A new pathway encompassing calpain 3 and its newly
identified substrate cardiac ankyrin repeat protein is
involved in the regulation of the nuclear factor-jB pathway
in skeletal muscle
Lydie Laure*, Nathalie Danie
`
le*, Laurence Suel, Sylvie Marchand, Sophie Aubert,
Nathalie Bourg, Carinne Roudaut, Ste
´
phanie Duguez, Marc Bartoli and Isabelle Richard
Ge
´
ne
´
thon, CNRS UMR8587 LAMBE, Evry, France
Introduction
Calpain 3 is a muscle specific, calcium dependent,
multi-substrate cysteine protease whose mutations are
the cause of limb girdle muscular dystrophy 2A
(LGMD2A, OMIM 253600), a severe muscle disorder
leading to selective atrophy and weakness of proximal
muscles [1,2]. Calpain 3 becomes activated once an
Keywords
calpain 3; cardiac ankyrin repeat protein;
limb girdle muscular dystrophy 2A; NF-jB;
skeletal muscle; titin
Correspondence
I. Richard, Ge
´
ne
´
Structured digital abstract
l
MINT-7990388: Titin (uniprotkb:Q8WZ42) physically interacts (MI:0915) with CARP (uni-
protkb:
Q9CR42)bytwo hybrid (MI:0018)
l
MINT-7990374: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with Titin (uni-
protkb:
Q8WZ42)bytwo hybrid (MI:0018)
l
MINT-7990342: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with CARP (uni-
protkb:
Q9CR42)bytwo hybrid (MI:0018)
Abbreviations
Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DARP, diabetes-related ankyrin repeat protein;
FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; MARP, muscle ankyrin repeat proteins; NF, nuclear factor;
NLS, nuclear localization signals; qRT-PCR, quantitative RT-PCR; ROI, region of interest; TA, tibialis anterior; YFP, yellow fluorescent protein.
4322 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
internal propeptide is removed from its active site by
an auto-proteolytic process [3]. Although the large
majority of the substrates identified are structural pro-
teins [3–5], proteins involved in cell metabolism [5–7]
and in the regulation of gene and protein expression
[2,7–9] were also suggested to be potential calpain 3
substrates. Taken together, the ensuing cleavages were
proposed to play a role in three major physiological
processes: the orchestration of sarcomere remodeling
[10–12], the control of apoptosis [9,13] and the regula-
tion of gene expression [2,7–9].
Calpain 3 is found in several different subcellular
assessed as a substrate. The structure of CARP com-
prises several ankyrin-like repeats, PEST motifs (i.e.
regions of protein instability rich in proline, glutamic
acid, serine and threonine) and putative nuclear locali-
zation signals (NLS) [18,19,26,28]. In the heart, CARP
expression increases in remodeling conditions associ-
ated with pathological hypertrophy [31–34]. In the skel-
etal muscle, CARP expression is low under basal
conditions but was reported to be induced in several
conditions such as exercise [30,35–38], atrophy [26] and
muscle pathologies [39–43]. From a molecular point of
view, CARP is known to act as a transcriptional regula-
tor. Indeed, CARP can bind to DNA [19] and inhibits
the transcription of MLC-2V by association with the
transcription factor YB1 in the heart [21].
Considering that (a) a molecular complex encom-
passes calpain 3 and CARP in the N2A elastic region
[18]; (b) exercise stimulates both calpain 3 activity [44]
and CARP expression [30] in skeletal muscle; (c) cal-
pain 3 was previously suggested to cleave unidentified
regulators of transcription [9]; and (d) a member of
the MARP family was previously demonstrated to be
cleaved by calpain 3 [29], the present study aimed to
identify the possible functional relationship(s) between
CARP and calpain 3 and the physiological pathway(s)
under control. We first showed that calpain 3 cleaves
CARP in vitro. Once cleaved, the long C-terminal part
of CARP is more efficiently bound to titin, possibly
impeding CARP nuclear translocation and any subse-
quent gene expression regulation. In addition, we dem-
the presence of the protease-dead C129S calpain 3,
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4323
CARP migrates at an apparent molecular weight of
approximately 40 kDa. A lower band is clearly visible
in the presence of wild-type calpain 3 (37 kDa for the
shorter form), demonstrating that CARP is cleaved in
the presence of calpain 3 in vitro (Fig. 1A).
CARP and calpain 3 interaction was tested using
yeast two-hybrid experiments. Because the ectopic
expression of wild-type calpain 3 leads to uncontrolled
proteolysis, a construct encoding catalytically inactive
calpain 3 fused to GAL 4 binding domain (pAS-C3)
was used as a bait and a construct encoding CARP
fused with the activation domain (pGAD-CARP) was
used as a prey. The yeasts resulting from the mating of
clones transformed with either calpain 3 or CARP
grow on Leu-Trp-His- selection medium, indicating
that calpain 3 and CARP interact (Fig. 1B). The fact
that calpain 3 interacts directly with CARP supports
the idea that the cleavage is direct.
Efforts to identify CARP cleavage site by protein
sequencing were unsuccessful. We therefore con-
structed several N-terminal truncated forms of CARP
(pDNter1, pDNter2, pDNter3 and pDNter4; see Materi-
als and methods) with respect to the different domains
of this protein (Fig. 1C). First, after expression in
NIH3T3, their migration patterns were compared by
immunoblotting with the profiles observed upon cal-
pain 3 mediated-CARP cleavage (Fig. 1D). The plas-
HIS) were injected and transferred by electroporation
in tibialis anterior (TA) muscles of 129SvPasIco wild-
type mice. Seven days later, the muscles were exposed
and submitted to direct observation using a confocal
microscope and an excitation wavelength of 514 nm
for yellow fluorescent protein (YFP) emission. The set-
ting for the CFP emission (excitation wavelength of
457 nm) was also attempted, but the fluorescence was
much weaker than YFP and the images were blurry,
impeding their analysis. We therefore used YFP fluo-
rescence only for further analysis.
Fig. 1. CARP is a substrate of calpain 3. (A) Western blot analysis performed on NIH3T3 extracts over-expressing V5-tagged CARP in the
presence of either wild-type or C129S-mutated calpain 3. The appearance of a 37-kDa CARP proteolytic fragment shows that CARP is
cleaved in presence of active calpain (V5 specific staining; upper panel). The activation of calpain 3 is verified by the detection of the 58 and
55 kDa autolysis fragments (calpain 3 specific staining; lower panel). (B) Yeast two-hybrid assessment of calpain 3-CARP interaction. The
calpain 3 construct was mutated on its active site to prevent uncontrolled proteolysis. Yeasts resulting from the mating of clones trans-
formed with calpain 3 or CARP were grown on Trp-Leu- (control medium; lower panels) or Trp-Leu-His- medium (selective medium; upper
panels). As a positive control, an interaction test of calpain 3 and N2A-titin is performed (upper left panel). The yeasts carrying calpain 3 and
CARP grow on the selective medium, indicating that CARP and calpain 3 interact (upper middle panel). (C) Schematic representation of
CARP structure (top) and sequence (bottom) indicating the presence of two PEST domains (light gray colored box), a coiled-coil region (gray
colored box), five ankyrin repeats (five dark gray boxes), two core NLS (in red) and a bipartite NLS (in yellow; the bipartite NLS encompass-
ing one of the core NLS). The region of interaction with titin-N2A is highlighted in bold ⁄ blue, as well as by bold ⁄ blue underlined characters
in the sequence. The consensus site for calpain 3 cleavage and the positions of the three imperfect cleavage sequences identified in CARP
are shown at the bottom. The truncated constructs (DNter1-4 and NterCARP) are shown below the CARP structure and the calpain 3 cleav-
age site is indicated by an arrow. (D) Western blot analysis performed on NIH3T3 extracts over-expressing either the full-length or the trun-
cated CARP constructs (DNter1–4). The molecular weight of DNter2 matches the lower band detected when CARP is co-expressed with
calpain 3 (37 kDa band; compare the first and the fourth lane). (E) Western blot analysis performed on NIH3T3 extracts over-expressing
CARP or the truncated DNter1 or DNter2 CARP constructs, in the presence or absence of calpain 3. DNter1 is cleaved when co-expressed
with calpain 3, whereas DNter2 is not.
Regulation of CARP by calpain 3 L. Laure et al.
(Fig. 2C, lower panel). This undefined localization,
taken together with the absence of physiologically rele-
vant protein domains in this region, suggests that this
fragment is probably devoid of biological activity.
To further investigate the possibility of translocation
in between various cell compartments, the strength of
the interaction between CARP and the muscle sarco-
mere was assessed in vitro using a two-hybrid assay and
in vivo using fluorescence recovery after photobleaching
(FRAP). Two-hybrid experiments were carried out
between yeast competent cells transformed either with
pAS-N2A-titin fused with GAL4-binding domain or
pGAD-CARP or DNter2 fused with GAL4-activation
domain. The growth of the clones is more important
when titin-N2A is expressed with DNter2, suggesting
that the weak interaction detected between CARP and
titin-N2A is reinforced after CARP cleavage (Fig. 2D).
FRAP analysis is commonly used to quantify the
mobility of a fluorescent molecule in a cell compart-
ment of interest [48]. FRAP experiments were carried
out after injection of pYFP-CARP-CFP-HIS, pYFP-
DNter2-CFP-HIS or pYFP-Nter-CFP-HIS in the TA
of 129SvPasIco mice. The fluorescence recovery speed
observed in the presence of the Nter protein is so rapid
that we could not even bleach a region of interest
(ROI) efficiently, impeding FRAP measurement (data
not shown). This result suggests that the short N-ter-
minal CARP fragment is freed from the sarcomere,
which is consistent with the results obtained by direct
localization of the fluorescence and with the fact that
using homologous recombination (Figs S1 and S2 and
Doc. S1). Although a weak quantity of calpain 3
mutated mRNA is still expressed (< 20% of the wild-
type level) (Fig. S1B), western blot analysis confirmed
the complete knockout of the protein in this murine
model (Fig. S1C). CARP subcellular localization and
mobility were assessed after injection of a plasmid
encoding pYFP-CARP-CFP-HIS in the TA muscles of
C3-null and 129SvPasIco strains. Since CARP will not
be processed by calpain 3 in C3 deficient animals and
will only be slightly processed in wild-type animals,
the full-length CARP protein is therefore the main
YFP-tagged protein present in both cases. With
respect to CARP localization, no significant difference
was noted: in both models, CARP is localized in the
nucleus, as well as on the fiber sarcomere, easily recog-
nizable by the striated pattern of the fluorescence
(Fig. 3A). In FRAP experiments (Fig. 3B), the fluores-
cence recovery speed is significantly slower in wild-
type muscles than in calpain 3 deficient muscles
(Fig. 3C), suggesting that the interaction between
CARP and titin is reinforced in the presence of cal-
pain 3. These results suggest that the calpain 3-medi-
ated cleavage of some molecules of CARP reinforces
the interaction of other unprocessed CARP molecules
with the sarcomere.
Taken together, the results obtained in the present
study appear to corroborate that, once cleaved by cal-
pain 3, the C-terminal part of CARP, as well as
unprocessed CARP molecules, bind more efficiently to
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4327
whose DNA-binding activity is slightly elevated in the
presence of CARP (on one out of the two consensus
sequences considered), all the other transcription fac-
tors are inhibited (Fig. 4A). The 32 factors most signif-
icantly inhibited (cut-off ratio CARP⁄ lacZ < 0.5) are
presented schematically in Fig. S3. Although its inhibi-
tion does not reach this level with this quantification
method, the activity of the transcription factor NF-jB,
as measured with three different consensus sequences,
is consistently repressed. This transcription factor
appeared to be particularly interesting considering that
it was previously described as having a role in muscle
atrophy [50] and is abnormally distributed subsequent
to calpain 3 deficiency [8].
Using a quantitative ELISA-based method, we con-
firmed that, when CARP is significantly over-expressed
by two-fold, NF-jB p65 transcriptional activity is sig-
nificantly decreased two-fold (P < 0.05; Fig. 4B).
Using the quantification of its messenger level on
RNA extracts of the same cells, we confirmed that this
transcription factor is not transcriptionally regulated
(Fig. 4C) and concluded that its nuclear translocation
or its activity is modulated by CARP. We also
performed real-time quantitative RT-PCR (qRT-PCR)
of MuRF1, an E3 ubiquitin ligase whose transcription
is up-regulated through NF-jB activation in atrophic
muscle fibers [51–53]. Interestingly, MuRF1 expression
remains constant in this experiment, strongly suggest-
hypothesis.
The results obtained in the present study strongly
suggest that, once cleaved, CARP interaction with the
region N2A is reinforced. CARP interacts with titin-
N2A using a region situated in its second ankyrin
repeat (Fig. 1B) [18]. Bio-informatics analysis indicated
that this region remains structurally unaffected by the
cleavage, whereas the coiled-coil region appears to be
destructed (for methodology, see Materials and meth-
ods). In addition to carrying NLS, this region was
previously proposed to be involved in the homodi-
merization of CARP [49]. We therefore propose that
the loss of CARP dimerization promotes the binding to
titin by improving the accessibility of the titin-binding
domain. Interestingly, the importance of CARP inter-
action for its function was recently demonstrated in a
Fig. 3. Calpain 3 produces a reinforcement of CARP interaction
with titin. (A) CARP localization after electrotransfer of YFP tagged
CARP in TA muscles from wild-type (left) and C3-null (right) mice.
In both models, CARP is localized in the nucleus and on the sarco-
mere of the fibers. Scale bars = 20 lm. (B) Quantification of FRAP
experiments. FRAP was measured for several ROI after photoble-
aching at 514 nm in TA muscles from wild-type and C3-null mice
transduced with YFP-tagged CARP. The fluorescence recovery
speed is slower in muscles of animals bearing functional calpain 3
(**P < 0.01, n = 10).
Regulation of CARP by calpain 3 L. Laure et al.
4328 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
pathophysiological context since pathogenic mutations
result in the loss of CARP binding to talin and FHL2
tion through nuclear translocation inhibition,
combining the destruction of an NLS with an increase
in the affinity of the targeted gene regulator for one of
its partners.
The sarcomeric sequestration consecutive to calpain
3 activation might, as a consequence, control CARP-
dependent gene expression. Indeed, MARPs are con-
sidered to be involved in gene transcription because (a)
Ankrd2 localizes in euchromatin, the region of chro-
matin where active gene transcription occurs [59], is
able to bind to three transcription factors, YB-1, PML
and p53, and enhances the up-regulation of the
p21(WAFI ⁄ CIPI) promoter by p53 [17] and (b) CARP
can bind to DNA [19] and is a negative regulator of
the transcription factor YB1 in the heart [21]. Interest-
ingly, calpain 3 was also reported to participate in the
control of gene expression [2,7–9], suggesting that the
complex calpain 3 ⁄ CARP might comprise an axis for
gene regulation. Amongst the possible CARP targets
identified in the present study, NF-jB p65 DNA bind-
ing activity was confirmed to be inhibited by CARP
over-expression. Interestingly, we previously demon-
strated that calpain 3 possibly participates in the
control of the NF-jB pathway because calpain 3
deficiency is associated with an altered distribution of
both NF-jB and of its regulator IjBa [8], as well as
with blockade of the induction of specific anti-apopto-
tic NF-jB target genes such as c-FLIP [9]. From a
mechanistic point of view, it could be postulated that a
direct interaction between CARP ankyrin repeats and
tion in mice models invariably protects against muscle
atrophy, whereas NF-jB activation promotes proteoly-
sis in vivo [51,64–66]. However, in our hands, although
the over-expression of CARP in muscle cells results in
NF-jB p65 inhibition, it does not affect the expression
of MURF1, which is one of the main mediators of
NF-jB-dependent muscle atrophy [51]. It was also pre-
viously suggested that p65 is not the member of the
NF-jB family involved in the induction of atrophy
[64]. Taken together, CARP-dependent NF-jB inhibi-
tion therefore appears unlikely to play a role in muscle
atrophy. On the other hand, several studies have sug-
gested a possible involvement of NF-jB in muscle cell
survival through induction of anti-apoptotic factors
[8,9,67]. Calpain 3 deficiency was previously reported
to be associated with a deregulation of the NF-jB
pathway and an increase in muscle fiber apoptosis [8].
The participation of NF-jB signaling in the pathogen-
esis of LGMD2A is therefore an interesting possibility.
The findings obtained in the present study lead to a
proposed working hypothesis: in the absence of calpain
3, CARP nuclear activities would be exacerbated,
which would lead to a decrease in NF-jB activity
(Fig. S4). NF-jB inhibition would impede the protec-
tion of muscle from apoptosis, an event leading to
progressive muscle destruction. In line with this
hypothesis, CARP ectopic expression was previously
reported to be able to induce apoptotic cell death in
hepatoma cells [62]. In conclusion, calpain 3, through
its action on CARP, appears to have a central role in
from a random primed cDNA library obtained by reverse
transcription of an adult human skeletal muscles poly(A)
RNA library (Ambion AM7983; Ambion, Austin, TX,
USA). The PCR product was digested by XmaI and NcoI
and cloned in fusion with the GAL4 DNA-binding domain
in pAS. CARP and DNter2 cDNA were fused to GAL4
activation domain in pGAD. Briefly, CARP and DNter2
were PCR amplified with primers containing the restriction
sites NcoI in the 5¢ primer and XmaI in the 3¢ primer
(Table 1). The digested fragments were ligated in EcoRI ⁄
BamHI linearized pGAD. Every amplified sequence was
validated by automated sequencing.
Rabbit polyclonal antibody directed against the epitope
QESEEQQQFRNIFKQ in exon 17 of the calpain 3 (B3)
was kindly provided by Dr Ahmed Ouali (INRA UR 370,
Saint Genes Champanelle, France) and has been described
previously [8]. NF-jB-specific rabbit polyclonal antibody
was obtained from Chemicon. Mouse monoclonal antibody
specific for the V5 epitope was purchased from Invitrogen.
Horseradish peroxidase linked donkey anti-rabbit IgG and
sheep anti-mouse IgG antibodies were obtained from GE
Healthcare (Piscataway, NJ, USA).
Cell culture and transfection
The NIH3T3 cell line was obtained from the American
Type Culture Collection (Rockville, MD, USA) and the C2
mouse myoblasts from the ATCC [69]. Fibroblasts and
myoblasts were cultured in DMEM containing gentamicin
(10 lgÆmL
)1
) and supplemented with 10% or 20% fetal
The muscle proteins of the different sub-cellular compart-
ments were extracted using the ProteoExtract
Ò
Subcellular
Proteome Extraction Kit (S-PEK; Calbiochem
Ò
Merck
KGaA, Darmstadt, Germany). Briefly, TA muscles were
homogenized in 1 mL of lysis buffer with a Fast-Prep instru-
ment (MP-Biomedicals, Solon, OH, USA), and proteins of
the cytosol, membranes, nucleus and cytoskeleton were
extracted in accordance with the manufacturer’s instructions.
The samples were denatured before SDS ⁄ PAGE using
LDS NuPage buffer (Invitrogen) supplemented with 100 mm
dithiothreitol. Sample protein concentrations were deter-
mined by the BCA methodology (Thermo Scientific, Rock-
ford, IL, USA). Protein samples were submitted to
SDS ⁄ PAGE in precast 4–12% acrylamide gradient gels (Nu-
Table 1. Primers used for cloning.
Plasmid Insert
Upper primer
Lower primer
pGAD-CARP Full-length
CARP
CGCCATGGCAATGATGGTACTGAAAGTAGAGG
CGGCCCGGGAACTGATTAAGAGTCTGTCG
pGAD-DNter2 CARP from
71 to 319
GAGCCATGGAACAACGGAAAAGCGAGAAAC
CGGCCCGGGAACTGATTAAGAGTCTGTCG
dene difluoride) membranes (Millipore, Billerica, MA, USA)
by the appliance of an electric field (100 V for 1 h). The
transfer efficiency was evaluated by Ponceau red protein
staining (0.2%, w ⁄ v, in 5% acetic acid). The membranes were
probed with antibodies against calpain 3 (dilution 1 : 150),
green fluorescent protein (GFP) (dilution 1 : 5000), NF-jB
p65 (dilution 1 : 4000) or V5 epitope (dilution 1 : 5000). For
calpain 3 and V5 specific western blot, detection was
performed with secondary antibodies (dilution 1 : 10 000)
coupled to horseradish peroxidase and revelation was rea-
lised with the SuperSignal West Pico substrate (Pierce). For
GFP and NF-jB-specific western blot, detection was carried
out with a secondary antibody coupled to IRDye 680
(Li-Cor, Lincoln, NE, USA; dilution 1 : 10 000) and the
membranes were exposed to the Odyssey infrared imaging
system (Li-Cor) for detection of the signal.
RNA extraction and real-time qRT-PCR
Total RNA were isolated from mouse cells using Trizol
reagent (Gibco). cDNA were synthesized from 1 lg of total
RNA using the SuperScript first strand synthesis system for
RT-PCR kit (Invitrogen) and random oligonucleotides.
Expression of calpain 3, CARP, NF-jB and MuRF1 genes
was monitored by a qRT-PCR method using TaqMan
probes (Perkin Elmer, Waltham, MA, USA) and a 7900
HT fast RT-PCR machine (Applied Biosystems, Carlsbad,
CA, USA). The ubiquitous acidic ribosomal phosphopro-
tein (P0) was used to normalize the data across samples. P0
expression was monitored by SYBRGreen incorporation.
The primer pairs and TaqMan probes used for amplifica-
tion are indicated in Table 2. Each experiment was per-
100 mm dishes of 1 · 10
6
C2 myogenic cells were prepared
for each condition. They were transfected with pcDNA3-
CARP or with a mock plasmid (pcDNA3-lacZ) and differ-
entiated into myotubes for 7–10 days. Nuclear extracts
from CARP-expressing and control C2 myotubes were pre-
pared using a Nuclear Extraction Kit (Active Motif) in
accordance with the manufacturer’s instructions. Either 1.5
or 40 lg of nuclear extract were used for NF-jB p65 and
RelB activity assay, respectively. The transcription factor
activity was measured at 450 nm using a spectrophotometer.
Table 2. Primers and probes sets used for qRT-PCR of mouse genes.
Acronym Name Accession number
Upper primer
Probe
Lower primer
C3 Calpain 3 NM_007601.3 mC3.F ACAACAATCAGCTGGTTTTCACC
mC3.P TGCCAAGCTCCATGGCTCCTATGAAG
mC3.R CAAAAAACTCTGTCACCCCTCC
CARP Ankyrin repeat domain 1 NM_013468 mCARP.F CTTGAATCCACAGCCATCCA
mCARP.P CATGTCGTGGAGGAAACGCAGATGTC
mCARP.R TGGCACTGATTTTGGCTCCT
NF-jB p65 Reticuloendotheliosis viral oncogene
homolog A (Rela)
NM_009045 mp65NFjB.F GGCGGCACGTTTTACTCTTT
mp65NFjB.P CGCTTTCGGAGGTGCTTTCGCAG
mp65NFjB.R TCAGAGTTCCCTACCGAAGCAG
MurF1 Tripartite motif-containing 63 (Trim63), NM_001039048 mMurf1.F AGGGCCATTGACTTTGGGAC
mMurf1.P AGGAGG AGTTTACAGAAGAGGAGGCTGATGAG
accordance with Genethon ethical committee.
Endotoxin-free plasmids were prepared with the Endo-
Free Megaprep kit (Qiagen, Valencia, CA, USA). In total,
50 lg of plasmid were injected into the TA muscles of wild-
type (129svPasIco) or C3-null mice (18–32 weeks old).
Immediately after injection, transcutaneous electric pulses
were applied through two stainless steel plate electrodes
placed on each side of the hind limb. Eight square-wave
electric pulses were generated by an ECM-830 electropulsa-
tor (BTX, Holliston, MA, USA) with an output voltage of
200 VÆcm
)1
, a pulse length of 20 ms, and a frequency of
pulse delivery of 2 Hz. For monitoring of fluorescence,
7 days after injection, mice were anaesthetized with intra-
peritoneal injections of ketamine ⁄ xylazine (at a concentra-
tion of 100 and 10 mgÆkg
)1
, respectively), the skin
surrounding the TA was dissected, a glass cover-slide was
positioned on the exposed muscle and the fluorescence was
observed using a confocal microscope (DM-IRBE; Leica
Microsystems, Bannockburn, IL, USA) and a laser excita-
tion wavelength of 514 nm for YFP detection.
FRAP experiments
FRAP experiments were performed by bleaching ROIs
across mouse TA fibers transduced 7 days previously with
YFP-tagged constructs. Ten iterations of photobleaching
were used at a laser set up of k = 514 nm and 100%
output. The prebleaching status, bleaching and fluorescence
were compared using the Mann–Whitney non parametric
test. P < 0.05 or P < 0.01 was considered statistically
significant.
Acknowledgements
We acknowledge the excellent technical expertise of
Ludovic Arandel, Thibaut Marais and Lae
¨
titia Van Wit-
tenberghe. We are very grateful to Dr Ahmed Ouali for
providing us with antibodies. This work was supported
by the ‘Association Franc¸ aise contre les Myopathies’.
References
1 Fardeau M, Eymard B, Mignard C, Tome FM, Richard
I & Beckmann JS (1996) Chromosome 15-linked
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4333
limb-girdle muscular dystrophy: clinical phenotypes in
Reunion Island and French metropolitan communities.
Neuromuscul Disord 6, 447–453.
2 Richard I, Broux O, Allamand V, Fougerousse F,
Chiannilkulchai N, Bourg N, Brenguier L, Devaud C,
Pasturaud P, Roudaut C et al. (1995) Mutations in the
proteolytic enzyme calpain 3 cause limb-girdle muscular
dystrophy type 2A. Cell 81, 27–40.
3 Taveau M, Bourg N, Sillon G, Roudaut C, Bartoli
M & Richard I (2003) Calpain 3 is activated through
autolysis within the active site and lyses sarcomeric
and sarcolemmal components. Mol Cell Biol 23,
9127–9135.
4 Guyon JR, Kudryashova E, Potts A, Dalkilic I, Brosius
muscular dystrophy type 2A. FASEB J 22, 1521–1529.
10 Duguez S, Bartoli M & Richard I (2006) Calpain 3: a
key regulator of the sarcomere? Febs J 273, 3427–3436.
11 Kramerova I, Kudryashova E, Tidball JG & Spencer
MJ (2004) Null mutation of calpain 3 (p94) in mice
causes abnormal sarcomere formation in vivo and
in vitro. Hum Mol Genet 13, 1373–1388.
12 Kramerova I, Kudryashova E, Venkatraman G &
Spencer MJ (2005) Calpain 3 participates in sarcomere
remodeling by acting upstream of the ubiquitin-protea-
some pathway. Hum Mol Genet 14, 2125–2134.
13 Baghdiguian S, Richard I, Martin M, Coopman P,
Beckmann JS, Mangeat P & Lefranc G (2001) Patho-
physiology of limb girdle muscular dystrophy type 2A:
hypothesis and new insights into the IkappaBal-
pha ⁄ NF-kappaB survival pathway in skeletal muscle.
J Mol Med 79, 254–261.
14 Sorimachi H, Kinbara K, Kimura S, Takahashi M,
Ishiura S, Sasagawa N, Sorimachi N, Shimada H,
Tagawa K, Maruyama K et al. (1995) Muscle-specific
calpain, p94, responsible for limb girdle muscular
dystrophy type 2A, associates with connectin through
IS2, a p94-specific sequence. J Biol Chem 270, 31158–
31162.
15 Kinbara K, Sorimachi H, Ishiura S & Suzuki K (1997)
Muscle-specific calpain, p94, interacts with the extreme
C-terminal region of connectin, a unique region flanked
by two immunoglobulin C2 motifs.
Arch Biochem Bio-
phys 342, 99–107.
human ankyrin-repeated protein homologous to CARP.
Biochem Biophys Res Commun 285, 715–723.
23 Pallavicini A, Kojic S, Bean C, Vainzof M, Salamon M,
Ievolella C, Bortoletto G, Pacchioni B, Zatz M,
Lanfranchi G et al. (2001) Characterization of human
skeletal muscle Ankrd2. Biochem Biophys Res Commun
285, 378–386.
Regulation of CARP by calpain 3 L. Laure et al.
4334 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
24 Kemp TJ, Sadusky TJ, Saltisi F, Carey N, Moss J,
Yang SY, Sassoon DA, Goldspink G & Coulton GR
(2000) Identification of Ankrd2, a novel skeletal muscle
gene coding for a stretch-responsive ankyrin-repeat
protein. Genomics 66, 229–241.
25 Tsukamoto Y, Senda T, Nakano T, Nakada C, Hida T,
Ishiguro N, Kondo G, Baba T, Sato K, Osaki M et al.
(2002) Arpp, a new homolog of carp, is preferentially
expressed in type 1 skeletal muscle fibers and is
markedly induced by denervation. Lab Invest 82,
645–655.
26 Baumeister A, Arber S & Caroni P (1997) Accumula-
tion of muscle ankyrin repeat protein transcript reveals
local activation of primary myotube endcompartments
during muscle morphogenesis. J Cell Biol 139, 1231–
1242.
27 Boengler K, Pipp F, Fernandez B, Ziegelhoeffer T,
Schaper W & Deindl E (2003) Arteriogenesis is
associated with an induction of the cardiac ankyrin
repeat protein (carp). Cardiovasc Res 59, 573–
581.
mouse hearts overexpressing calsequestrin. Cell Calcium
32, 21–29.
34 Zolk O, Frohme M, Maurer A, Kluxen FW, Hentsch
B, Zubakov D, Hoheisel JD, Zucker IH, Pepe S &
Eschenhagen T (2002) Cardiac ankyrin repeat protein,
a negative regulator of cardiac gene expression, is
augmented in human heart failure. Biochem Biophys
Res Commun 293, 1377–1382.
35 Barash IA, Mathew L, Ryan AF, Chen J & Lieber
RL (2004) Rapid muscle-specific gene expression
changes after a single bout of eccentric contractions
in the mouse. Am J Physiol Cell Physiol 286, C355–
C364.
36 Carson JA, Nettleton D & Reecy JM (2002) Differential
gene expression in the rat soleus muscle during early
work overload-induced hypertrophy. FASEB J 16, 207–
209.
37 Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman
EP & Esser KA (2002) Response of rat muscle to acute
resistance exercise defined by transcriptional and trans-
lational profiling. J Physiol 545, 27–41.
38 Hentzen E, Lahey M, Peters D, Mathew L, Barash I,
Friden J & Lieber R (2006) Stress-Dependent And
Stress-Independent Expression Of The Myogenic Regu-
latory Factors And The Marp Genes After Eccentric
Contractions. J Physiol 570
, 157–167.
39 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A
web-accessible complete transcriptome of normal
human and DMD muscle. Neuromuscul Disord 12(Suppl
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4335
muscle-specific calpain, and characterization of its
autolysis. Biochem J 335 (Pt 3), 589–596.
46 Daniele N, Richard I & Bartoli M (2007) Ins and outs
of therapy in limb girdle muscular dystrophies. Int J Bio-
chem Cell Biol 39, 1608–1624.
47 de Morree A, Lutje Hulsik D, Impagliazzo A, van
Haagen HHHBM, de Galan P, van Remoortere A, ‘t
Hoen PAC, van Ommen GB, Frants RR & van der
Maarel SM (2010) Calpain 3 is a rapid-action, unidirec-
tional proteolytic switch central to muscle remodeling.
PLoS ONE 5, e11940.
48 Reits EA & Neefjes JJ (2001) From fixed to FRAP:
measuring protein mobility and activity in living cells.
Nat Cell Biol 3, E145–E147.
49 Witt SH, Labeit D, Granzier H, Labeit S & Witt CC
(2005) Dimerization of the cardiac ankyrin protein
CARP: implications for MARP titin-based signaling.
J Muscle Res Cell Motil 26, 401–408.
50 Jackman RW & Kandarian SC (2004) The molecular
basis of skeletal muscle atrophy. Am J Physiol Cell
Physiol 287, C834–C843.
51 Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh
BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J,
Glass DJ et al. (2004) IKKbeta ⁄ NF-kappaB activation
causes severe muscle wasting in mice. Cell 119, 285–
298.
52 Glass DJ (2005) Skeletal muscle hypertrophy and atro-
phy signaling pathways. Int J Biochem Cell Biol 37 ,
60 Inoue J, Kerr LD, Rashid D, Davis N, Bose HR Jr
& Verma IM (1992) Direct association of pp40 ⁄ I
kappa B beta with rel ⁄ NF-kappa B transcription
factors: role of ankyrin repeats in the inhibition of
DNA binding activity. Proc Natl Acad Sci USA 89,
4333–4337.
61 Perkins ND (2006) Post-translational modifications reg-
ulating the activity and function of the nuclear factor
kappa B pathway. Oncogene 25, 6717–6730.
62 Park JH, Liu L, Kim IH, Kim JH, You KR & Kim
DG (2005) Identification of the genes involved in
enhanced fenretinide-induced apoptosis by par-
thenolide in human hepatoma cells. Cancer Res 65,
2804–2814.
63 Mohamed JS, Lopez MA, Cox GA & Boriek AM
(2010) Anisotropic regulation of Ankrd2 gene expres-
sion in skeletal muscle by mechanical stretch. FASEB J
24, 3330–3340.
64 Hunter RB, Stevenson E, Koncarevic A, Mitchell-
Felton H, Essig DA & Kandarian SC (2002)
Activation of an alternative NF-kappaB pathway in
skeletal muscle during disuse atrophy. FASEB J 16,
529–538.
65 Judge AR, Koncarevic A, Hunter RB, Liou HC, Jack-
man RW & Kandarian SC (2007) Role for IkappaBal-
pha, but not c-Rel, in skeletal muscle atrophy. Am J
Physiol Cell Physiol 292, C372–C382.
66 Mourkioti F, Kratsios P, Luedde T, Song YH,
Delafontaine P, Adami R, Parente V, Bottinelli R,
Pasparakis M & Rosenthal N (2006) Targeted
weakness).
Fig. S3. CARP expression inhibits the DNA-binding
activities of 32 transcription factors.
Fig. S4. Calpain 3-mediated cleavage of CARP reduces
its effects on transcription factors.
Doc S1. Construction and characterization of the cal-
pain 3 deficient animal model.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4337