Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot - Pdf 11

Characterization of recombinant forms of the yeast Gas1 protein
and identification of residues essential for glucanosyltransferase
activity and folding
Cristina Carotti
1
, Enrico Ragni
1
, Oscar Palomares
2
, Thierry Fontaine
3
, Gabriella Tedeschi
4
,
Rosalı
´
a Rodrı
´
guez
2
, Jean Paul Latge
´
3
, Marina Vai
5
and Laura Popolo
1
1
Dipartimento di Scienze Biomolecolari e Biotecnologie, Universita
`
degli Studi di Milano, Milano, Italy;

ylotrophic yeast Pichia past oris. Here we r eport that 48 h
after induction with methanol, soluble Gas1p was produced
at a y ield of % 10 mgÆL
)1
of medium, and this value w as
unaffected by the further removal of the serine-rich region or
by fusion to a 6 · His tag. Purified soluble Gas1 protein
showed b-(1,3)-glucanosyltransferase activity that was
abolished by replacement o f the putative catalytic residues,
E161 and E262, with glutamine. Spectral studies confirmed
that the recombinant soluble Gas1 protein assumed a stable
conformation in P. pastoris. Interestingly, thermal dena-
turation studies demonstrated that Gas1p is highly resistant
to heat denaturation, and a complete refolding of the protein
following heat treatment was observed. We also showed that
Gas1p contains five intrachain disulphide bonds. T he effects
of the C74S, C103S and C265S substitutions in the mem-
brane-bound Gas1p were analyzed in S. cerevisiae.The
Gas1-C74S protein was t otally unable to complement the
phenotype o f t he gas1 null mutant. We found that C74 is an
essential residue for the proper f olding and maturation of
Gas1p.
Keywords: b(1,3)-glucanosyltransferase; Gas1 protein;
Pichia pastoris; yeast cell wall.
The cell wall is an extracellular compartment that plays
several essential functions in yeast a nd fungal cells. It
determines the cell morphology and preserves o smotic
integrity. In fungal pathogens, the cell wall is involved in the
interaction with the host cells and in virulence. The
biogenesis of the extracellular matrix is a fascinating aspect

b-N-acetylglucosaminidase H; GH, glycoside h ydrolases; GluTD,
b-(1,3)-glucan transferase domain; GPI, glycosylphosphatidyl-
inositol; H, 6 · His.
(Received 20 May 2004, revised 15 July 2004, accepted 21 July 2004)
Eur. J. Biochem. 271, 3635–3645 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04297.x
The reaction mechanism proposed for these enzymes is a
general acid/base catalysis [5]. Protonation of the glycosidic
oxygen by a catalytic acid residue is f ollowed by the release
of the cleaved product and stabilization of the carbon cation
by the catalytic nucleophile. The new reducing end is then
transferred to the hydroxyl group at the 3 -position of the
nonreducing end of another a cceptor molecule, yielding a
linear transfer product longer than the original substrate
[3,4]. At low c oncentrations of substrate, the reaction is
preferentially hydrolytic, the hydroxyl group of a water
molecule being the final acceptor. In glycoside hydrolases,
as for many cellulases, mannanases or glucanases, the
proton donor and the nucleophile residues are usually
aspartates or glutamates [6–8]. These residues are located in
different microenvironments that influence t he protonation
state of the carboxyl group of their side-chain [7].
The a im of the present study was to express Ga s1p a t
high levels for biochemical and structural characterization
of the protein as a r epresentative of the GH72 family.
Spectroscopic analyses o f t he purified proteins were
performed, and the behaviour of the purified protein
upon heat treatment was also monitored. By combining
heterologous expression and site-directed mutagenesis, the
role of two putative catalytic residues was investigated.
Moreover, the disulphide bonds present in Gas1p were

% (w/v) biotin, 2% (w/v) aga r] and
minimal methanol plates [0.5% (v/v) methanol, 1.34% (w/v)
YNB, 4 · 10
)5
% (w/v) biotin, 2% (w/v) agar] were used.
To induce the expression of recombinant proteins, the
His
+
Mut
s
colonies were shifted from a glycerol-complex
medium [1% (w/v) yeast extract, 2% ( w/v) peptone, 1%
(v/v) glycerol, 1.34% (w/v) YNB, 4 · 10
)5
% (w/v) biotin]
to a methanol-complex medium [1% (w/v) yeast extract,
2% (w/v) peptone, 0.5% (v/v) methanol, 1.34% (w/v) Y NB,
4 · 10
)5
% (w/v) biotin], according to the man ufacturer’s
instructions. Cells were grown in b atches at 30 °Cwith
strong agitation, and the growth was monitored th rough the
increase in attenuance at 600 nm.
The S. cerevisiae haploid strain, WB2d, carrying a n
inactivated GAS1 gene (ga s1::LEU2), was used for the
expression of the glycosylphosphatidylinositol (GPI)-
anchored forms Gas1-C74S, Gas1-C103S and Gas1-
C265S. S. cerevisiae cells were cultured in batches at 30 °C
in SC medium [0.67% (w/v) YNB, 2% (w/v) glucose and
the required supplements at 50 mgÆL

box region) – were obtained using the forward primer
XHup (5¢-GCATATTCGACTGA
CTCGAGACGATGT
TCCAGCGATTGAA-3¢) and the reverse primers XHdown
(5¢-ATCGTCGGGCTCA
GGATCCTTAAGATGAAGA
TGAAGCTGAAGA-3¢) or XH-Sdown (5 ¢-GTCGTCG
AGCTCA
GGATCCTTAATCAACACTACCTGATGC
AGA-3¢), respectively. XHup is complementary to nucleo-
tides +68 to +87 o f the coding region of GAS1 and has an
XhoI site incorporated (underlined). XHdown and XH-
Sdown are complementary to nucleotides +1549 to +1569
and to nucleotides +1426 to +1446, respectively, and have
an in-frame TAA stop codon (shown in bold) and a BamHI
site (underlined).
For each construct, a 6 · His ( H)-tagged s oluble form
was p repared using the same f orward primer, Xhup, and
the reverse primer His-XHdown (5¢-ATCGTCGGG
CTCA
GGATCCTTAGTGATGGTGATGGTGATGAGA
TGAAGATGAAGCTGAAGA-3¢), for Gas1
523
-H, or
His-XH-Sdown (5¢-GTCGTCGAGCTCA
GGATCCTTA
GTGATGGTGATGGTGATGATCAACACTACCTGAT
GCAGA-3¢), for sGas1
482
-H (the 6 h istidine coding

and FMGLN262 are complementary to nucleotides +771
to +796. In these primers, a Gln codon (shown in bold),
instead of the Glu codon, was incorporated. For
Gas1E161Q-H, 20 cycles of a 45 s me lting step at 94 °C, a
1 m in annealing step at 50 °C and a 2.5 min extension step
at 72 °C were performed using t he Pfu Turbo DNA
polymerase (Stratagene). For Gas1E262Q-H, the tempera-
ture of the annealing step was 62 °C with p rimers XHup
and RMGLN262, and 57 °C with p rimers FMGLN262
and His-XHdown. The mutations of interest are located in
the region of overlap between the amplified fragments. The
pairing of overlapping fragments was u sed for a second
PCR step, using the forward primer XHup and the reverse
primer His-XHdown, to amplify the full-length mutated
sequence of GAS1. Twenty-five cycles o f a 45 s melting step
at 94 °C,a1 minannealingstepat50 °C for Gas1E161Q-H
and 5 3 °C for Gas1E262Q-H, and a 2 min extension step at
72 °C were performed and the Taq DNA polymerase was
used. The corresponding P. pastoris expression plasmids
derived from pHIL-S1 were named pE161Q and pE262Q.
Mutagenesis of C74, C103 and C265
The m utant GPI-anchored forms – Gas1-C74S, Gas1-
C103S and Gas1-C265S – were constructed by PCR-based
mutagenesis. For Gas1-C74S, two fragments of GAS1 were
amplified using two sets of primers: the primer pair OligoUP
(5¢-TACCATTTATCGATTACTGGCATACAATGGT-
3¢), complementary to nucleotides )830 to )800, and Oligo1
(5¢-TCTG
GAGCTCgaCTCATAATTGGCCAAAGG-3¢),
partially complementary to nucleotides +199 to +228; and

YCplac33 ARS-CEN shuttle vector and the resulting
plasmids were used to transform the WB2d ( gas1::LEU2)
strain. As a control, the same strain was transformed with
the wild-type GAS1 gene cloned in the same single copy
vector.
Transformation of
P. pastoris
and expression
of recombinant Gas1 proteins
Plasmids, linearized with BglII, were transformed into
P. pastoris cells using the ÔEasyCompÕ chemical transfor-
mation method (Invitrogen). His
+
Mut
s
mutants were
obtained by selecting His
+
transformants that grew well
on minimal dextrose, but poorly on minimal methanol
plates. To i nduce the expression of recombinant proteins,
the positive clones were cultured at 30 °C overnight in
10 mL of glycerol-complex medium with strong agitation
and the cells were spun down and resuspended in 20 mL of
methanol-complex medium to an attenuance o f 1.0 at
600 n m. Fresh m ethanol was added daily to 0.5% (v/v). The
culture medium was collected 48 h afte r the induction,
centrifuged and culture supernatants were quickly frozen
andstoredat)20 °C prior to purification.
Purification of His-tagged Gas1 proteins

fractions, corresponding to the major peaks, were collected.
Protein concentration was determined by using the dye
reagent protein assay (Bio-Rad).
Endo-b-
N
-acetylglucosaminidase H treatment
Endo-b-N-acetylglucosaminidase H (Endo H) treatment
was performed on culture supernatant or on purified
proteins. For the treatment of culture supernatant, 80 lL
of a deglycosylation buffer [300 m
M
sodium citrate, pH 5.5,
0.5% (w/v) SDS, 2% (v/v) 2-mercaptoethanol] was a dded to
80 lL of culture supernatant and boiled for 2 min. After
repartition into two equal volumes, one aliquot was added to
100 mU of Endo H (Roche) and the other was used as a
control. After 18 h of incubation at 37 °C, an equal volume
of 2· Laemmli buffer was added and the samples were boiled
for 2 min prior to electrophoresis. For the treatment of
purified proteins, 2 lg of protein in 50 m
M
sodium acetate,
pH 5.5, was used. Samples were divided into two aliquots:
one was used as a control and the other was treated with 2 lL
of Endo H (10 mU). For treatment of the denatured protein,
Ó FEBS 2004 Production and characterization of Gas1p (Eur. J. Biochem. 271) 3637
SDS and 2-mercaptoethanol were added to final concentra-
tions of 0.02% (w/v) and 0.1
M
, resp ectively, prior to division

N-ethylmaleimide a fter cooling.
After electrophoresis, proteins were either stained with
Coomassie Blue R-250 or using a silver nitrate kit (Amer-
sham Pharmacia Biotech, Bucks., UK). For detection b y
Western blotting, proteins were transferred to nitrocellulose
membranes and processed as described previously [13].
Rabbit anti-Gas1p immunoglobulin, diluted 1 : 3000, was
used to detect Gas1p. A monoclonal anti-(polyHistidine)
immunoglobulin, diluted 1 : 3000 (Sigma), was used to
detect the 6 · His tag. Horseradish peroxidase-conjugated
anti-rabbit or anti-mouse secondary immunoglobulins were
used. Bound antibodies were revealed using the ECL
Western blotting detection reagents (Amersham Pharmacia
Biotech). To check the equivalence of protein loading,
primary antibodies were stripped and filters were treated
with anti-phosphofructokinase 1 ( Pfk1p) im munoglobulin
(kindly provided by J. J. Heinisch, Universitat H ohenheim,
Stuttgart, Germany), diluted 1 : 30 000.
Pulse–chase experiment and immunoprecipitation
A total of 2.5 · 10
8
logarithmically growing cells (equival-
ent to a value of 12 at an attenuance of 450 nm) were
resuspended in 4 mL of SC medium, incubated at 30 °Cfor
20 min, then pulse-labelled for 7 min with 350 lCi of
[
35
S]methionine. Pulse labelling was terminated upon the
addition of 40 lL of chase solution containing 0.3% (w/v)
methionine and 0.3

aprotinin, and 1 0 lgÆmL
)1
leupeptin. Cells
were broken by vortexing with glass beads (0.45 mm
diameter) for four, 1 min periods, and then lysates were
denaturated f or 5 min at 100 °C. This treatment fully
solubilized Gas1p [14]. Then, 450 lL o f RIPA-minus buffer
[10 m
M
Tris/HCl, pH 7.2, 150 m
M
NaCl, 1% (v/v) Triton
X-100, 1% (w/v) sodium deoxycholate plus protease
inhibitors], was added and, i n this way, the p ercentage of
SDS was lowered to 0.1. A fter a 15 min incubation at 4 °C,
beads and cellular debris were sedimented by a 2 min
centrifugation i n a microfuge, followed by a further
centrifugation of the surpernatant for 15 min at 4 °C. Eight
microlitres of preimmune serum was added to the cleared
supernatant, and the tubes were gently mixed for 1 h
at 4 °C. Fifty microlitres of a 30% (v/v) suspension of
Protein A–Sepharose was added and, after incubation for
1 h, immune complexes were s edimented a t low speed at
4 °C. The supernatant was transferred to a new Eppendorf
tube and 8 lL of anti-Gas1p IgG were added. Incubation
was continued overnight at 4 °C. Then, 50 lL of the Protein
A–Sepharose suspension was added, incubation co ntinued
for 1 h and, after sedimentation, the Protein A–Sepharose
immune complexes w ere w ashed fi ve tim es w ith 1 mL of
RIPA buffer [the same composition of RIPA-minus buffer

far-UV range (200–250 nm) on a Jasco J-715 spectropola-
rimeter (Japan Spectroscopic Co., Tokyo, Japan), as
described previously [15]. The protein concentration was
0.20–0.28 mgÆmL
)1
in 50 m
M
sodium acetate buffer,
pH 5.5. Mean residue mass ellipticity was calculated based
on 10 7.98 as the average molecula r mass per residue,
obtained from the amino acid composition, and expressed
in terms of [h]
MWR
(degree · cm
2
· dmol
)1
). Thermal
unfolding of sGas1
523
-H was monitored b y recording the
ellipticity at 220 nm while heating from 20 °Cto80°Cand
cooling again at 1 °CÆmin
)1
using a computer-controlled
circulation waterbath. Fluorescence emission spectra were
obtained on an S LM Aminco 8000 s pectrofluorimeter at
3638 C. Carotti et al.(Eur. J. Biochem. 271) Ó FEBS 2004
25 °C and in 0.2-cm optical path-cells, using 4 nm s lits for
both e xcitation a nd emi ssion beams. The sample concen-

with DTNB. To analyze disulphide thiols, freshly prepared
100 m
M
1,4-dithioerythritol solution was a dded to the
denaturated sample and the reduction was carried out for
2 h at 25 °C. Excess dithioerythritol w as removed by gel
filtration on PD10 before incubation with DTNB.
Results and discussion
Production of recombinant soluble forms of Gas1p
in
P. pastoris
Gas1 is a plasma membrane GPI-anchored glycoprotein of
% 125–130 kDa. It contains a large N-terminal catalytic
domain of abou t 310 residues (D23–P332), known a s the
b-( 1,3)-glucan transferase dom ain (GluTD), a cystine-rich
region containing a motif of eight cysteines (C370–C462)
and a serine-rich region in which 28 serines are clustered in a
region between residues S485 and S525 (Fig. 1A). The
serine-rich region is a target for O-glycosylation and is
dispensable for activity [2,13]. A secretory signal peptide
(M1–A22) and a signal sequence for GPI attachment are
present at the N- and C-terminal ends, respectively. In order
to undertake a biochemical characterization of Gas1p, we
attempted to express it in P. pastoris. DNA sequences,
encoding different soluble forms of Gas1p, were subcloned
in the pHIL-S1 expression vector in-frame with the DNA
sequence e ncoding the P. pastoris Pho1p s ignal sequence.
The expression of the proteins was driven by the methanol-
inducible AOX1 promoter. Constructs encoding forms of
Gas1p lacking the GPI-attachment signal (sGas1

(sGas1
482
), which was produced at levels equivalent to
sGas1
523
(Fig. 2 A, lanes 7–9). The presence of the His-tag
(sGas1-H) did not appreciably modify the expression level
of sGas1
523
and sGas1
482
, suggesting no deleterious effects
of the additional amino acids on Gas1p expression and
secretion ( Fig. 2A, lanes 10–12 and 13–15). Where the tag
was p resent the proteins were also recognized by a PolyHis
monoclonal antibody ( data not shown). T he difference in
molecular mass between sGas1
523
and sGas1
482
is % 20 kDa
and exceeds the 4 kDa predicted by the length of the
segment removed. This i s consistent with previous evidence
that the serine-rich region is a highly O-glycosylated
segment in the Gas1 protein [13].
The glycosylation profile of the proteins was examined.
Aliquots of medium containing the recombinant proteins
were treated with Endo H and analysed by Western blotting
using anti-Gas1p immunoglobulin (Fig. 2C). The apparent
molecular mass of both sGas1

of sGas1
523
-H was monophasic, with a melting point at
56.5 °C, and also h ighly cooperative (Fig. 3B). As shown in
the CD spectrum of Fig. 3A, the structural changes upon
heating to 80 °C resulted in a decrease of regular secondary
structure content ( 8% a-helix and 17% b-sheet). Interest-
ingly, these structural changes were totally reversible
because sGas1
523
-H recovered the initial structure at
20 °C after c ooling from 80 °C (Fig. 3A). Figure 3C shows
the fluorescence emission spectrum obtained for sGas1
523
-H
(spectrum 1). The emission of the protein was dominated by
the tryptophan contribution (spectrum 2, excitation at
295 n m) with a maximum at 320 nm and a shoulder at
332 nm. The intrinsic tryptophan fluorescence of a protein
is a sensitive indicator of the local environment of its
tryptophan residues. The mature G as1 protein contains five
tryptophan residues. The fact that the tryptophan emission
in sGas1
523
-H was s hifted to a lower wavelength than
expected for solvent-exposed tryptop hans strongly suggests
that these residues a re located in a hydrophobic environ-
ment in the protein. The low tyrosine contribution,
Fig. 2. Analysis of cultu re su pernata nts from Pichia pastoris-trans-
formed cells. (A) Coomassie Blue staining of 100 lLofculture

a-he lices and b-sheets, and that the latter ones predominate.
Quantification of disulphides and free sulphydryl groups
present in Gas1p
Proteins of Family GH72 are rich in cysteines but no
determination of disulfide bonds has yet been reported. The
yeast Gas1 protein contains 14 cysteines. We used DTNB
to quantify t he number of disulphides plus free sulphydryl
groups in Gas1p. The recombinant protein lacking the
O-glycosylated region, which is dispensable for activity and
is devoid of cysteines, was analysed. As shown in Table 1,
sGas1
482
-H contai ns four thiols – one of which is readily
accessible to the reagent in native conditions – and five
disulphide bridges. The same results were obtained after
treatment with Endo H (Table 1), which completely
removes the N-linked c hains (data not shown). This
indicates that accessibility to t he reagent is not influenced
by the N-linked chains. Equivalent results w ere obtained for
sGas1
523
-H.
In order t o determine whether the disulphide bridges were
intra- or intermolecular, the electrophoretic mobility of
Gas1p was analysed under reducing and nonreducing
conditions. When s amples are d enaturated in th e absence
of a reducing agent a decrease in electrophoretic mo bility of
the nonreduced sample, with respect to the corresponding
reduced sample, in dicates the presen ce of interchain disul-
phide bridges, whereas an increase in mobility is related to

putative catalytic residues located at the end of strands b-4
and b-7. This fold has also been predicted for Gel1p [19,20].
Fig. 3. Spectroscopical characterization of Gas1p. (A) Far-UV (200–250 nm) CD spectra of purified sGas1
523
-H at 20 °C(j), aft er heating at 80 °C
(d) and cooling again at 20 °C(s). [h]
MRW
, mean residue mass ellipticity. (B) Thermal unfolding of sGas1
523
-H in 50 m
M
sodium acetate buffer,
pH 5.5; changes in ellipticity at 220 nm were continuously monitored upon heating from 20 °Cto80°C. (C) Fluorescence emission spectra of
sGas1
523
-H. Spectrum 1 was obtained for excitation at 275 nm. Spectrum 2 ( tryptophan contribution) was obtained for excitation at 295 nm and
normalized at wavelengths above 380 nm. Spectrum 3 (tyrosine c ontribution ) was calculated as the difference spectrum (spectrum 1 minus spectrum
2). Fluorescence is expressed in arbitrary units. All the spectra were recorded at 25 °C and pH 5.5.
Table 1. Quantification o f disulphides and suphydryl groups in Gas1p.
The number of DTNB molecules per protein molecule as a mean of
three different determinations (SD < 10%) are shown in parenthe sis.
Endo H, endo-b-N-acetylglucosamin idase H.
Protein and condition Number of cysteines
sGas1
482
-H
Native conditions 1 (0.72)
After denaturation 4 (4.30)
After denaturation and reduction 14 (13.6)
Endo H-treated sGas1

proteins (data not shown). Analysis of the b(1,3)-glucano-
syltransferase activity is shown i n F ig. 6. Using G
13
laminarioligosaccharide as a substrate, sGas1
523
-H pro-
duced smaller and larger oligosaccharides (Fig. 6A) that
corresponded to t he released and t ransferred products, a s
previously characterized [4], and confirmed the following
two-step enzyme activity:
E þ G
13
! E-G
x
þ G
13Àx
ð1Þ
E-G
x
þ G
13
! E þ G
13þx
ð2Þ
In contrast, with sGas1E161Q-H a nd sGas1E262Q-H, no
transferase activity was observed, indicating that both
glutamic acid residues are essential for th e two-step activity
(Fig. 6 B,C). I n a ddition, the sGas1
482
-H protein was

3642 C. Carotti et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Gas1 protein was as active as the fully glycosylated form,
indicating that N-linked chains are not required for activity
(data not shown).
Essential role of C74 in the folding and stability
of the GPI-anchored Gas1p
To gain insight into the putative role played by the cysteine
residues in t he original GPI-anchored form of Gas1p, we
performed experiments based on site-dire cted mutagenesis.
We chose C74, the most N-terminal cysteine, the one next to
it (C103), and C265, which is c lose to the E262 catalytic
residue in the primary sequence. Each cysteine residue was
replaced with a serine. A gas1D mutant strain of S. cere-
visiae was transformed with a centromeric plasmid har-
bouring the wild-type GAS1 gene or the mutant constructs
(C74S, C103S and C265S, Fig. 1C). We reasoned that if
folded properly and localized correctly, the mutant proteins
should be able to fully complement the in vivo defects typical
of the mutant lacking Gas1p [21]. Upon microscopic
analysis, Gas1-C74S-expressing cells displayed the typical
gas1D abnormal morphology, whereas gas1D ce lls
expressing the mutant p roteins (Gas1-C103S or Gas1-
C265S) showed partial r eversal of the morphological
defects, and cells expressing the wild-type GAS1 exhibited
the normal morphology ( data not shown). Consistently with
these observations, the Gas1-C74S protein did not comple-
ment th e slow growth phenotype of gas1D cells, the
duplication time (T
d
)inSCmediumat30°Cbeing3.5h

35
S]methionine and c hased fo r the indicated times before being
processed for immunoprecipitation w ith anti-Gas1p IgG .
Ó FEBS 2004 Production and characterization of Gas1p (Eur. J. Biochem. 271) 3643
transformed with t he empty v ector. Control gas1 cells
carrying the wild-type GAS1 gene showed a T
d
of 1.8 h. The
T
d
of cells expressing Gas1-C103S or Gas1-265S was 2.6 h,
indicating a partial complementation of the slow-growth
phenotype.
The total inability of Gas1-C74S and the partial ability
Gas1-C103S or GasC265-S proteins to rescue the gas1
phenotype could be primarily a result of alterations in
expression or folding of the mutant proteins. T o exclude
effects at t he mR NA level, a Northern blot analysis was
performed. Cells containing either the wild-type GAS1 gene
or the mutated alleles had comparable levels o f GAS 1
mRNA (data not shown). Therefore, the mutations do not
affect transcript accumulation.
The endoplasmic reticulum (ER) is the folding compart-
ment for proteins, such as Gas1p, destined for the plasma
membrane. F ailure to acquire a proper native conformation
leads to recognition b y the quality control machinery in the
ER, provoking retention and eventually degradation
[22,23]. Total protein from gas1D-transformed cells was
analysed by immunoblotting using anti-Gas1p immuno-
globulin. As shown in F ig. 7A, mature Gas1p (130 kDa)

decreased for 60 min when the immature form was almost
undetectable. This i ndicates that the G PI-anchored Gas1-
C74S is synthesized at the l evel of ER, but is not further
processed and undergoes degradation.
Conclusions
Proteins of Family GH72 play an active role in yeast and
fungal morphogenesis but, to date, no detailed biochemical
characterization has been reported. Previously, Gas1p has
proven to b e useful for studies on protein transport along
the secretory pathway in yeast. In this w ork, Gas1p w as
used as a model protein to undertake a first bioch emical
characterization of an enzyme of Family GH72. Here we
have shown that P. pastoris is a suitable host for the high-
level expression and secretion of Gas1p. The protein yield
was estimated to be about 100 times higher than for an
equivalent construct expressed in S. cerevisiae under the
control of the natural GAS1 promoter in a multicopy vector
(L. Popolo & M. Vai, unpu blished data). The purified
His-tagged sGas1 is active and could be used for future
structural characterization o f the protein. Our results
suggest that the high-level expression of secreted forms of
proteins in P. pa storis could constitute a valuable tool in the
study of fungal and p lant GPI proteins involved in c ell wall
biogenesis.
Multiple sequence alignment performed on t he 40
members o f F amily GH72 suggested t hat glutamates 161
and 262 in Gas1p could play the role of catalytic residues.
These predictions have been supported experimentally
because the replacement of these residues with glutamine
abolished the activity of Gas1p, whereas no significant

for non-native disulphide bond formation during folding
pathway, as has been suggested to occur for some
mammalian multidomain proteins [28], or for the sequential
and independent fold ing of the single domains – assuming
a vectorial mode of folding for Gas1p. In any case, the
replacement of C74 with a serine c ould e ntrap the protein in
a folding intermediate that is no longer processed and is
degraded. F rand & Kaiser reported that the ER form of
Gas1p accumulates in cells treated with dithiothreitol or in
cells defective in Ero1p, and is stable [25]. Our finding, that
the Gas1-C74S protein is unstable, is not necessarily in
contrast with their results. In the presence of the reducing
3644 C. Carotti et al.(Eur. J. Biochem. 271) Ó FEBS 2004
agent, or in an ero1 mutant, all disulphide bonds are
affected and probably present in a reduced state. Moreover,
both conditions are rather harsh and could a lso affect the
degradation pathway.
Given this prominent role of C74 in directing the folding
of Gas1p, it is premature to assess whether it is involved in
the formation of a structurally important disulphide bond,
and more direct analysis, such as mapping of disulphide
bridges, will be necessary to address t his point.
Acknowledgements
We wish to thank Michel Monod and Maria Antonietta Van oni for
plasmids and helpful suggestions, Carmela Gissi for the multiple
alignment, Prof. Gavilanes for helpful comments on spectral analysis,
Serena Crotti for technical assistance, David Horner for English
revision and Antonio Grippo for preparing the figures. This work was
partially supported by EU proje ct No. QLK3-CT-20009-01537
ÔEUROCE LLWALLÕ to L.P., and FIR ST 2001 and 20 02 grant to

9. Vai,M.,Gatti,E.,Lacana,E.,Popolo,L.&Alberghina,L.(1991)
Isolation and deduced amino acid sequence of the gene encoding
gp115, a yeast glycophosph olipid-anchored pro tein containing a
serine-rich region. J. Biol. Chem. 266, 12242–12248.
10. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K. & Pease, L.R.
(1989) E ngineer ing hybrid g enes without t he use o f restriction
enzymes: gene splicing by overlap extension. Gene 77, 61–68.
11. Valdivieso, M.H., Ferrario, L., Vai, M., Duran, A. & Popolo, L.
(2000) Chitin synthesis in a gas1 mutant of Saccharomyces cere-
visiae. J. Bacteriol. 182, 4752–4757.
12. Braakman, I., Hoover-Litty, H., Wagner, K.R. & Helenius, A.
(1991) Folding of influenza hemagglutinin in the endoplasmic
reticulum. J. Cell. Biol. 114, 401–411.
13. Gatti, E ., Popolo, L., Vai, M., Rota, N. & Alberghina, L. (1994)
O-linked oligosaccharides in yeast glycosyl phosphatidylinositol-
anchored protein g p115 are clustered in a serine-rich region not
essential for its function. J. Biol. Chem. 269, 19695–19700.
14. Watanabe, R., Funato, K., Venkataraman, K., Futerman, A.H. &
Riezman, H. (2002) Sphingolipids are required for the stable
membrane association of g lycosylphosphatidylinositol-anchored
proteins in yeast. J. Biol. Chem. 277, 49538–49544.
15. Batanero, E., Villalba, M., Ledesma, A., Puente, X.S. & Rodriguez,
R. (1996) Ole e 3, an olive-tree allergen, belongs to a widespread
family of pollen proteins. Eur. J. Biochem. 241 , 772–778.
16. Tedeschi, G., Oungre, E., Mortarino, M., Negri, A., Maffeo, G. &
Ronchi, S. (2000) Purific atio n and primary structure of a n ew
bovine spermadhesin . Eur. J. Biochem. 26 7, 6175–6179.
17. Trimble, R.B., Atkinson, P.H., Tsc hopp, J.F., Townsend, R.R. &
Maley, F. (1991) Structure of oligosaccharides on Saccharomyces
SUC2 invertase secreted by the methylotrophic yeast Pichia pas-

required for Gas1p transport from the endoplasmic reticulum in
COP II vesicles. EMBO J. 15, 182–191.
27. Fonzi, W.A. (1999) PHR1 and PHR2 o f Candida albicans encode
putative glycosidases required for proper cross-linking of b eta-
1,3- and beta-1,6-glucans. J. Bacteriol. 181, 7070–7079.
28. Jansens, A., van Duijn, E. & Braakman, I. (2002) Coordinated
nonvectorial folding in a newly synthesized multidomain protein.
Science 298, 2401–2403.
Supplementary material
The following material is available from http://www.
blackwellpublishing.com/products/journals/suppmat/EJB/
EJB4297/EJB4297sm.htm
Fig. S1. Multiple sequence alignment among the catalytic
domains of Family GH 72 members.
Ó FEBS 2004 Production and characterization of Gas1p (Eur. J. Biochem. 271) 3645


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status