 160–70 kDa was observed
(Fig. 1C), which corresponds to NRG-1 species
described for mouse brain as well as human brain
material [19]. Similar to cell supernatants, the soluble
fraction of mouse brain contained a secreted form of
NRG-1 of 55–60 kDa.
Fig. 1. Isoforms of NRG-1 expressed in the human astroglioma cell line U373 and mouse brain. (A) In general, three major types of
NRG-1 are generated, which all share an EGF-like domain; further variation is achieved through differences in the sequences of the
C-terminal part of the EGF domain (a or b) isoforms, and the juxtamembrane region (e.g. a2orb1 isoforms) and other domains such
as the type II specific Kringle or the type III specific cysteine-rich domain. (B) To identify mRNA species of NRG-1 present in the
human astroglioma cell line U373, RT-PCR was performed. A sample lacking RNA was used as a no template control (NT) and a
GAPDH sequence was amplified for the reaction control. (C) NRG-1 protein expression in U373 cells and mouse brain was analyzed
using the antibody against the C-terminus or against the extracellular domain. Cell lysate or the membrane fraction from mouse brain
was subjected to 4–12% NuPAGE and cell supernatants (medium) or soluble proteins from mouse brain were subjected to 8%

239
Cysteine rich domain (type III) NRG-CRD_for
NRG-CRD_rev
GAGGTGAGCCGATGGAGATTTA
CCTCTCAGGCGCTCAGCTTC
219
a NRG-5¢_for
NRG-a_rev
TCTCCGGCGAGATGTCCGA
GCTCCAGTGAATCCAGGTTG
668
b NRG-5¢_for
NRG-Beta_rev
TCTCCGGCGAGATGTCCGA
GGCAGCGATCACCAGTAAAC
677
GAPDH GAPDH_for
GAPDH_rev
GAAGGGCTCATGACCACAGTCCAT
TCATTGTCGTACCAGGAAATGAGCTT
450
Fig. 2. Proteolytical processing of APP and NRG-1 in U373 cells. U373 cells overexpressing human APP695 were incubated with inhibitors
for b-secretase, c-secretase or metalloproteinases, or stimulated with phorbol 12-myristate 13-acetate. Proteolytic processing products of
APP or NRG-1 were detected in culture supernatants after precipitation or in lysed cells with appropriate antibodies. (A) Cells were incubated
with the tripeptidic inhibitor of the b-secretase (25 l
M) and shedded APPs-b or NRG-1 was visualized by western blotting. (B) Full length pro-
tein (FL) or C-terminal membrane tethered fragments (CTF) of either APP or NRG-1 were detected in cell lysates after an incubation period
of 48 h with 2 l
M DAPT. (C) Phorbol 12-myristate 13-acetate (PMA) (1 lM, 4 h) or GM6001 (10 lM, 26 h) were added to the cells to investi-
gate the influence of metalloproteinases on secretion of NRG-1 ectodomain (NTF, N-terminal fragment) in U373 cells. APPs-a served as a

cells; Fig. 2C). Therefore, metalloproteinases appear to
be involved in NRG-1 processing in the astrocytoma
cell line U373, as previously described for other cell
lines [28,55].
RNA interference (RNAi)-induced knockdown of
ADAM10 has no influence on NRG-1 shedding
Because GM6001, which was used for inhibitory stud-
ies, is a broad spectrum inhibitor of MMPs as well as
ADAMs, we chose the RNAi approach to analyze in
particular the role of ADAM10 in NRG-1 cleavage. As
a control for unspecific RNAi-induced effects, MMP2
knockdown was examined as well. RNAi treatment tar-
geted against endogenous ADAM10 of the U373 cells
resulted in a 60% reduction of mature ADAM10,
whereas MMP2 targeted oligomers had no influence
(Fig. 3A). The decrease of ADAM10 due to RNAi was
accompanied by a 30% decrease in APPs-a shedding
(Fig. 3B) serving as an internal control. Because APP is
Immature
Mature
Fig. 3. Influence of siRNA mediated knock-
down of ADAM10 on APP or NRG-1
processing in U373 cells. U373 cells were
transfected with a set of RNA oligomers
targeted to ADAM10 (AD). Mock-transfect-
ed cells (C) or cells transfected with RNA
oligomers against MMP2 (M) were used as
controls. Forty-eight hours after transfection,
cells were investigated with respect to
ADAM10 and products of APP or NRG-1

not a major sheddase of this protein (Fig. 3C).
In vivo effect of ADAM10 on NRG-1 proteolysis
Because ADAM10 was not implicated in the shedding
of distinct NRG-1 isoforms of cultured human astro-
glioma cells (a2 and b2; Fig. 1B), we analyzed NRG-1
processing in ADAM10 overexpressing mice to take
into account all of the expressed isoforms. Two trans-
genic mouse lines with different expression levels of
ADAM10 (moderate, ADAM10mo; high, ADAM10hi)
and a mouse line transgenic for a dominant negative
ADAM10 mutant (ADAM10dn) were included in this
investigation. All mouse lines have been examined in
detail elsewhere with respect to APP processing, learn-
ing and behaviour [40,41,56]. The expression of the
proteinase itself is illustrated in Fig. 4A (lower part).
In soluble protein fractions of brains derived from the
three transgenic lines, the amount of the N-terminal
fragment of NRG-1 (approximately 60 kDa; Fig. 4)
was not changed compared to the wild-type. Addition-
ally, neither full length NRG-1, nor C-terminal frag-
ments in the brain membrane fraction were influenced
by an altered ADAM10 amount or activity (Fig. 4).
We therefore conclude that, in vivo, the proteolytic
processing of NRG-1 does not depend on the a-secre-
tase ADAM10.
For further confirmation of these findings, we exam-
ined the myelination of peripheral nerves in ADAM10
transgenic mice and mice overexpressing dominant
negative ADAM10. Because myelination strongly
depends on NRG-1-ErbB signalling of Schwann cells

but tomacula-like structures (local myelin thickenings
[60]) were observed. Additionally, in the mouse line
with higher ADAM10 expression (ADAM10hi), Akt-
phosphorylation was significantly reduced to 40%
compared to wild-type mice. This probably reflects
effects that do not depend on NRG-1 cleavage.
Discussion
The data obtained in the present study for the human
astroglioma cell line U373 clearly reveal BACE-1 and
c-secretase dependent shedding of the endogenous
ErbB receptor ligand, which we identified predomi-
nantly as type a2-NRG-1 and, to a lesser extent, as
the b2 isoform. Additionally, GM6001, a broad spec-
trum metalloproteinase inhibitor, was able to reduce
NRG-1 shedding but a specific knockdown of
ADAM10 by RNAi remained without any effect
within the cellular system. Therefore, the present study
demonstrates that ADAM10 is not a major sheddase
of neuregulin-1 and enhancement of ADAM10 will
probably have no side effects due to NRG-1 cleavage.
Because catalytically active ADAM10 is found on
the plasma membrane [38] and neuregulin-1b1 cleav-
age, for example, is restricted to the Golgi apparatus
[28], it is plausible that distinct localization of
ADAM10 and NRG-1 might inhibit a functional sub-
strate–proteinase interaction. Furthermore, NRG-1 is
mainly found in cholesterol rich lipid rafts [61,62],
favouring its role as a BACE-1 substrate, whereas
ADAM10 and its catalytic activity (at least for APP)
were shown to be localized in cholesterol-poor nonraft

[29,34], mice at postnatal day 30 or even older
(2 years) showed no abnormalities with respect to neu-
regulin-1 processing. In the case of ADAM10, investi-
gations of adult mice moderately overexpressing
Fig. 6. Akt-phosphorylation in ADAM10 transgenic mice. (A) Total-
Akt and phospho-Akt were detected by western blotting in soluble
fractions of brains from ADAM10mo, ADAM10hi and ADAM10dn
mice. Nontransgenic littermates (Wt, wild-type) were used as con-
trols. (B) Phospho-Akt was normalized by total-Akt and quotients
from wild-type mice were set to 100%. Values represent
the mean ± SEM (n = 4 for each mouse line; one-way analysis of
variance ⁄ Bonferroni post hoc test: **P < 0.01).
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1575
ADAM10 or its dominant negative variant resulted in
totally unchanged amounts of NRG-1 processing
products.
Therefore, the influence of ADAM10 on NRG-1 was
additionally analyzed in young mice (postnatal day 17)
by the status of peripheral nerve ensheathment. In the
second postnatal week, myelination is almost finished in
mice (central nervous system [65]; peripheral nervous
system [66]); therefore, alterations should be apparent.
However, neither moderate ADAM10 overexpressing
mice, nor mice with a restriction of enzyme activity by
dominant negative ADAM10, revealed differences in
axon myelination parameters compared to wild-type
littermates at postnatal day 17.
Surprisingly, adult mice with high levels of
ADAM10 overexpression showed myelin infoldings

occurred by ErbB2 cleavage in our transgenic mice.
However, because we did not observe an influence on
myelination in ADAM10 transgenic mice, this observa-
tion might be restricted to tumour cells.
We also cannot exclude that, in non-neuronal tis-
sue, embryonic development or pathological stages
ADAM10 itself, or cleavage products of its other sub-
strates, might be involved in NRG-1-ErbB cross-talk.
In summary, however, we present evidence demonstrat-
ing that, in the healthy early postnatal and adult
mouse, moderate alterations in the amount of
ADAM10 do not interfere with neuregulin-1 signalling.
Accordingly, ADAM10 will have no impact on down-
stream physiological functions such as nerve remyelina-
tion or the schizophrenia-resembling psychiatric
changes as observed for BACE-1 knockout mice
[34,69]. The results obtained in the present study there-
fore suggest that a moderate upregulation of ADAM10
expression and its a-secretase activity with a preventive
or therapeutical intention is not impaired by side effects
resulting from the NRG-1-ErbB signalling network.
Experimental procedures
Antibodies, inhibitors and RNAi oligomers
The primary antibodies used were: 6E10 for the detection
of APPs-a (Senetek, St Louis, MO, USA; dilution
1 : 1000), anti-neuregulin-1 (H-210; dilution 1 : 200) for the
detection of secreted NRG-1 fragments, anti-neuregulin-
1a ⁄ b1 ⁄ 2 (C-20; dilution 1 : 500) (both Santa Cruz Biotech-
nology, Santa Cruz, CA, USA) for the detection of
membrane bound NRG-1, anti-ADAM10 (Chemicon,

were used. Transfections were performed with Opti-MEM
and Lipofectamine2000 (Invitrogen).
ADAM10 and neuregulin-1 processing C. Freese et al.
1576 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
RNA preparation and RT-PCR
The RNA of U373 cells was isolated by using confluent 6 cm
culture plates and the RNA isolation kit with on-column
DNA digestion as recommended in the manufacturer’s pro-
tocol (Macherey-Nagel, Du
¨
ren, Germany). Four hundred
nanograms of RNA were reverse transcribed in a 20 lL reac-
tion volume by the reverse-it-RT-PCR-kit from ABgene
(Hamburg, Germany) with intron-spanning specific primers
(0.2 lm each). Amplificates were analyzed on 1% agarose
gels and GAPDH amplification served as a control for the
RT-PCR reaction and PCR conditions. Primer sequences
and the amplificate length are provided in Table 1.
The amplificates from RT-PCR with primers NRG-
jD_for and NRG-TM_rev were ligated into pUC19 (Fer-
mentas, St Leon-Rot, Germany) and plasmid DNA from
eight positive clones (identified by blue–white selection) was
sequence analyzed with M13 universal primer.
Preparation of mouse brain samples
The generation of transgenic mice has been described
previously [40]. Seven- to 10-week-old mice were sacrificed,
the brains were dissected and stored on dry ice. Ice-cold
Tris buffer (20 m m Tris ⁄ HCl, pH 8.5) containing proteinase
inhibitors (Inhibitor Complete Mini; Roche Diagnostics
Corp., Mannheim, Germany) was added and tissue was

) and
fresh inhibitor was added for an additional 4 h. Phorbol
12-myristate 13-acetate-induced shedding was performed
for 4 h in serum free BSA supplemented medium. For inhi-
bition of c-secretase, cells were treated with DAPT for 48 h
in culture medium.
For RNAi experiments, cells were transfected with
750 pmol of RNAi oligomers (250 pmol each) in six-well
plates. After 5 h of transfection, the medium was replaced
by culture medium. After 44 h, cells were covered with
serum-free medium and incubated for 4 h for collection of
secreted proteins and cell lysates.
Western blotting
Proteins of cell culture supernatants were precipitated with
trichloroacetic acid and normalized by the protein content
of the cell lysates. Adequate amounts of soluble or mem-
brane tethered proteins were separated on 8% SDS-gels or
4–12% Bis–Tris NuPAGE gels (Invitrogen) and blotted on
a poly(vinylidene difluoride) membrane or nitrocellulose
(total-Akt and phospho-Akt). Proteins were then detected
with the appropriate primary antibodies. Chemiluminescent
signals from alkaline phosphatase or horseradish peroxidase
coupled secondary antibodies were visualized with a
charge-coupled device camera and the software versa doc
(Bio-Rad, Munich, Germany) and were quantified with
aida 3.5 (Raytest, Straubenhardt, Germany).
Electron microscopy and G-ratio determination
Seventeen-day-old or adult transgenic mice (15–17 months
old) and nontransgenic littermates were perfused with
NaCl ⁄ P

disease’ funded by the Federal Ministry of Education
and Research (to A.N.G.).
References
1 Buonanno A & Fischbach GD (2001) Neuregulin and
ErbB receptor signaling pathways in the nervous sys-
tem. Curr Opin Neurobiol 11, 287–296.
2 Esper RM, Pankonin MS & Loeb JA (2006) Neuregu-
lins: versatile growth and differentiation factors in ner-
vous system development and human disease. Brain Res
Rev 51, 161–175.
3 Falls DL (2003) Neuregulins: functions, forms, and sig-
naling strategies. Exp Cell Res 284, 14–30.
4 Steinthorsdottir V, Stefansson H, Ghosh S, Birgisdottir
B, Bjornsdottir S, Fasquel AC, Olafsson O, Stefansson
K & Gulcher JR (2004) Multiple novel transcription ini-
tiation sites for NRG1. Gene 342, 97–105.
5 Garratt AN, Ozcelik C & Birchmeier C (2003) ErbB2
pathways in heart and neural diseases. Trends Cardio-
vasc Med 13, 80–86.
6 Negro A, Brar BK & Lee KF (2004) Essential roles of
Her2 ⁄ erbB2 in cardiac development and function.
Recent Prog Horm Res 59, 1–12.
7 Britsch S (2007) The neuregulin-I ⁄ ErbB signaling sys-
tem in development and disease. Adv Anat Embryol Cell
Biol 190, 1–65.
8 Ozaki M, Sasner M, Yano R, Lu HS & Buonanno A
(1997) Neuregulin-beta induces expression of an
NMDA-receptor subunit. Nature 390, 691–694.
9 Roysommuti S, Carroll SL & Wyss JM (2003) Neuregu-
lin-1beta modulates in vivo entorhinal-hippocampal

63–75.
17 Kerber G, Streif R, Schwaiger FW, Kreutzberg GW &
Hager G (2003) Neuregulin-1 isoforms are differentially
expressed in the intact and regenerating adult rat ner-
vous system. J Mol Neurosci 21, 149–165.
18 Law AJ, Shannon WC, Hyde TM, Kleinman JE & Harri-
son PJ (2004) Neuregulin-1 (NRG-1) mRNA and protein
in the adult human brain. Neuroscience 127, 125–136.
19 Chaudhury AR, Gerecke KM, Wyss JM, Morgan DG,
Gordon MN & Carroll SL (2003) Neuregulin-1 and
erbB4 immunoreactivity is associated with neuritic pla-
ques in Alzheimer disease brain and in a transgenic
model of Alzheimer disease. J Neuropathol Exp Neurol
62, 42–54.
20 Garcia RA, Vasudevan K & Buonanno A (2000) The
neuregulin receptor ErbB-4 interacts with PDZ-contain-
ing proteins at neuronal synapses. Proc Natl Acad Sci
USA 97, 3596–3601.
21 Gerecke KM, Wyss JM & Carroll SL (2004) Neuregu-
lin-1beta induces neurite extension and arborization in
cultured hippocampal neurons. Mol Cell Neurosci 27,
379–393.
22 Kwon OB, Longart M, Vullhorst D, Hoffman DA &
Buonanno A (2005) Neuregulin-1 reverses long-term
potentiation at CA1 hippocampal synapses. J Neurosci
25, 9378–9383.
23 Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjorns-
dottir S, Sigmundsson T, Ghosh S, Brynjolfsson J,
Gunnarsdottir S, Ivarsson O, Chou TT et al. (2002)
Neuregulin 1 and susceptibility to schizophrenia. Am J

nation by the beta-secretase BACE1. Science 314, 664–
666.
30 Montero JC, Yuste L, az-Rodriguez E, Esparis-Ogando
A & Pandiella A (2000) Differential shedding of trans-
membrane neuregulin isoforms by the tumor necrosis
factor-alpha-converting enzyme. Mol Cell Neurosci 16,
631–648.
31 Ritch PS, Carroll SL & Sontheimer H (2005) Neuregu-
lin-1 enhances survival of human astrocytic glioma cells.
Glia 51, 217–228.
32 Bao J, Wolpowitz D, Role LW & Talmage DA (2003)
Back signaling by the Nrg-1 intracellular domain. J Cell
Biol 161, 1133–1141.
33 Zhang Z, Prentiss L, Heitzman D, Stahl RC, DiPino Jr
F & Carey DJ (2006) Neuregulin isoforms in dorsal
root ganglion neurons: effects of the cytoplasmic
domain on localization and membrane shedding of
Nrg-1 type I. J Neurosci Res 84, 1–12.
34 Hu X, Hicks CW, He W, Wong P, Macklin WB, Trapp
BD & Yan R (2006) Bace1 modulates myelination in
the central and peripheral nervous system. Nat Neurosci
9, 1520–1525.
35 Shirakabe K, Wakatsuki S, Kurisaki T & Fujisawa-
Sehara A (2001) Roles of Meltrin beta ⁄ ADAM19 in
the processing of neuregulin. J Biol Chem 276, 9352–
9358.
36 Walsh DM, Minogue AM, Sala FC, Fadeeva JV, Wasco
W & Selkoe DJ (2007) The APP family of proteins: simi-
larities and differences. Biochem Soc Trans 35, 416–420.
37 Schillo S, Pejovic V, Hunzinger C, Hansen T, Pozna-

44 Kramer R, Bucay N, Kane DJ, Martin LE, Tarpley JE
& Theill LE (1996) Neuregulins with an Ig-like domain
are essential for mouse myocardial and neuronal devel-
opment. Proc Natl Acad Sci USA 93, 4833–4838.
45 Hartmann D, de Strooper B, Serneels L, Craessaerts K,
Herreman A, Annaert W, Umans L, Lubke T, Lena
IA, von Figura K et al. (2002) The disintegrin ⁄ metallo-
protease ADAM 10 is essential for Notch signalling but
not for alpha-secretase activity in fibroblasts. Hum Mol
Genet 11, 2615–2624.
46 Endres K, Postina R, Schroeder A, Mueller U &
Fahrenholz F (2005) Shedding of the amyloid precursor
protein-like protein APLP2 by disintegrin-metallopro-
teinases. FEBS J 272, 5808–5820.
47 Tan W, Wang Y, Gold B, Chen J, Dean M, Harrison
PJ, Weinberger DR & Law AJ (2007) Molecular clon-
ing of a brain-specific, developmentally regulated
neuregulin 1 (NRG1) isoform and identification of a
functional promoter variant associated with schizophre-
nia. J Biol Chem 282, 24343–24351.
48 Peles E & Yarden Y (1993) Neu and its ligands: from
an oncogene to neural factors. Bioessays 15, 815–824.
49 Lacroix-Fralish ML, Tawfik VL, Nutile-McMenemy N,
Harris BT & Deleo JA (2006) Differential regulation of
neuregulin 1 expression by progesterone in astrocytes
and neurons. Neuron Glia Biol 2, 227–234.
50 Tokita Y, Keino H, Matsui F, Aono S, Ishiguro H,
Higashiyama S & Oohira A (2001) Regulation of neu-
regulin expression in the injured rat brain and cultured
astrocytes. J Neurosci 21, 1257–1264.

acute excytotoxic stress. Neuroscience 152, 459–468.
57 Nave KA & Salzer JL (2006) Axonal regulation of myeli-
nation by neuregulin 1. Curr Opin Neurobiol 16, 492–500.
58 Hellyer NJ, Kim MS & Koland JG (2001) Heregulin-
dependent activation of phosphoinositide 3-kinase and
Akt via the ErbB2 ⁄ ErbB3 co-receptor. J Biol Chem
276, 42153–42161.
59 Monje PV, Bunge MB & Wood PM (2006) Cyclic AMP
synergistically enhances neuregulin-dependent ERK and
Akt activation and cell cycle progression in Schwann
cells. Glia 53, 649–659.
60 Adlkofer K, Frei R, Neuberg DH, Zielasek J, Toyka
KV & Suter U (1997) Heterozygous peripheral myelin
protein 22-deficient mice are affected by a progressive
demyelinating tomaculous neuropathy. J Neurosci 17,
4662–4671.
61 Frenzel KE & Falls DL (2001) Neuregulin-1 proteins in
rat brain and transfected cells are localized to lipid
rafts. J Neurochem 77, 1–12.
62 Wakatsuki S, Kurisaki T & Sehara-Fujisawa A (2004)
Lipid rafts identified as locations of ectodomain
shedding mediated by Meltrin beta ⁄ ADAM19. J Neuro-
chem 89, 119–123.
63 Campsall KD, Mazerolle CJ, De RY, Kothary R &
Wallace VA (2002) Characterization of transgene
expression and Cre recombinase activity in a panel of
Thy-1 promoter-Cre transgenic mice. Dev Dyn 224,
135–143.
64 Sankaranarayanan S, Price EA, Wu G, Crouthamel
MC, Shi XP, Tugusheva K, Tyler KX, Kahana J, Ellis

Birchmeier C (2000) A dual role of erbB2 in myelina-
tion and in expansion of the schwann cell precursor
pool. J Cell Biol 148, 1035–1046.
ADAM10 and neuregulin-1 processing C. Freese et al.
1580 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status