Expressed as the sole Hsp90 of yeast, the a and b isoforms
of human Hsp90 differ with regard to their capacities for
activation of certain client proteins, whereas only Hsp90b
generates sensitivity to the Hsp90 inhibitor radicicol
Stefan H. Millson
1
, Andrew W. Truman
1
, Attila Ra
´
cz
2
, Bin Hu
3
, Barry Panaretou
3
, James Nuttall
1
,
Mehdi Mollapour
1
, Csaba So
¨
ti
2
and Peter W. Piper
1
1 Department of Molecular Biology and Biotechnology, The University of Sheffield, UK
2 Department of Medical Chemistry, Semmelweis University, Budapest, Hungary
3 Division of Life Sciences, King’s College London, UK
Heat shock protein 90 (Hsp90), an essential molecular

E-mail: Peter.Piper@sheffield.ac.uk
(Received 24 April 2007, revised 1 June
2007, accepted 3 July 2007)
doi:10.1111/j.1742-4658.2007.05974.x
Heat shock protein 90 (Hsp90) is a molecular chaperone required for the
activity of many of the most important regulatory proteins of eukaryotic
cells (the Hsp90 ‘clients’). Vertebrates have two isoforms of cytosolic
Hsp90, Hsp90a and Hsp90b. Hsp90b is expressed constitutively to a high
level in most tissues and is generally more abundant than Hsp90a, whereas
Hsp90a is stress-inducible and overexpressed in many cancerous cells.
Expressed as the sole Hsp90 of yeast, human Hsp90a and Hsp90b are both
able to provide essential Hsp90 functions. Activations of certain Hsp90
clients (heat shock transcription factor, v-src) were more efficient with
Hsp90a, rather than Hsp90b, present in the yeast. In contrast, activation
of certain other clients (glucocorticoid receptor; extracellular signal-regu-
lated kinase-5 mitogen-activated protein kinase) was less affected by the
human Hsp90 isoform present in these cells. Remarkably, whereas expres-
sion of Hsp90b as the sole Hsp90 of yeast rendered cells highly sensitive to
the Hsp90 inhibitor radicicol, comparable expression of Hsp90a did not.
This raises the distinct possibility that, also for mammalian systems, altera-
tions to the Hsp90a ⁄ Hsp90b ratio (as with heat shock) might be a signifi-
cant factor affecting cellular susceptibility to Hsp90 inhibitors.
Abbreviations
AD, activator domain; BD, DNA-binding domain; CT, C-terminal activator ⁄ modulator; DO, complete dropout glucose medium; ERK,
extracellular signal-regulated kinase; GR, glucocorticoid receptor; HSF, heat shock transcription factor; Hsp90, heat shock protein 90;
MAP kinase, mitogen-activated protein kinase; v-src, v-src tyrosine kinase; Y2H, yeast two-hybrid.
FEBS Journal 274 (2007) 4453–4463 ª 2007 The Authors Journal compilation ª 2007 FEBS 4453
duplication of the S. cerevisiae genome [8], as most
yeast species have just a single Hsp90.
Vertebrates also have two major forms of cytosolic

The human genome appears to have just two func-
tional genes for Hsp90a and one for Hsp90b [10]. So
essential is the Hsp90 function conferred by these genes
that it is possible that neither Hsp90a nor Hsp90b can
be inactivated completely in vertebrate systems, creat-
ing a situation where the remaining isoform would have
to provide all the essential functions for cytosolic
Hsp90. Hsp90b loss is known to cause embryonic
lethality in the mouse [15]. Whereas it might be feasible
to generate Hsp90a or Hsp90b gene knockouts in
particular animal tissues, it is not clear whether this is a
realistic strategy for revealing any functional differ-
ences between the isoforms. We have therefore investi-
gated yeast strains that express, to similar levels, either
human Hsp90a or human Hsp90b as their sole Hsp90.
Here we report a study of the activation of various
Hsp90 clients and Hsp90 inhibitor sensitivity in such
strains; analysis that showed that many mammalian
clients are able to be activated by both Hsp90a and
Hsp90b. Whether Hsp90a or Hsp90b is expressed in
the yeast, however, has a dramatic effect on Hsp90
inhibitor sensitivity. This raises the intriguing possibil-
ity that the a ⁄ b isoform ratio may be an important
determinant of such inhibitor sensitivity in mammalian
cells. In an independent study, yeasts expressing either
Hsp90a or Hsp90b
were recently used to study the
effects of some naturally occurring sequence polymor-
phisms in the human genes for Hsp90 [16].
Results

integrity or the ability to withstand osmostress (pro-
perties defective in certain Hsp90 mutants of yeast
[3,14,18,19]; unpublished data). Both strains were
growth-arrested when exposed to the mating phero-
mone a-factor (data not shown), and so were not defec-
tive in this Hsp90-dependent response [20]. Also, when
rendered histidine prototrophic through the introduc-
tion of an HIS3 vector, both PP30[hHsp90a] and
PP30[hHsp90b] grew well at 30 °C in the presence of
Human Hsp90a and Hsp90b expressed in yeast S. H. Millson et al.
4454 FEBS Journal 274 (2007) 4453–4463 ª 2007 The Authors Journal compilation ª 2007 FEBS
30 mm 3-aminotriazole. They are therefore not defective
in the Hsp90-dependent activation of Gcn2p kinase [21].
In contrast, the strain expressing Hsp90b was slightly
temperature-sensitive [PP30[hHsp90a], and exhibited
growth on YPD to 39–40 °C, whereas PP30[hHsp90b]
grew only to 36–37 °C (not shown)]. Growth of S. cere-
visiae at high temperature requires the activity of the
C-terminal activator ⁄ modulator (CT) domain of yeast
HSF (Hsf1p). Cells expressing a CT domain-deficient
Hsf1p exhibit no growth above 35 °C. This high-temper-
ature growth defect is rescued by Hsp90 overexpression,
revealing that this growth defect is primarily due to the
low level of (Hsf1p-directed) Hsp90 expression in these
cells [14,22].
To find whether heat activation of the Hsf1p CT
domain is defective in our strains expressing a single
Hsp90 isoform (all strains with a wild-type Hsf1p), we
monitored a reporter gene (HSE2-lacZ [23]) that mea-
sures activity of the Hsf1p CT domain (HSE2-lacZ

and extracellular signal-regulated kinase-5 (ERK5)
mitogen-activated protein (MAP) kinase [18].
GR assays indicated that human Hsp90a and
Hsp90b, as well as the native yeast Hsp90s, were all
capable of activating GR in these strains (Fig. 2).
Active v-src expression is normally lethal for yeast,
an organism with very low intrinsic levels of tyrosine
kinase activity [25]. With use of a galactose-inducible
system for v-src expression, high levels of tyrosine
phosphorylation were generated in response to v-src
induction in PP30[hHsp90a] (Fig. 3B); an induction
associated with strong growth inhibition (Fig. 3A). In
contrast, the identically treated culture of strain
PP30[hHsp90b] exhibited much lower levels of tyrosine
A
B
C
Fig. 1. (A) Measurement of the relative levels of Hsp90 expression
in strains PP30[pHSC82b], PP30[pHSP82], PP30[hHsp90a], and
PP30[hHsp90b]. Ten micrograms of total soluble protein was gel
fractionated, and then western blotted; the blot was then probed
with anti-(Achlya Hsp90) monoclonal serum. The bands indicated by
an asterisk correspond to a slightly degraded, N-terminally trun-
cated form of Hsp90 that is often present in total cell extracts of
yeast [45]. (B) Levels of HSE2-LacZ reporter gene activity in strain
PSY145* with wild-type Hsf1p [22] (hatched bars) or strain
PSY145*HSF(1–583) with a CT domain-deficient Hsf1p [22] (open
bars), showing that heat induction of HSE2-LacZ is dependent on
the Hsf1p CT domain. (C) Measurements of HSE2-LacZ expression
in strains PP30[pHSP82], PP30[pHSC82b], PP30[hHsp90a], and

reporter gene [27], which monitors the activity of
Rlm1p, a transcription factor activated by cell integrity
MAP kinase.
Loss of cell integrity MAP kinase generates a num-
ber of characteristic phenotypes in yeast, including
temperature and caffeine sensitivity [28–30] and loss of
mating projection formation upon treatment with mat-
ing pheromones [31]. Plasmid pG1-ERK5 rescues these
phenotypes of slt2D yeast [18]. It was also able to res-
cue these phenotypes in both PP30[hHsp90a]slt2D and
PP30[hHsp90b]slt2D, the restoration of high-tempera-
ture (37 °C) growth being shown in Fig. 4A. Both iso-
forms of human cytosolic Hsp90 can therefore activate
human ERK5 MAP kinase in yeast.
Rlm1p, the major trans-activator of cell wall genes
in yeast, is activated through Slt2p-catalyzed phos-
phorylation [27,32,33]. slt2D mutant cells therefore
display a pronounced Rlm1p activity defect. Hsp90 is
required for the rescue of their Rlm1p activity defect
by ERK5 expression, as such rescue is abolished by
the T22I Hsp90 mutation or by Hsp90 inhibitor treat-
ment [18]. As shown in Fig. 4B, ERK5 expression
provided an appreciable rescue of the Rlm1p activity
of PP30[hHsp90a]slt2D and PP30[hHsp90b]slt2D, acti-
vity that was increased by two stress inducers of cell
integrity pathway signaling, heat shock and caffeine.
This is yet further evidence that both Hsp90a and
Hsp90b are able to activate human ERK5 expressed
in yeast.
Fig. 2. Measurements of GR activity in 30 °C cultures of strains

We used the yeast two-hybrid (Y2H) system to deter-
mine the relative strengths of in vivo interaction of
these two MAP kinases with the two isoforms of
human Hsp90. In the yeast Hsp90s, a C-terminal
Gal4p DNA-binding domain (BD) extension preserves
the essential Hsp90 functions in vivo, whereas position-
ing this BD at the N-terminus of Hsp90 inactivates the
chaperone [34]. We therefore constructed strains that
express Y2H ‘bait’ fusions comprising Hsp90a and
Hsp90b with C-terminal BD extensions (Hsp90a-BD,
Hsp90b-BD; see Experimental procedures). These were
then mated to cells expressing the previously described
Gal4p activator domain (AD)-Slt2p and AD-ERK5
‘prey’ fusions [3,18]. Expression of the GAL7 pro-
moter-regulated LacZ gene in the resulting diploid
strains, a gene reporter of protein–protein interaction,
was then analyzed. As shown in Fig. 5A, both the
Slt2p and ERK5 MAP kinases displayed stronger
Y2H interactions with Hsp90b than with Hsp90a.
Consistent with Slt2 and ERK5 acquiring an
enhanced capacity for Hsp90 binding in vivo in
response to Mkk1 ⁄ 2-directed phosphorylation of the
MAP kinase activation loop [3,14,18], Y2H interaction
of these MAP kinases with the two isoforms of human
Hsp90 was strengthened by heat shock (Fig. 5A). The
stronger interaction of ERK5 with Hsp90b, relative to
Hsp90a, was then confirmed through an analysis of
extracts of PP30[hHsp90a]slt2D and PP30[hHsp90b]
slt2D cells expressing a functional [18] ERK5(1–407)-
His

PP30[hHsp90b]slt2D cultures, either in growth at 25 °C, or heat
shocked from 25 °Cto39°C for 1 h. The blots were probed with
anti-(Achlya Hsp90) and anti-tetra-His sera. Control lanes (C) are the
extracts from unstressed, non-ERK5-expressing cultures of the
same strains.
S. H. Millson et al. Human Hsp90a and Hsp90b expressed in yeast
FEBS Journal 274 (2007) 4453–4463 ª 2007 The Authors Journal compilation ª 2007 FEBS 4457
His
12
(Fig. 5B). As this, and the Y2H interactions in
Fig. 5A, essentially reflect the formation of a late-stage
complex of the Hsp90 chaperone cycle [3,14,18], it is
possible that MAP kinase complexes with Hsp90b in
yeast progress more slowly through this chaperone
cycle than do the equivalent complexes with Hsp90a
(see Discussion).
Expression of Hsp90a or Hsp90b markedly affects
cellular sensitivity to the Hsp90 inhibitor radicicol
We recently reported that strain PP30[hHsp90b]is
extremely sensitive to Hsp90 inhibitors [35]. This, how-
ever, is not a general effect of human Hsp90 expres-
sion in yeast, as the cells expressing Hsp90a were not
sensitized to the Hsp90-targeting antibiotic radicicol.
Instead, strain PP30[hHsp90a] was relatively radicicol-
resistant, displaying levels of sensitivity comparable to
that of isogenic strains expressing either of the two iso-
forms of the native yeast Hsp90 (PP30[pHSC82b],
PP30[pHSP82]); Fig. 6A,C,D. Remarkably, low radici-
col levels (to 4 lm) were found to increase the final
biomass yields of PP30[pHSP82], relative to the other

D
BC
Fig. 6. (A–C) Only Hsp90b, not Hsp90a, sensitizes yeast to radicicol. Final biomass yields, expressed as a percentage of that of cells with
no inhibitor, for cells expressing just a single isoform of either yeast Hsp90 (r, Hsp82; j, Hsc82) or human Hsp90 (e, Hsp90a; h, Hsp90b),
cultured for 42 h in the presence of (A) 0–4 l
M radicicol, 30 °C, (B) 0–50 lM radicicol, 30 °C, or (C) 0–50 lM radicicol, 37 °C. (D) Morphologic
differences between PP30[hHsp90a] and PP30[hHsp90b] cultured for 6 or 24 h at 30 °C in the presence of 4 l
M radicicol.
Human Hsp90a and Hsp90b expressed in yeast S. H. Millson et al.
4458 FEBS Journal 274 (2007) 4453–4463 ª 2007 The Authors Journal compilation ª 2007 FEBS
radicicol concentration, the latter strain was not arrested
in growth (Fig. 6A,B).
Discussion
In this work, we have investigated how the presence
of Hsp90a or Hsp90b ) as the sole Hsp90 in yeast
cells ) influences both the activation of certain clients
in these cells and cellular sensitivity to the Hsp90
inhibitor radicicol. The most striking finding was that
it is only expression of Hsp90b, not comparable
expression of Hsp90a, which renders yeast highly sen-
sitive to radicicol (Fig. 6). This raises the distinct pos-
sibility that, in mammalian systems as well, alterations
to the Hsp90a ⁄ Hsp90b ratio (as with heat shock) may
be a significant factor affecting sensitivity of cells to
Hsp90 inhibitors. Up to now, the Hsp90a ⁄ Hsp90b iso-
form ratio has never been considered as a possible
influence on Hsp90 drug resistance. Instead, the total
level of the drug target (Hsp90) in cells, and the
amount of this Hsp90 that becomes locked into com-
plexes with client proteins [36] have generally been

Hsp90a than by Hsp90b.
Hsp90 tends to transiently bind its client proteins, in
a chaperone cycle thought to take place over a time
scale of minutes [37,38]. In yeast, Hsp90b undergoes
stronger Y2H interaction with MAP kinase clients than
Hsp90a (Fig. 5). As detection of in vivo protein–protein
interaction by the Y2H approach requires a fairly long
association of ‘bait’ and ‘prey’ fusions in the nucleus of
the living cell, these stronger MAP kinase Y2H interac-
tions with Hsp90b as compared to Hsp90a (Fig. 5A)
are consistent with a longer residence time of these cli-
ents in the form of multiprotein complexes in vivo when
associated with Hsp90b as compared to Hsp90a ) an
indication that Hsp90b may progress rather more
slowly through the chaperone cycle than Hsp90a. Y2H
interactions with Hsp90 are generally only detected
when the chaperone cycle is slowed [3].
In mammalian cells, the fraction of the cellular
Hsp90 existing in the form of multiprotein complexes
with client proteins appears to be a major determinant
of Hsp90 drug sensitivity, the high sensitivity of certain
cancer cells to these drugs apparently being associated
with the large pool of mutant client proteins sequester-
ing much of the Hsp90 into Hsp90–client complexes
[36]. Thus, the high radicicol sensitivity of
PP30[hHsp90b] relative to the other strains tested
(Fig. 6) may, in part, be due to a higher Hsp90 frac-
tion in this strain existing as multichaperone complexes
with high affinity for client proteins, rather that as the
latent uncomplexed chaperone.

S. H. Millson et al. Human Hsp90a and Hsp90b expressed in yeast
FEBS Journal 274 (2007) 4453–4463 ª 2007 The Authors Journal compilation ª 2007 FEBS 4459
ratio [43]. This, in turn, may affect the operation of the
Hsp90 chaperone machine.
Experimental procedures
Yeast strains and yeast culture
Cultures were grown at 30 °Cor33°C, either on complete
dropout glucose medium (DO) [44] or on YPD medium
[2% (w ⁄ v) glucose, 2% Bacto peptone, 1% yeast extract,
20 mgÆL
)1
adenine). Radicicol was purchased from Sigma
(Poole, UK).
Derivatives of strain PP30 that express, as their sole
Hsp90, the native Hsc82 or Hsp82 of S. cerevisiae
(PP30[pHSC82b], PP30[pHSP82]), as well as human
Hsp90b (PP30[hHsp90b]), have been described previously
[35]. A plasmid (pH90a) for human Hsp90a expression in
S. cerevisiae was constructed by PCR amplification of the
Hsp90a ORF using the forward primer AAATAA
GTCG
ACATGCCTGAGGAAACCCAG (SalI site underlined;
Hsp90a start codon in bold) and the reverse primer CTTC
AT
CTGCAGTTAGTCTACTTCTTCCAT (PstI site under-
lined; stop codon position in bold). This PCR product was
cleaved with SalI and PstI, and then inserted into Sal
I–PstI-cleaved pHSCprom (an expression vector that
comprises the LEU2 vector YCplac111 with S. cerevisiae
HSC82 promoter and ADHI terminator inserts [45]),

were then transformed with the TRP1 plasmids pG1 and
pG1-ERK5 (control empty vector and vector for TDH1
promoter-driven ERK5 expression, respectively [18]) or
pHis-ERK5(1–407) (a vector for MET25 promoter-regulated
expression of a functional truncated ERK5 with a C-terminal
12xHis tag) [18].
Western blot analysis
Total protein extracts were prepared and western blots pre-
pared as described previously [46]. Antisera used at 1 : 2500
dilution were mouse monoclonal antibodies to Achlya ambi-
sexualis Hsp90 (Stressgen, Victoria, Canada) or tetra-His
(Qiagen, Crawley, UK).
Two-hybrid studies
Two-hybrid baits that consist of human Hsp90a and
Hsp90b fusions with a C-terminal BD extension (Hsp90a-
BD; Hsp90b-BD) were generated by homologous recombi-
nation within yeast, essentially as previously described
[34,48]. ORFs of these human Hsp90s were initially ampli-
fied by two sequential PCR amplifications. The first PCR
used primers that possess 3¢ sequence homologies to these
Hsp90s but 5¢ homologies to plasmid pBDC [34] (Hsp90a,
forward primer GCTTGAAGCAAGCCTCGATGCCT
GAGGAAACCCAGACCCAA, reverse primer CAGT
AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA;
Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT
GCCTGAGGAAGTGCACCATGGA, reverse primer CA
GTAGCTTCATCTT TCGATCGACT TCTTCC ATGCGA
GA). The second PCR used a universal pair of primers
[34,48]. PJ69-4 a [48] was then transformed with the product
of this second PCR and NruI-digested pBDC, so as to gen-

legend to Fig. 6.
Acknowledgements
We are indebted to J. Brodsky, S. Fields, D. Levin,
S. Lindquist, C. Marshall, C. Prodromou and W. Ober-
mann for gifts of strains, plasmids and antisera. This
work was supported by grants from the Wellcome Trust
(074575 ⁄ Z ⁄ 04 ⁄ Z), BBSRC (C506721 ⁄ 1), the EU 6th
Framework program (FP6506850, FP6518230), the Hun-
garian Science Foundation (OTKA-F47281) and the
Hungarian National Research Initiative (1A ⁄ 056 ⁄ 2004
and KKK-0015 ⁄ 3.0). C. So
¨
ti is a Bolyai research Scho-
lar of the Hungarian Academy of Sciences.
References
1 Riggs DL, Cox MB, Cheung-Flynn J, Prapapanich V,
Carrigan PE & Smith DF (2004) Functional specificity
of co-chaperone interactions with Hsp90 client proteins.
Crit Rev Biochem Mol Biol 39, 279–295.
2 Pearl LH & Prodromou C (2006) Structure and mecha-
nism of the hsp90 molecular chaperone machinery.
Annu Rev Biochem 75, 271–294.
3 Millson SH, Truman A, King V, Prodromou C, Pearl L
& Piper PW (2005) A two-hybrid screen of the yeast
proteome for Hsp90 interactors uncovers a novel
Hsp90 chaperone requirement in activity of a stress-acti-
vated MAP kinase, Slt2p (Mpk1p). Eukaryot Cell 4,
849–860.
4 Zhao R, Davey M, Hsu YC, Kaplanek P, Tong A, Par-
sons AB, Krogan N, Cagney G, Mai D, Greenblatt J

12 Eustace BK, Sakurai T, Stewart JK, Yimlamai D,
Unger C, Zehetmeier C, Lain B, Torella C, Henning
SW, Beste G et al. (2004) Functional proteomic
screens reveal an essential extracellular role for hsp90
alpha in cancer cell invasiveness. Nat Cell Biol 6,
507–514.
13 Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB,
Richardson JA & Benjamin IJ (1999) HSF1 is required
for extra-embryonic development, postnatal growth and
protection during inflammatory responses in mice.
EMBO J 18, 5943–5952.
14 Truman AW, Millson SH, Nuttall JM, Mollapour M,
Prodromou C & Piper PW (2007) In the yeast heat
shock response Hsf1-directed induction of Hsp90 facili-
tates the activation of the Slt2(Mpk1) cell integrity
MAP kinase. Eukaryot Cell 6, 744–752.
15 Voss AK, Thomas T & Gruss P (2000) Mice lacking
HSP90beta fail to develop a placental labyrinth. Devel-
opment 127, 1–11.
16 MacLean MJ, Llordella MM, Bot N & Picard D (2005)
A yeast-based assay reveals a functional defect of the
Q488H polymorphism in human Hsp90alpha. Biochem
Biophys Res Commun 337, 133–137.
17 Piper PW, Millson SH, Mollapour M, Panaretou B,
Siligardi G, Pearl LH & Prodromou C (2003) Sensitivity
to Hsp90-targeting drugs can arise with mutation to the
Hsp90 chaperone, cochaperones and plasma membrane
ATP binding cassette transporters of yeast. Eur J
Biochem
270, 4689–4695.

of hsp90 compromise steroid receptor action in vivo.
Nature 348, 166–168.
25 Xu Y, Singer MA & Lindquist S (1999) Maturation of
the tyrosine kinase c-src as a kinase and as a substrate
depends on the molecular chaperone Hsp90. Proc Natl
Acad Sci USA 96, 109–114.
26 Citri A, Harari D, Shochat G, Ramakrishnan P, Gan J,
Eisenstein M, Kimchi A, Wallach D, Pietrokovski S &
Yarden Y (2006) Hsp90 recognizes a common surface
on client kinases. J Biol Chem 281, 14361–14369.
27 Jung US, Sobering AK, Romeo MJ & Levin DE (2002)
Regulation of the yeast Rlm1 transcription factor by
the Mpk1 cell wall integrity MAP kinase. Mol Microbiol
46, 781–789.
28 Kamada Y, Jung US, Piotrowski J & Levin DE (1995)
The protein kinase C-activated MAP kinase pathway of
Saccharomyces cerevisiae mediates a novel aspect of the
heat shock response. Genes Dev 9, 1559–1571.
29 Ketela T, Green R & Bussey H (1999) Saccharomyces
cerevisiae mid2p is a potential cell wall stress sensor and
upstream activator of the PKC1-MPK1 cell integrity
pathway. J Bacteriol 181, 3330–3340.
30 Martin H, Rodriguez-Pachon JM, Ruiz C, Nombela C
& Molina M (2000) Regulatory mechanisms for modu-
lation of signaling through the cell integrity Slt2-medi-
ated pathway in Saccharomyces cerevisiae. J Biol Chem
275, 1511–1519.
31 Zarzov P, Mazzoni C & Mann C (1996) The SLT2
(MPK1) MAP kinase is activated during periods of
polarized cell growth in yeast. EMBO J 15, 83–91.

38 Prodromou C, Siligardi G, O’Brien R, Woolfson DN,
Regan L, Panaretou B, Ladbury JE, Piper PW & Pearl
LH (1999) Regulation of Hsp90 ATPase activity by
tetratricopeptide repeat (TPR)-domain co-chaperones.
EMBO J 18, 754–762.
39 Prodromou C, Panaretou B, Chohan S, Siligardi G,
O’Brien R, Ladbury JE, Roe SM, Piper PW & Pearl
LH (2000) The ATPase cycle of Hsp90 drives a molecu-
lar ‘clamp’ via transient dimerization of the N-terminal
domains. EMBO J 19, 4383–4392.
40 Young JC & Hartl FU (2000) Polypeptide release by
hsp90 involves ATP hydrolysis and is enhanced by the
co-chaperone p23. EMBO J 19, 5930–5940.
41 McLaughlin SH, Smith HW & Jackson SE (2002) Stim-
ulation of the weak ATPase activity of human Hsp90
by a client protein. J Mol Biol 315, 787–798.
42 Owen BA, Sullivan WP, Felts SJ & Toft DO (2002)
Regulation of heat shock protein 90 ATPase activity by
sequences in the carboxyl terminus. J Biol Chem 277,
7086–7091.
43 Panaretou B, Siligardi G, Meyer P, Maloney A, Sullivan
JK, Singh S, Millson SH, Clarke PA, Naaby-Hansen S,
Stein R et al. (2002) Activation of the ATPase activity
of Hsp90 by AHA1 and other co-chaperones. Mol Cell
10, 1307–1318.
44 Adams A, Gottschling DE, Kaiser CA & Stearns T
(1997) Methods in Yeast Genetics. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
45 Panaretou B, Sinclair K, Prodromou C, Johal J, Pearl L
& Piper PW (1999) The Hsp90 of Candida albicans can