Sequences and structural organization of phospholipase A
2
genes from
Vipera aspis aspis
,
V. aspis zinnikeri
and
Vipera berus berus
venom
Identification of the origin of a new viper population based on ammodytin I1
heterogeneity
Isabelle Guillemin*, Christiane Bouchier†, Thomas Garrigues‡, Anne Wisner§ and Vale
´
rie Choumet*
Unite
´
des Venins, Institut Pasteur, Paris, France
We used a PCR-based method to determine the genomic
DNA sequences encoding phospholipases A
2
(PLA2s) from
the venoms of Vipera aspis aspis (V. a. aspis), Vipera aspis
zinnikeri (V. a. zinnikeri), Vipera berus berus (V. b. berus)
and a neurotoxic V. a. aspis snake (neurotoxic V. a. aspis)
from a population responsible for unusual neurotoxic
envenomations in south-east France. We sequenced five
groups of genes, each corresponding to a different PLA2.
The genes encoding the A and B chains of vaspin from the
neurotoxic V. a. aspis,PLA2-IfromV. a. zinnikeri,andthe
anticoagulant PLA2 from V. b. berus are described here.
Single nucleotide differences leading to amino-acid substi-

(PLA2s) are major components of snake
venoms. They catalyze the Ca
2+
-dependent hydrolysis of
the 2-acyl ester bond of 1,2-diacyl-3-sn-phosphoglycerides
releasing fatty acids and lysophospholipids. These enzymes
can be separated into 11 groups. Those belonging to group
II have six to eight disulfide bonds and a C-terminal
extension not present in group I venom PLA2s [1]. They
are found in the venoms of Crotalinae and Viperinae
snakes and in human platelets, liver and spleen [2,3]. Snake
venoms contain a large number of PLA2 isoenzymes
which differ in neurotoxicity, myotoxicity, cardiotoxicity,
anticoagulation and edema-inducing properties [2].
To date, the structures of only six Viperinae PLA2 genes
have been studied: ammodytin I1 (DDBJ/EMBL/GenBank
accession no. AF253048), ammodytin I2 (DDBJ/EMBL/
GenBank accession no. X84018), ammodytoxin C (DDBJ/
EMBL/GenBank accession no. X76731) and ammodytin L
(DDBJ/EMBL/GenBank accession no. X84017) from
Vipera ammodytes ammodytes (V. am. ammodytes)andtwo
genes encoding an acidic inhibitor (VP7) (DDBJ/EMBL/
GenBank AC AF373342) and a basic PLA2 protein (VP8)
(DDBJ/EMBL/GenBank AC AF373342) from Vipera
palaestinae venom [4–6]. All these genes are composed of
five exons and four introns, like genes encoding human
Correspondence to V. Choumet, Unite
´
de Biochimie et de Biologie
Mole

Note: The nucleotide sequences reported in this paper have been
deposited in the DDBJ/EMBL/GenBank nucleotide sequence data-
bases under accession numbers AY158634, AY158635, AY158636,
AY158637, AY158638, AY158639, AF548351, AY152843,
AY159807, AY159808, AY159809, AY159810, AY159811,
AY243574, AY243575, AY243576, AY243577.
(Received 2 December 2002, revised 4 April 2003,
accepted 22 April 2003)
Eur. J. Biochem. 270, 2697–2706 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03629.x
group II PLA2s. In contrast, PLA2 genes from Crotalinae
snakes such as Trimeresurus flavoviridis, Trimeresurus
gramineus, Trimeresurus (Ovophis) okinavensis and Crotalus
scutulatus scutulatus are organized into four exons and three
introns, like group I PLA2s [7–10]. Despite this difference,
nucleotide sequence analyses have shown that, unusually,
introns are more conserved than exons in both Viperinae
and Crotalinae. Moreover, mutations leading to amino-acid
changes are common in the protein-coding regions (but not
in the signal peptide exon), but are limited to the third exon
in V. palaestinae [6,11]. Thus, the genes encoding the group
II PLA2 of snake venoms evolved by gene duplication,
followed by divergence from a common ancestral gene by
accelerated Darwinian selection, probably as a means of
acquiring new functions [9,11].
In this paper, we extend the study of PLA2 genes to the
French vipers Vipera aspis aspis (V. a. aspis), Vipera aspis
zinnikeri (V. a. zinnikeri), and Vipera berus berus (V. b.
berus). We were prompted to carry out this study by the
recent identification of a distinct, unusually neurotoxic
population of V. a. aspis in the south-east of France [12].

V. a. aspis and V. b. berus in the Puy-de-Doˆ me, V. a.
zinnikeri in the Gironde, and neurotoxic V. a. aspis in the
Alpes-Maritimes. The V. a. aspis snake captured in the
Alpes-Maritimes was responsible for one case of neurotoxic
envenomation [12]. We studied one individual per snake
species. Genomic DNA was extracted from snake livers as
previously described [14].
DNA was amplified with a set of primers (Genset Oligos,
Paris, France) targeting conserved regions of the PLA2
genes for which sequences were available in databases. The
primer-binding sites were located upstream from the
5¢-UTR (PLA5G) and downstream from the 3¢-UTR
(PLA3G). Amplification reactions were carried out in a
final volume of 50 lL containing 2.5 lLPLA5Gand
2.5 lLPLA3G(10l
M
each), 1 lLdNTPs(dATP,dCTP,
dTTP and dGTP, 10 m
M
each), 5 lL Taq buffer supplied
with the enzyme, 0.25–0.5 lg genomic DNA and 1.5 U
rTaq polymerase (Amersham Biosciences, Orsay, France).
The DNA was denatured by heating at 95 °Cfor7min.It
was then subjected to 30 amplification cycles as follows:
denaturation at 95 °C for 1 min and annealing coupled with
extension at 69 °C for 6 min. A final extension step was
carried out, at 72 °C for 10 min. The reaction product was
analyzed by agarose gel electrophoresis in 1 · Tris/borate
buffer.
DNA fragments of the expected size (2.1 kb) were

ponding genomic DNA fragments from each snake with
primers (Table 1) specific for the PLA2s previously charac-
terized in Vipera venoms. We also designed primers specific
for the Bov-B LINE retroposon, a phylogenetic marker
previously identified in some PLA2 genes of Viperidae
snakes including V. am. ammodytes [4,5].
Five groups of snake venom PLA2 genes were sequenced.
Nucleotide polymorphism was identified in each group.
Two groups of genes were most similar, in terms of
nucleotide sequences, to cDNAs encoding chains A and B
of vaspin (DDBJ/EMBL/GenBank accession no.s
AJ459806 and AJ459807, respectively) [13], chains A and
B of vipoxin (Gi numbers: 16974941 and 16974940) from
V. am. meridionalis [16] and the two subunits of PLA2-I (Gi
numbers: 1709547 and 1709548) from V. a. zinnikeri [17].
They also showed a high level of nucleotide identity with
cDNAs encoding the presynaptic neurotoxic complex RV4/
RV7 from Daboia russelli formosensis (DDBJ/EMBL/
2698 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
GenBank accession no.s X68385 and X68386, respectively
[18]). Two other groups were most similar, in terms of
nucleotide sequence, to the ammodytin I1 (DDBJ/EMBL/
GenBank accession no. AF253048) and ammodytin I2
(DDBJ/EMBL/GenBank accession no. X84017) genes
from V. am. ammodytes, respectively [19]. The last group
of genes was most similar to the V. b. berus PLA2 protein
(Gi number: 423975) [20]. A list of all the venom PLA2
genes identified in each captured snake is presented in
Table 2. Unexpectedly, genes encoding the A and B chains
of vaspin, a heterodimeric neurotoxin, were identified in

PLA5G1 (F) AGGAYTCTCTGGATAGTGG
PLA3G1 (R) CTCACCACAGACGATWTCC
PLA5G2 (F) CGGTAAGCCCATAACGCCCA
PLA3G2 (R) CAGGCCAGGATTTGCAGCC
PLA3G4 (R) CATAAACAYGAGCCAGTTGCC
ARTF
a
(F) GAGTGGATGCACAGTCGTTG
ARTR
a
(R) GAAACGGAGGTAGTGACACAT
AtxBF
b
(F) GCCTGCTCGAATTCGGGATG
AtxBrc
b
(R) CTCCTTCTTGCACAAAAAGTG
AtxACF
c
(F) CTGCTCGAATTCGGGATG
AtxACrc
c
(R) GTCYGGGTAATTCCTATATA
AmlF
d
(F) GTGATCGAATTTGGGAAGATGATCCA
Amlrc
d
(R) CCCTTGCATTTAAACCTCAGGTACAC
a

+
c
259
V. am. ammodytes + (In) + – – – 259
Snake species Ammodytin I1 protein sequence
b
AtxA AtxB AtxC AmL Retroposon
V. a. aspis L70, S71, E78, L12 – – – – –
V. a. zinnikeri L70, S71, E78, L12 – – – – –
Neurotoxic V. a. aspis +
c
+
c
+
c
–+
c
(AtxC)
1st group of clones L70, S71, E78, L123
2nd group of clones M70, G71, Q78, F123
V. b. berus T3 (peptide signal) – – – +
c
+
c
(AmL)
N1 K56
V. am. ammodytes M70, G71, Q78, F123 + + + + + (AtxC, AmL)
a
AmI, ammodytin I1; AmI2, ammodytin I2; VaspA, vaspin chain A; VaspB, vaspin chain B; AtxA, ammodytoxin A; AtxB, ammodytoxin
B; AtxC, ammodytoxin C; AmL: ammodytin L;

PLA2 genes of Crotalinae snakes (Trimeresurus flavoviridis)
were also of similar length [4–6,8]. Interestingly, a 476 bp
insertion was observed in the 3¢-UTR of the ammodytin I2
gene from V. b. berus. This fragment was similar to a region
located upstream from the TATA-box-binding protein gene
of T. gramineus and T. flavoviridis [22], suggesting a
probable common ancestry of V. b. berus and Trimeresurus
species.
ThelengthofintronDintheammodytinI1gene
depended on the species. It was 133 bp long in V. a.
zinnikeri and V. a. aspis whereas it was 259 bp long
in V. b. berus and V. am. ammodytes (DDBJ/EMBL/
GenBank accession no. AF253048). Interestingly, introns
of both lengths were found in the genome of the neurotoxic
V. a. aspis, with six of the 10 sequenced clones having the
126 bp deletion as in V. a. aspis, V. a. zinnikeri,andthe
remaining four clones having an intron D similar to that of
the V. am. ammodytes ammodytin I1 gene.
All PLA2 genes contained a TAA stop codon, an
AATAAA polyadenylation site 80 bp downstream from
the stop codon, and a TATA-like box (CATAAAA) 270 bp
upstream from the ATG translation initiation codon, as
found in other Viperinae and Crotalinae genes [2,22].
Table 3. Structural organization of V. a. aspis, V. a. zinnikeri, V. b. berus and neurotoxic V. a. aspis PLA2 genes.
PLA2 gene
(no. of clones)
a
Exon
Exon length
(bp) Intron

(52) 2 56 B 243 GGGCGgtgag/tccagTTGAA
3 133 C 671 GACCGgtaag/tccagCTGCT
4 101 D 261 CTGTGgtgag/tgcagGAAAC
5(3¢-UTR) 140 (110)
a
Clones harboring complete sequences of PLA2s are presented.
Fig. 1. Alignment of some of the variant genes encoding chain B of
vaspin from V. a. aspis (neurotoxic) and V. a. zinnikeri. Two vaspin
chain B gene variants are shown for V. a. zinnikeri (vp0016B10VAZ
and vp0016C06VAZ, DDBJ/EMBL/GenBank accession no.s
AY243574 and AY243577, respectively) and V. a. aspis
(vp0015F11VAN and vp0015C10VAN, DDBJ/EMBL/GenBank
accesion no.s AY243575 and AY243576, respectively). The nucleotides
forming the introns are shown in italics, and those constituting the
exons are underlined. Stars below the sequence indicate nucleotides
conserved in all sequences. Dashes correspond to deleted nucleotides.
Putative transcription factors are boxed.
2700 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Several putative regulatory sequences were identified
with the TRANSFAC 4.0 databases: binding sites for the
transcription factors Sp1 (CCCGCCA), NF-IL6 (TGGG
GAA), NF-jB (GGGGAAGTCCC) and AP-2 (CCCTG
CC) were identified in PLA2 genes (Figs 1 and 2) [22].
These trans-acting factors may act as stress-response
Ó FEBS 2003 Genomic analysis of phospholipases A
2
from French viper venoms (Eur. J. Biochem. 270) 2701
elements or may be responsible for tissue-specific regula-
tion [23].
Conservation of the nucleotide sequence

few amino acids and in lethal potency or enzymatic
activities, have been isolated from the venoms of individual
Crotalinae snakes [24].
We then identified a consensus nucleotide sequence for
each of the five PLA2 genes (Fig. 2). For the genes encoding
chains A and B of vaspin and PLA2 from V. b. berus,a
single consensus sequence was obtained, regardless of the
snake species. For the ammodytin I1 and I2 genes, however,
two to three consensus sequences were obtained, according
to the snake species or subspecies. Only one of the consensus
sequences for the ammodytin I1 and I2 genes is presented in
Fig. 2. In contrast with that observed in comparisons of
gene variants encoding the same PLA2 (Fig. 1), the
alignment of these consensus sequences showed that nuc-
leotide variations were more common in exons than in
introns (Fig. 2). Exons 3 and 5 were the most divergent,
whereas the signal peptide, the 5¢-UTR and 3¢-UTR and the
promoter region were the most highly conserved (Fig. 2).
The nucleotide substitutions mostly involved transitions
rather than transversions, in contrast with that observed in
conopeptide genes, thus excluding the involvement of DNA
polymerase V in genomic hypervariability [25]. These
observations are not consistent with the neutral evolution
theory, which states that the strong conservation of exons
serves to maintain the function of the mature protein [26].
The protein-coding regions of the PLA2 genes of French
vipers most probably evolved in an accelerated Darwinian
manner, as reported for the PLA2 genes expressed in
Crotalinae and V. am. ammodytes venom [2,3,5,7,8].
Deduced amino-acid sequence analysis

whereas another group (19 of 42) had one amino-acid
difference (Asn111Ser), corresponding to a mutation in
the fifth exon (Fig. 3). The sequence of the vaspin B
chain was identical in V. a. zinnikeri and the neurotoxic
V. a. aspis. However, it differed by one residue from the
sequence of the B chain of vipoxin from V. am. merid-
ionalis [19], and by three residues from the published
Fig. 2. Alignment of the consensus sequences of ammodytin I1 (AmtI1),
ammodytin I2 (AmtI2), vaspin chains A and B and V. berus PLA2 genes
isolated from French vipers. The ammodytin I1 consensus sequence was
defined from the sequences of V. a. aspis, V. a. zinnikeri,neurotoxic
V. a. aspis isoforms 1 and 2 and V. b. berus PLA2 (DDBJ/EMBL/
GenBank accession no.s AY159807, AY159810, AY159808,
AY159809 and AY159811, respectively). The ammodytin I2 consensus
sequence was defined from the sequences of V. a. aspis,neurotoxic
V. a. aspis and V. b. berus (DDBJ/EMBL/GenBank accession no.s
AY158637, AY158638 and AY158639, respectively). The vaspin chain
A consensus sequence was defined from the sequences of V. a. zin-
nikeri and neurotoxic V. a. aspis (DDBJ/EMBL/GenBank accession
no.s AY152843 and AF548351) and that of vaspin chain B, from the
sequences of V. a. zinnikeri and neurotoxic V. a. aspis (DDBJ/EMBL/
GenBank accession no.s AY158635 and AY158634). Dots indicate
identity with the ammodytin I1 sequence. Asterisks indicate nucleo-
tides conserved within PLA2s. Dashes correspond to deleted nucleo-
tides if the ammodytin I1 sequence is taken as the reference sequence.
Italics indicate DNA tandem repeats. Putative transcription factor-
binding sites are boxed.
2702 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Ó FEBS 2003 Genomic analysis of phospholipases A
2

other snakes studied. The genome of one of these neurotoxic
snakes displayed features characteristic of V. am. ammo-
dytes (monomeric ammodytins A, B and C, and ammodytin
I1n with a 259 bp intron D, the Bov-B LINE retroposon)
and of V. a. aspis (vaspin A and B chains and ammodytin
I1a with a 133 bp intron D; Table 2). This suggests possible
interbreeding between these two species, leading to a hybrid
V. a. aspis with a higher level of polymorphism in venom
PLA2 genes in this snake (Table 2). The identification of
natural hybrids between V. a. aspis and V. am. ammodytes
in Italy is consistent with the hypothesis of horizontal
transfer [28]. Moreover, immunological analysis of albumin
proteins also suggests that V. aspis and V. ammodytes are
closely related species [29]. The unusually strong conserva-
tion of introns in PLA2 genes may facilitate homologous
recombination events between PLA2 genes from different
species.
Amino-acid substitutions: implications for PLA2
structure and/or function
The amino-acid substitutions due to the variant PLA2 genes
are indicated below the protein sequence alignment in
Fig. 3. Frameshifts were observed in exons 4 and 5 of the
ammodytin I1 gene, and in exon 3 of the ammodytin I2 gene
Fig. 3. Alignment of V. a. aspis, V. a. zinnike ri, V. b. berus and neurotoxic V. a. aspis PLA2 protein sequences. Dots indicate amino acid residues
identical with those of the ammodytin I2 protein. Dashes indicate gaps introduced to optimize the alignment, using Renetseder’s numbering system
[39]. AmI2 (blue) corresponds to ammodytin I2, VaspB (red) corresponds to the vaspin chain B protein and VaspA (green) corresponds to vaspin
chain A. AmI1n corresponds to ammodytin from the neurotoxic V. a. aspis. AmI1a corresponds to the ammodytin I1 of V. a. aspis, V. a. zinnikeri
and the neurotoxic V. a. aspis. AmI1b corresponds to ammodytin I1 from V. b. berus. VB (black) corresponds to V. b. berus PLA2. The cysteine
residues involved in disulfide bridges are indicated in yellow. . indicates residue Asp49. Amino acid substitutions resulting from nucleotide
polymorphisms are indicated below the alignment, in the color used for the PLA2.

Six of these residues were substituted (Fig. 3), probably
decreasing the stability of the molecule by preventing the
formation of disulfide bonds.
Toxicity and heterocomplex formation
Little is known about the toxicity of ammodytin I1. Komori
et al. [32] purified three PLA2s from V. aspis venom
(PLA2-I, PLA2-II and PLA2-III) and determined their
biological activities. The N-terminal sequence of PLA2-III
is identical with that deduced here from the nucleotide
sequence of ammodytin I1. Thus, if PLA2-III corresponds
to ammodytin I1, it is not lethal. Ammodytin I2 is a
nontoxic PLA2 [33]. Vaspin is a neurotoxin [13,17] and the
PLA2 of V. b. berus has potent anticoagulant activity [20].
Mutations leading to amino-acid substitutions were most
common in exon 4. They were clustered in an exposed
region defined as the b-wing and in a short segment defined
as the anticoagulant region [34]. Such mutations were also
found in exons 3 and 5, specifically in the first 16 residues of
exon 3 and at the 3¢ extremity of exon 5 (Fig. 3). It has been
suggested that the b-wing region and the region between
amino acids 106 and 128 in exon 5 are involved in PLA2
toxicity [30,35,36]. If this is indeed the case, then substitu-
tions occurring in these areas may affect the neurotoxicity or
anticoagulant effect of the PLA2.
The substitutions in the A and B chains of vaspin, in the
inhibitor and PLA2 subunits, respectively, should be
considered together, as these proteins associate in a het-
erodimeric complex to exert their neurotoxic effects. The
formation of this complex involves intermolecular inter-
actions [17,37,38]. The inhibitor subunit stabilizes the

genome, leads us to conclude that the new population of
neurotoxic V. a. aspis is of ÔhybridÕ origin. Phylogenetic
and evolutionary analyses are underway to confirm this
hypothesis.
Acknowledgements
I. G. holds a postdoctoral fellowship from the Direction des
Programmes Transversaux de Recherche (PTR) of the Pasteur Institute.
This work was funded by the Direction des PTR of the Pasteur Institute.
We also thank Stephane Ferris and Eliana Ochoa from the genomics
platform Genopole-IP for technical assistance. We are grateful to
Y. Doljanski, O. Grosselet and A. Teynie
´
for capturing the snakes and
for carrying out the herpetological survey.
References
1. Danse, J.M., Gasparini, S. & Me
´
nez, A. (1997) Molecular biology
of snake venom phospholipases A2. In Venom Phospholipase A2
Enzymes: Structure, Function and Mechanism (Kini, R.M., ed.),
pp. 29–71. Wiley & Sons Ltd, Chichester, UK.
2. Kini, R.M. (1997) Phospholipase A2: a complex multifunctional
protein puzzle. In Venom Phospholipase A2 Enzymes: Structure,
Function and Mechanism (Kini, R.M., ed.), pp. 1–28. Wiley &
Sons, Chichester, UK.
3. Yoshikawa, T., Naruse, S., Kitagawa, M., Ishiguro, H., Naga-
hama, M., Yasuda, E., Semba, R., Tanaka, M., Nomura, K. &
Hayakawa, T. (2001) Cellular localization of group IIA phos-
pholipase A2 in rats. J. Histochem. Cytochem. 49, 777–782.
4. Kordis, D. & Gubensek, F. (1996) Ammodytoxin C gene helps to

Gene 172, 267–272.
11. Kini, R.M. & Chan, Y.M. (1999) Accelerated evolution and
molecular surface of venom phospholipase A2 enzymes. J. Mol.
Evol. 48, 125–132.
12. De Haro, L., Robbe-Vincent, A., Saliou, B., Valli, M., Bon, C. &
Choumet, V. (2002) Unusual neurotoxic envenomations by Vipera
aspis aspis snakes in France. Hum. Exp. Toxicol. 21, 137–145.
13. Jan, V., Maroun, R.C., Robbe-Vincent, A., De Haro, L. &
Choumet, V. (2002) Toxicity evolution of Vipera aspis aspis
venom: identification and molecular modeling of a novel phos-
pholipase A2 heterodimer neurotoxin. FEBS Lett. 527, 263–268.
14. Winnepenninckx, B., Backeljau, T. & De Wachter, R. (1993)
Extraction of high molecular weight DNA from molluscs. Trends
Genet. 9, 407.
15. Ewing, B., Hillier, L., Wendl, M.C. & Green, P. (1998) Base-
calling of automated sequencer traces using phred. I. Accuracy
assessment. Genome Res. 8, 175–185.
16. Perbandt, M., Wilson, J.C., Eschenburg, S., Mancheva, I., Alek-
siev, B., Genov, N., Willingmann, P., Weber, W., Singh, T.P. &
Betzel, C. (1997) Crystal structure of vipoxin at 2.0 A
˚
: an example
of regulation of a toxic function generated by molecular evolution.
FEBS Lett. 412, 573–577.
17. Komori, Y., Masuda, K., Nikai, T. & Sugihara, H. (1996) Com-
plete primary structure of the subunits of heterodimeric phos-
pholipase A2 from Vipera a. zinnikeri venom. Arch. Biochem.
Biophys. 327, 303–307.
18. Wang,Y M.,Lu,P.J.,Ho,C.L.&Tsai,I.H.(1992)Character-
ization and molecular cloning of neurotoxic phospholipase A2

25. Conticello, S.G., Gilad, Y., Avidan, N., Ben-Asher, E., Levy, Z. &
Fainzilber, M. (2001) Mechanisms for evolving hypervariability:
the case of conopeptides. Mol. Biol. Evol. 18, 120–131.
26. Kimura, M. (1983) The Neutral Theory of Molecular Evolution.
Cambridge University Press, Cambridge, UK.
27. Pan,H.,Liu,X L.,Ou-Yang,L L.,Yang,G Z.,Zhou,Y C.,
Li, Z P. & Wu, X F. (1998) Diversity of cDNAs encoding
phospholipase A2 from Agkistrodon halys pallas venom, and its
expression in E. coli. Toxicon 36, 1155–1163.
28. Naulleau, G. (1997) La Vipe
`
re Aspis, pp. 42–43. Eveil Nature,
Angoule
`
me, France.
29. Herrmann, H.W. & Joger, U. (1997) Evolution of viperine snakes.
In Venomous Snakes: Ecology, Evolution and Snakebite (Thorpe,
R.S., Wu
¨
ster, W. & Malhotra, A., eds), pp. 43–61. The Zoological
Society of London and Clarendon Press, Oxford, UK.
30. Dupureur, C.M., Yu, B.Z., Jain, M.K., Noel, J.P., Deng, T., Li, Y.,
Byeon, I.J. & Tsai, M.D. (1992) Phospholipase A2 engineering.
Structural and functional roles of highly conserved active site re-
sidues tyrosine-52 and tyrosine-73. Biochemistry 31, 6402–6413.
31. White, S.P., Scott, D.L., Otwinowski, Z., Gelb, M.H. & Sigler,
P.B. (1990) Crystal structure of cobra-venom phospholipase A2
in a complex with a transition-state analogue. Science 250,
1560–1563.
32. Komori, Y., Nikai, T. & Sugihara, H. (1990) Comparative study