Fragile X-related protein FXR1 controls post-
transcriptional suppression of lipopolysaccharide-induced
tumour necrosis factor-a production by transforming
growth factor-b1
Tarnjit K. Khera
1
, Andrew D. Dick
1,2
and Lindsay B. Nicholson
1,2
1 Department of Cellular and Molecular Medicine, School of Medical Sciences, University of Bristol, UK
2 Department of Clinical Sciences South Bristol, Academic Unit of Ophthalmology, University of Bristol, UK
Introduction
Tumour necrosis factor-a (TNF-a) is a key mediator of
inflammation, during which it plays a crucial role in the
early phase of a host’s defence against infection [1,2]. It
is also produced during autoimmune inflammatory
diseases, where it contributes to tissue damage [3,4].
Septic shock is an extreme example of dysregulated
inflammation, in which TNF-a is expressed rapidly and
at high levels [5–8].
To limit the potentially devastating effects that can
follow the release of TNF-a, its expression is under
strict control. It is regulated at the level of transcription,
pre-mRNA processing, mRNA stability, translation,
Keywords
FXR1; macrophages; RNA-binding proteins;
TGF-b1; TNF-a
Correspondence
T. K. Khera, Department of Cellular and
Molecular Medicine, School of Medical

opposes LPS-induced stabilization of TNF-a mRNA and reduces the
amount of TNF-a protein, through induction of expression of the mRNA-
binding protein FXR1.
Abbreviations
ARE, AU-rich element; BMDMu, bone marrow-derived macrophages; CMV, cytomegalovirus; FXR1, Fragile X mental retardation-related
protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HuA, human antigen R; IL, interleukin; LPS, lipopolysaccharide; MAPK,
mitogen-activated protein kinase; Q-PCR, quantitative PCR; RFP, red fluorescent protein; siRNA, small interfering RNA; TGF-b1, transforming
growth factor-b1; TIA-1, T-cell intracellular antigen 1; TNF-a, tumour necrosis factor-a; TTP, tristetraprolin.
2754 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
and retention at the plasma membrane [9–13]. The
TNF-a mRNA 3¢-UTR contains AU-rich elements
(AREs). AREs, which are found in many cytokine,
inflammatory gene and oncogene mRNAs, are targets
for binding proteins that regulate mRNA stability [14].
Mice with targeted deletion of the TNF-a ARE show
spontaneous production of TNF-a and develop
chronic inflammatory arthritis and inflammatory bowel
disease [15]. Multiple RNA-binding proteins that inter-
act with the TNF-a ARE and regulate its expression
have been identified. These include tristetraprolin
(TTP), T-cell intracellular antigen 1 (TIA-1), TIA-1-
related protein, human antigen R (HuA), AU-rich
element binding factor 1, and Fragile X mental retar-
dation-related protein 1 (FXR1) [16–22]. FXR1 is a
homologue of the Fragile X mental retardation syn-
drome protein, and, together with Fragile X mental
retardation-related protein 2P, forms the Fragile X
mental retardation-related family of RNA-binding pro-
teins [23]. Targeted deletion of FXR1 produced a mouse
that died soon after birth, but macrophage cell lines

protein production. Furthermore, inhibition of FXR1
production can abolish the suppression of TNF-a
protein production induced by TGF-b1. FXR1 there-
fore plays an important role in the negative regulation
of TNF-a.
Results
TGF-b1 inhibits LPS-induced TNF-a protein
production by a TNF-a mRNA expression-
independent mechanism
TGF-b1 is known to destabilize the mRNA of LPS-
induced chemokines and regulate the mRNA stability
of various other genes [33]. It was reported to inhibit
TNF-a protein production without concomitant altera-
tions in the levels of mRNA, although the mechanism
was unknown [34,35].
Bone marrow-derived macrophages (BMDMu) and
RAW 264.7 cells treated with LPS (100 pg ÆmL
)1
to
1 lgÆmL
)1
) for 4 h produced TNF-a protein in a dose-
dependent fashion, maximum production being
reached at 100 ngÆmL
)1
(Fig. S 1A,B). When TGF-b1
(10 ngÆmL
)1
) [35] was added to either BMDMu or
RAW 264.7 cells treated with LPS (100 ngÆmL

T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2755
treated with LPS and TGF-b1; untreated cells acted as
controls. In unstimulated cells, no luciferase protein
expression was seen. LPS treatment induced luciferase
expression (Fig. 2B), whereas the simultaneous addi-
tion of TGF-b 1 with LPS led to a reduction in lucifer-
ase activity from 100% to 43.5 ± 14.1% (P = 0.01).
In agreement with published data, these experiments
show that the TNF-a 3¢-UTR is sufficient to give LPS
the ability to stabilize mRNA [12], but they also dem-
onstrate that this process is regulated by TGF-b1.
Induction of FXR1 expression by TGF-b1 leads to
post-transcriptional downregulation of TNF-a
protein
Many RNA-binding proteins, such as TTP, TIA-1,
HuA, TIA-1-related protein, and FXR1, are known to
bind to the ARE in the 3¢-UTR of cytokines, including
TNF-a, and regulate translation. We therefore studied
the effect of TGF-b1 on RNA-binding proteins,
including the mRNA expression of HuA (Fig. 3A),
TIA-1 (Fig. 3B), and TTP (Fig. 3C). LPS induced an
increase in HuA expression and a decrease in TIA-1
expression, but TGF-b1 did not have an effect
on these mRNA levels. As the production of these
proteins was not induced by TGF-b1, they were not
likely candidates for mediating its effects. As expected
[37], LPS induced TTP mRNA expression, although,
unexpectedly, TGF-b1 decreased the LPS-induced
increase in TTP levels. TTP is a negative regulator

RAW 264.7 cells. TGF-b1 alone and TGF-b1 with
LPS also induced FXR1 protein production in this sys-
tem (Fig. 3F). As expected, two different isoforms of
FXR1 were visualized by western blotting with anti-
body against FXR1 following the addition of TGF-b1
and TGF-b1 ⁄ LPS [39,40].
The pattern of FXR1 induction suggests that it
could play a role in regulating TNF-a protein expres-
sion in cells treated with TGF-b1. To test this directly,
FXR1 was inhibited with small interfering RNA
(siRNA) (Fig. 4A). FXR1 siRNA inhibited FXR1
mRNA expression by 74% as compared with a control
siRNA. Inhibition of FXR1 protein production
was assessed by using RAW 264.7 cells treated with
TGF-b1 for 1 h (Fig. 4Ba) and RAW 264.7 cells
stably transfected with FXR1 under a cytomegalovirus
(CMV) promoter (FXR1-OE cells; Fig. 4Bb). In both
the RAW 264.7 cells treated with TGF-b1 and the
FXR1-OE cells, siRNA 1 led to the greatest inhibition
of FXR1 protein production, so siRNA 1 was used for
all experiments. In the control siRNA-transfected cells,
LPS induced TNF-a protein production, and the addi-
tion of TGF-b1 suppressed TNF-a protein production
by 63%. When FXR1 was inhibited, TGF-b1 was no
longer able to suppress LPS-induced TNF-a protein
production (Fig. 4C). These findings show that TGF-
b1-induced inhibition of TNF-a protein production is
reversed when FXR1 is inhibited.
Overexpression of FXR1 can suppress
LPS-induced TNF-a protein production

involved in FXR1 induction, SB203580, a cell-perme-
able p38 MAPK inhibitor, was used. RAW 264.7 cells
were treated with LPS (100 ngÆmL
)1
) and 0–10 lm
SB203580 for 4 h, and FXR1 protein (Fig. 6A) and
mRNA (Fig. 6B) were quantified. This treatment led
to substantial upregulation of FXR1 protein produc-
tion as well as an increase in mRNA levels. Further
experiments showed that the MAPKAP kinase 2 inhib-
itor also induced FXR1 mRNA expression (Fig. 2C).
These inhibitors were also tested with BMDMu trea-
ted with LPS. A negative control inhibitor (SB202474)
did not lead to expression of FXR1 mRNA, whereas
the MAPKAP kinase 2 inhibitor and SB203580 both
induced FXR1 mRNA expression (Fig. 6D). These
A
B
Fig. 2. TGF-b1 can inhibit LPS-induced protein production via the
3¢-UTR of TNF-a. (A) Schematic representation of the SV40–Luc–
TNF-3¢-UTR plasmid used. (B) The SV40–Luc–TNF-3¢-UTR plasmid
was cotransfected into RAW 264.7 cells with Renilla, also on a con-
stitutive promoter. After 24 h, the cells were treated with
100 ngÆmL
)1
LPS, with addition of 10 ngÆmL
)1
TGF-b1 alone or at
the same time as LPS. Luciferase expression was normalized using
Renilla. Cells treated with LPS alone were set at 100% luciferase

of FXR1 on the other. These results are consistent
with the phenotype of macrophages derived from
FXR1
) ⁄ )
mice [21]. The reporter assay showed more
suppression than quantification of TNF-a protein by
ELISA or intracellular staining. The most likely reason
for this is that only the effects of the TNF-a mRNA
3¢-UTR are being taken into account. Although the
luciferase data show that TGF-b1 can suppress LPS-
induced TNF-a production post-transcriptionally,
it does not provide information about whether
this occurs via mRNA instability and a decrease in
the half-life of TNF-a mRNA or via translational
suppression.
TGF-b1 inhibits the action of LPS, in part, by inter-
fering with p38 MAPK-dependent stabilization of mul-
tiple mRNAs [33]. This has downstream effects on a
number of genes, including those for TNF-a [50],
interleukin (IL)-3 [51], and IL-8 [52]. Inhibiting p38
A
CD
B
EF
Fig. 3. TGF-b1 can induce FXR1 mRNA and
protein expression. RAW 264.7 cells were
treated with 100 ngÆmL
)1
LPS and
10 ngÆmL

C
B
Fig. 5. Overexpression of FXR1 suppresses LPS-induced TNF-a
protein production. RAW 264.7 cells were transfected with the
RFP-OE or FXR1-OE plasmid and cultured in the presence of G418
for 4 weeks. FXR1 protein was detected by western blot (A), and
FXR1 mRNA expression was quantified using Q-PCR and normal-
ized using GAPDH; n =3, *P < 0.05 (B). RFP-OE and FXR1-OE
cells were cultured with or without 100–1 ngÆmL
)1
LPS for 4 h in
the presence of GolgiPlug. Intracellular analysis of TNF-a was
carried out by flow cytometry (C); n = 3–4, *P < 0.05.
a) RAW 264.7 cells
b) FXR1-OE cells
None
Control
siRNA 1
siRNA 2
siRNA 3
FXR1
Actin
FXR1
Actin
B
A
1.2
1
0.8
0.6

described, and, after 24 h, FXR1 protein was detected by western
blot (Bb). RAW 264.7 cells were transfected with siRNA, and, after
24 h, 100 ngÆmL
)1
LPS was added plus 10 ngÆmL
)1
TGF-b1 for 4 h
in the presence of GolgiPlug (C). Intracellular TNF-a was quantified
by flow cytometry; n =3,*P > 0.05.
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2759
is worthy of further investigation, as TTP is a negative
regulator of TNF-a. On the other hand, TGF-b1, but
not LPS alone, significantly increased FXR1 expres-
sion, whereas LPS in combination with TGF-b1 fur-
ther increased FXR1 expression. FXR1 is known to
bind to the TNF-a mRNA ARE and suppress transla-
tion [21]. Other mRNA-binding proteins, such as TTP,
are known to be controlled by phosphorylation by p38
MAPK ⁄ MK2. There is evidence suggesting that phos-
phorylation of another member of the FXR1 family,
Fragile X mental retardation protein, on Ser 144 may
be important in translational repression [54], but the
effects of phosphorylation of FXR1 are unknown. In
this article, we have shown that inhibition of the p38
MAPK pathway can upregulate FXR1, but the mecha-
nism for this remains unknown and is under investiga-
tion. It is also possible that other anti-inflammatory
cytokines may also upregulate FXR1, leading to post-
transcriptional regulation of TNF-a and possibly other

impaired host defence against infections [63–65].
Understanding the role that FXR1 plays in the control
of TNF-a by TGF-b1 could allow the development of
therapies that complement the blockade of TNF-a,to
give full efficacy while reducing unwanted side effects.
The study of RNA-binding proteins is therefore essen-
tial for the understanding of intracellular regulatory
pathways and molecular mechanisms of pathology.
Experimental procedures
BMDMu
C57BL ⁄ 6 Ly.5.2 congenic mice were obtained from Charles
River Laboratories (Margate, UK), and were reared under
specific pathogen-free conditions. The mice were maintained
in accordance with the Home Office Regulations for
A
C
B
D
Fig. 6. Inhibition of the p38 MAPK pathway
can induce FXR1 protein production in
LPS-treated macrophages. RAW 264.7 cells
were cultured with 100 ngÆmL
)1
LPS for 4 h
plus SB203580. FXR1 protein was detected
by western blot (A), and relative FXR1
mRNA expression was quantified by Q-PCR
(B). The results were normalized using
GAPDH; n =3,*P < 0.05. RAW 264.7 cells
were also cultured with 100 ngÆmL

)1
streptomycin, and 2 mml-glutamine
(all from Invitrogen, Paisley, UK). Cells were maintained at
37 °C in the presence of 5% CO
2
.
Inhibitors
SB203580 was purchased from Promega. The negative con-
trol inhibitor SB2025880 and MAPKAP kinase 2 (Hsp25)
inhibitor were purchased from Calbiochem (Nottingham,
UK).
Stable cell lines
RAW 264.7 cells were electroporated at 300 V and 960 l F
with plasmids containing RFP or FXR1 on the CMV pro-
moter (Cambridge Biosciences, Cambridge, UK). After
24 h, 500 lgÆmL
)1
G418 (Sigma Aldrich, Dorset, UK) was
added to the medium [67], and cells were used after 4 weeks
of culture.
Flow cytometry
Cells were seeded in macrophage serum-free medium (Invi-
trogen, Paisley, UK). The cells were treated with TGF-b1
(R&D Systems, Abingdon, UK) or LPS (Sigma Aldrich,
Dorset, UK) at the concentrations stated for 4 h in the
presence of 1 lgÆmL
)1
GolgiPlug (BD Bioscience, Oxford,
UK). The cells were washed in buffer containing a balanced
salt solution with 0.1% BSA and 0.08% azide (Media Ser-

Name Sequence (5¢–3¢) RT database
GAPDH Forward: TTCACCACCATGGAGAAGGC
Reverse: GGCATGGACTGTGGTCATGA
RTPrimerDB 2920
FXR1 Forward: ATAATTGGCAACCAGAACGCCAGG
Reverse: CCACATGGCTCTTGGTCATTTGCT
–
TNF-a Forward: CATCTTCTCAAAATTCGAGTGACAA
Reverse: TGGGAGTAGACAAGGTACAACCC
RTPrimerDB 147
TTP Forward: TGCAATAACCCATTTCCCTGGTGC
Reverse: TAGGAACGGATCCACCCAAACACT
–
TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAG
Reverse: AGGCTGCTTTGATGTCTTCGGTTG
–
HuA Forward: ACTGCAGGGATGACATTGGGAGAA
Reverse: AAGCTTTGCAGATTCAACCTCGCC
–
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2761
Genosys, Dorset, UK). The PCR product was purified using
the QIAquick PCR purification kit (Qiagen, Crawley, UK)
and inserted into the XbaI site in the pGL3 control vector
(Promega, Southampton, UK). The plasmid was amplified
in Top10 Escherichia coli (Invitrogen, Paisley, UK) and
purified using the HiSpeed Plasmid Midikit (Qiagen). A
Renilla plasmid (pRL–TK–renilla; Promega) was used as a
control. RAW 264.7 cells were seeded to a density of
1.5 · 10

gated secondary antibody (Santa Cruz Biotechnology).
Proteins were visualized by enhanced chemiluminescence
(Amersham, Little Chalfont, UK), according to the manu-
facturer’s instructions.
siRNA
Cells were plated in a six-well plate at a density of
1 · 10
6
cells per well overnight in DMEM containing 2 mm
l-glutamine only. On the following day, the cells were
washed with Optimem and transfected using Lipofectamine
RNAiMax (Invitrogen) with 50 nm control siRNA
(BLOCK-iT Alexa Fluor Red Fluorescent Control; Invitro-
gen) or FXR1 siRNA (Invitrogen) for 24 h. The following
FXR1 siRNA sequences were used: siRNA 1, 5¢-GGG
CCC UAA UUA CAC CUC CGG UUA U-3¢; siRNA 2,
5¢-GCA AUC CAU ACA GCU UAC UUG AUA A-3¢;and
siRNA 3, 5¢-GAA GUU GAU GCU UAU GUC CAG
AAA U-3¢.
Statistical analysis
Results are expressed as mean ± standard error of the
mean. The Mann–Whitney U-test, two-tailed, was used to
determine significance.
Acknowledgements
The flow cytometric analysis was carried out with
assistance from Dr A. Herman and Mr T. Curry, Flow
Cytometry Facility, Cellular and Molecular Medicine,
Bristol University. The authors would like to thank
Professor N. Perkins, University of Bristol, for review-
ing the manuscript. Mr O. Whitton assisted with the

Nature 420, 885–891.
9 Weil D, Brosset S & Dautry F (1990) RNA processing
is a limiting step for murine tumor necrosis factor beta
expression in response to interleukin-2. Mol Cell Biol
10, 5865–5875.
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2762 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
10 Moreira AL, Sampaio EP, Zmuidzinas A, Frindt P,
Smith KA & Kaplan G (1993) Thalidomide exerts its
inhibitory action on tumor necrosis factor alpha by
enhancing mRNA degradation. J Exp Med 177, 1675–
1680.
11 Han J, Huez G & Beutler B (1991) Interactive effects of
the tumor necrosis factor promoter and 3¢-untranslated
regions. J Immunol 146, 1843–1848.
12 Han J, Brown T & Beutler B (1990) Endotoxin-respon-
sive sequences control cachectin ⁄ tumor necrosis factor
biosynthesis at the translational level. J Exp Med 171,
465–475.
13 Biragyn A & Nedospasov SA (1995) Lipopolysaccha-
ride-induced expression of TNF-alpha gene in
the macrophage cell line ANA-1 is regulated at the
level of transcription processivity. J Immunol 155,
674–683.
14 Asirvatham AJ, Gregorie CJ, Hu Z, Magner WJ &
Tomasi TB (2008) MicroRNA targets in immune genes
and the Dicer ⁄ Argonaute and ARE machinery compo-
nents. Mol Immunol 45, 1995–2006.
15 Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli
F & Kollias G (1999) Impaired on ⁄ off regulation of

sion at the post-transcriptional level. J Biol Chem 280,
5750–5763.
22 Dean JL, Wait R, Mahtani KR, Sully G, Clark AR &
Saklatvala J (2001) The 3¢ untranslated region of tumor
necrosis factor alpha mRNA is a target of the mRNA-
stabilizing factor HuR. Mol Cell Biol 21, 721–730.
23 Bardoni B, Schenck A & Mandel JL (2001) The Frag-
ile X mental retardation protein. Brain Res Bull 56,
375–382.
24 Miyazono K (2000) Positive and negative regulation of
TGF-beta signaling. J Cell Sci 113, 1101–1109.
25 Dijke PT & Hill CS (2004) New insights into
TGF-b-Smad signalling. Trends Biochem Sci 29,
265–273.
26 Monteleone G, Kumberova A, Croft NM, McKenzie
C, Steer HW & MacDonald TT (2001) Blocking Smad7
restores TGF-beta1 signaling in chronic inflammatory
bowel disease. J Clin Invest 108, 601–609.
27 MacDonald TT (1999) Effector and regulatory lym-
phoid cells and cytokines in mucosal sites. Curr Top
Microbiol Immunol 236, 113–135.
28 Thorbecke GJ, Shah R, Leu CH, Kuruvilla AP, Hardi-
son AM & Palladino MA (1992) Involvement of endog-
enous tumor necrosis factor alpha and transforming
growth factor beta during induction of collagen type II
arthritis in mice. Proc Natl Acad Sci USA 89, 7375–
7379.
29 Mendez-Samperio P, Hernandez-Garay M & Nunez
Vazquez A (1998) Inhibition of Mycobacterium
bovis BCG-induced tumor necrosis factor alpha

Contrasting mechanisms for suppression of macrophage
cytokine release by transforming growth factor-beta and
interleukin-10. J Biol Chem 267 , 23301–23308.
36 Grzybowska EA, Wilczynska A & Siedlecki JA (2001)
Regulatory functions of 3¢UTRs. Biochem Biophys Res
Commun 288, 291–295.
37 Fairhurst A-M, Connolly J, Hintz K, Goulding N,
Rassias A, Yeager M, Rigby W & Wallace P (2003)
Regulation and localization of endogenous human
tristetraprolin. Arthritis Res Ther 5, R214–R225.
38 Carballo E, Lai WS & Blackshear PJ (1998) Feedback
inhibition of macrophage tumor necrosis factor-alpha
production by tristetraprolin. Science 281, 1001–
1005.
39 Vasudevan S & Steitz JA (2007) AU-rich-element-medi-
ated upregulation of translation by FXR1 and Argona-
ute 2. Cell 128, 1105–1118.
40 Kirkpatrick LL, McIlwain KA & Nelson DL (1999)
Alternative splicing in the murine and human FXR1
genes. Genomics 59, 193–202.
41 Sivalingam SP, Thumboo J, Vasoo S, Thio ST, Tse C
& Fong KY (2007) In vivo pro- and anti-inflammatory
cytokines in normal and patients with rheumatoid
arthritis. Ann Acad Med Singapore 36, 96–99.
42 Miossec P, Naviliat M, Dupuy d’Angeac A, Sany J &
Banchereau J (1990) Low levels of interleukin-4 and
high levels of transforming growth factor beta in
rheumatoid synovitis. Arthritis Rheum 33, 1180–1187.
43 Katsikis PD, Chu CQ, Brennan FM, Maini RN &
Feldmann M (1994) Immunoregulatory role of interleu-

type of peripheral blood CD4 + T cells in patients
with posterior segment intraocular inflammation. Invest
Ophthalmol Vis Sci 45, 170–176.
50 Brook M, Sully G, Clark AR & Saklatvala J (2000)
Regulation of tumour necrosis factor alpha mRNA
stability by the mitogen-activated protein kinase p38
signalling cascade. FEBS Lett 483, 57–61.
51 Ming XF, Stoecklin G, Lu M, Looser R & Moroni C
(2001) Parallel and independent regulation of interleu-
kin-3 mRNA turnover by phosphatidylinositol 3-kinase
and p38 mitogen-activated protein kinase. Mol Cell Biol
21
, 5778–5789.
52 Holtmann H, Winzen R, Holland P, Eickemeier S,
Hoffmann E, Wallach D, Malinin NL, Cooper JA,
Resch K & Kracht M (1999) Induction of interleukin-8
synthesis integrates effects on transcription and mRNA
degradation from at least three different cytokine- or
stress-activated signal transduction pathways. Mol Cell
Biol 19, 6742–6753.
53 Ogawa K, Chen F, Kim Y-J & Chen Y (2003) Tran-
scriptional regulation of tristetraprolin by transforming
growth factor-b in human T cells. J Biol Chem 278,
30373–30381.
54 Ceman S, O’Donnell WT, Reed M, Patton S, Pohl J &
Warren ST (2003) Phosphorylation influences the trans-
lation state of FMRP-associated polyribosomes. Hum
Mol Genet 12, 3295–3305.
55 Jin P, Zarnescu DC, Ceman S, Nakamoto M, Mowrey
J, Jongens TA, Nelson DL, Moses K & Warren ST

63 Nancy RS, Sharon KG, Jong-Hoon L, Evelyne TE &
Braun MM (2003) Listeria monocytogenes infection as
a complication of treatment with tumor necrosis
factor alpha-neutralizing agents. Arthritis Rheum 48,
319–324.
64 Keane J, Gershon S, Wise RP, Mirabile-Levens E,
Kasznica J, Schwieterman WD, Siegel JN & Braun
MM (2001) Tuberculosis associated with infliximab, a
tumor necrosis factor alpha-neutralizing agent. N Engl
J Med 345, 1098–1104.
65 Lee J-H, Slifman NR, Gershon SK, Edwards ET,
Schwieterman WD, Siegel JN, Wise RP, Brown SL,
Udall JN Jr. & Braun MM (2002) Life-threatening his-
toplasmosis complicating immunotherapy with tumor
necrosis factor alpha antagonists infliximab and etaner-
cept. Arthritis Rheum 46, 2565–2570.
66 Munder M, Eichmann K & Modolell M (1998) Alterna-
tive metabolic states in murine macrophages reflected
by the nitric oxide synthase ⁄ arginase balance: competi-
tive regulation by CD4 + T cells correlates with
Th1 ⁄ Th2 phenotype. J Immunol 160, 5347–5354.
67 Gough PJ, Garden S & Greaves DR (2001) The use of
human CD68 transcriptional regulatory sequences to
direct high-level expression of class A scavenger recep-
tor in macrophages in vitro and in vivo. Immunology
103, 351–361.
Supporting information
The following supplementary material is available:
Fig. S1. Dose-dependent induction of TNF-a expres-
sion by LPS.