Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc - Pdf 10

The miRNA-192

194 cluster regulates the Period gene
family and the circadian clock
Remco Nagel
1
, Linda Clijsters
1
and Reuven Agami
1,2
1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands
2 Center for Biomedical Genetics, The Netherlands
Introduction
Daily oscillations of physiological and behavioural
processes can be observed in diverse organisms, rang-
ing from the filamentous fungus Neurospora crassa to
humans. The oscillating rhythms are driven by an
internal timing mechanism called the circadian clock.
In mammals, the circadian system is organized as a
hierarchical network of molecular clocks that operate
in different tissues, with the master clock residing in
the suprachiasmatic nucleus (SCN) in the hypothala-
mus. The master clock itself is synchronized by means
of external cues from the daily light ⁄ dark cycles, and
transmits information regarding its phase to multiple
tissue-specific clocks [1]. The molecular machinery
underlying the circadian rhythm, which is present in
each individual cell, is thought to be composed of self-
sustaining transcriptional feedback loops. The core of
the molecular pathway regulating circadian oscillations
is the CLOCK ⁄ BMAL1 complex [2,3]. This hetero-

(Received 17 June 2009, revised 15 July
2009, accepted 22 July 2009)
doi:10.1111/j.1742-4658.2009.07229.x
Several biological functions in mammals are regulated in a circadian fash-
ion. The molecular mechanisms orchestrating these circadian rhythms have
been unravelled. The biological clock, with its core transcriptional unit
Bmal1 ⁄ CLOCK, is composed of several self-sustaining feedback loops. In
this study, we describe another mechanism impinging on the core compo-
nents of the circadian clock. Using a forward genetic screen, we identified
the miR-192 ⁄ 194 cluster as a potent inhibitor of the entire Period gene
family. In accordance, the exogenous expression of miR-192 ⁄ 194 leads to
an altered circadian rhythm. Thus, our results have uncovered a new mech-
anism for the control of the circadian clock at the post-transcriptional
level.
Abbreviations
CCG, clock-controlled gene; Cry, Cryptochrome; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein;
miRNA, microRNA; Per, Period; SCN, suprachiasmatic nucleus.
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5447
are of major importance in the control of the circadian
clock. The phosphorylation and degradation of Per
proteins have been suggested to control timing of the
mammalian clock [8]. Moreover, BMAL1 and Cry
proteins are subject to phosphorylation, SUMOylation
and proteasomal degradation, thereby controlling their
activity at the post-transcriptional level [9–11].
Recently, a new class of post-transcriptional regula-
tors, called microRNAs (miRNAs), has been shown to
possess regulatory functions towards the circadian
clock. miRNAs are single-stranded, nonprotein-coding
RNA molecules, approximately 19–25 nucleotides in

single clones with a defined level of GFP expression
were isolated. The constructed cell lines were subse-
quently transduced with a microRNA expression
library (miR-Lib; [13]) in a single-well format, drug
selected and pooled. To identify possible regulatory
miRNAs towards the inserted 3¢UTRs, the three pools
of cells containing one unique GFP reporter were fluo-
rescence-activated cell sorted on their GFP expression
levels. The relative abundance of miRNA inserts
between the low-GFP-expressing population and the
total population was measured by a barcode-type anal-
ysis using our miRNA arrays. We observed in the
resulting M–A plots that only a few miRNAs were
reproducibly enriched in the low-GFP-expressing pop-
ulation (Fig. 1A–C). The most striking observation
was that the most highly enriched miRNA expression
vector (miR-Vec) for all three individual 3¢UTRs
was the vector encoding the miR-192 ⁄ 194 cluster
(Fig. 1A–F).
To confirm that the obtained hits from the GFP
UTR screens indeed have regulatory capacities against
the 3¢UTR of the Per genes, we retested their effects
on the original HeLa cell line expressing the GFP sen-
sor constructs. We observed that miR-192 ⁄ 194 inhib-
ited GFP expression of all the sensor constructs,
whereas all the other obtained hits could not signifi-
cantly downregulate any of the GFP-Per sensors
(Fig. 2A–C and data not shown). To exclude the possi-
bility that miR-192 ⁄ 194 regulates a common sequence
in the GFP sensor construct, we subcloned the 3¢UTR

tumours [16], we attempted to exploit these cells to
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5448 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS
determine the endogenous role of miR-192 ⁄ 194. The
examination of 12 colorectal cell lines indicated a het-
erogeneous level of miR-192 ⁄ 194, ranging from very
low in HCT116, Colo320 and SW48 cells, to high in
LOVO, HT29 and LS174T cells (Fig. S1, see Support-
ing information). We made use of the different Per
luciferase 3¢UTR constructs to detect miR-192 ⁄ 194
activity. In transient transfection assays with these con-
structs containing wild-type and mutant Per 3¢UTRs,
we observed reduced expression of all three wild-type
3¢UTRs only in cell lines with strong expression of
endogenous miR-192 ⁄ 194 (LOVO, HT29, Fig. 4A). In
HCT116 cells, which do not express miR-192 ⁄ 194, no
such difference between wild-type and mutant 3¢UTRs
was observed. This result indicates that miR-192 ⁄ 194
expression is a prominent determinant for Per 3¢UTR
regulation in these cells. To explore this further, we
transfected anti-miR RNA oligos targeting miR-
192 ⁄ 194 or a control miRNA, miRNA-372. Whereas
the transfection of anti-miR-192 ⁄ 194 completely abol-
ished the miR-192 ⁄ 194-dependent regulation of Per1
3¢UTR in HT29 cells, transfection of the control anti-
miR left it intact (Fig. 4B). Together, these results
show that endogenously expressed miR-192 ⁄ 194 also
suppresses the synthesis of Per proteins.
miR-192


Per2 and Per3 3¢UTRs, respectively.
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5449
Subsequently, we made use of the engineered
NIH3T3 cells expressing miR-192 ⁄ 194 to determine
the effects on the circadian cycle by monitoring
BMAL1 mRNA levels. As described previously, levels
of BMAL1 mRNA oscillate in a circadian fashion in
time following serum shock. Examination of BMAL1
mRNA oscillation over a time course of 64 h revealed
A
B
C
D
*
*
*
Fig. 2. Validation of the effect of miR-192 ⁄ 4 on the Per 3¢UTRs.
(A–C) Verification of the effect of miR-192 ⁄ 194 on GFP expression in
HeLa-GFP-UTR constructs of Per1, Per2 and Per3 3¢UTRs, res-
pectively. Graphs depicting the GFP expression of the control and
miR-Vec-192 ⁄ 4 are shown in different colours. (D) Luciferase assay
showing the effect of miR-192 ⁄ 194 expression on luciferase con-
structs coupled to the Per 3¢UTRs. Values represent a triplicate
assay, in which the data are represented as the standardized
mean ± standard error of the mean (SEM). *Significant difference
when compared with the control (P < 0.01), as determined by a two-
tailed t-test. All experiments are representative of a triplicate repeat.
*
*

nents of the circadian clock. Strikingly, exogenous
overexpression of miR-192 ⁄ 194 leads to an altered
circadian cycle.
miRNAs and the circadian clock
Since the discovery of the molecular mechanism regu-
lating circadian rhythms, it has been recognized that
tight transcriptional control is essential for correct cir-
cadian cycling [17]. Recently, post-transcriptional
events have also been implicated in the control of the
circadian clock [8–11]. Not surprisingly, miRNAs have
also been shown to possess regulatory capacities on
the circadian rhythm [12]. It has been suggested that
miR-219 and miR-132 are capable of shortening the
circadian period and negatively regulating the light-
dependent resetting of the clock, respectively [12].
However, amongst the target genes suggested for these
two miRNAs, which are regulated in a circadian fash-
ion, no core components of the circadian clock were
found. This suggests that these miRNAs affect the cir-
cadian clock via indirect mechanisms. The identifica-
tion of the miR-192 ⁄ 194 cluster as a potent regulator
of the Per gene family, however, shows that the core
clock proteins are also under post-transcriptional
control exerted by miRNAs.
miRNAs and the circadian cycle
miR-219 is capable of shortening the circadian period
by 10–20 min [12]. The exact mechanism by which
this miRNA is able to alter the circadian period,
however, still remains to be examined. In addition to
this, the data presented here show that miR-192 ⁄ 194

192 ⁄ 194 in cells endogenously expressing this miRNA cluster
(HT29) in comparison with control cells. Values represent a tripli-
cate assay, in which the data are represented as the standardized
mean ± SEM.
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5451
Regulation of the miR-192

194 cluster
It has been reported that miRNA-192 and miR-194
can be induced by several factors, such as hepatocyte
nuclear factor-1a and p53 [21–23]. This suggests that
different cellular processes might affect the circadian
clock, for example genotoxic stresses that activate p53.
It has been proposed that the expression of most
CCGs peaks just before dawn and appears to prepare
for the stress caused by daily sun exposure [24]. Specu-
lating on this, the induction of miR-192 ⁄ 194 by acti-
vated p53 might be a means for cells to adjust the
circadian time to the level of radiation they encounter.
The observation that miR-192 and miR-194 are both
highly expressed in liver and kidney implies that these
miRNAs play a role in both of these tissues [25,26].
Interestingly, both of these tissues have been suggested
to be the only ones that are able to maintain circadian
rhythms of clock gene expression in the absence of a
functional SCN [27]. Therefore, it would be interesting
to determine the exact role of miR-192 ⁄ 194 in these
tissues. Together, the identification of inhibitory
miRNAs for the Per genes adds more complexity to

points.
Constructs
GFP-Per1-3¢UTR, GFP-Per2-3¢UTR and GFP-Per3-3¢UTR
were constructed by cloning the 3¢UTR of the respective
Per genes between Eco RI and BamHI restriction sites of
the GFP sensor vector, as described in [13]. The 3¢UTRs of
Per1, 2 and 3 were amplified from genomic DNA using the
following primers: Per1 forw, GAATTCTTAAACTCC
ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT
TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC
AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA
TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw,
GAATTCTTAAGTGACTGTGAGGATGAACCTTC; Per3
rev, GGATCCTCACGTTTTACATGTACAGAGTTTA.
Luc-Per1-3¢UTR, Luc-Per2-3¢UTR and Luc-Per3-3¢UTR
were produced by subcloning of the 3¢UTR of Per into the
pGL3 vector (Promega) downstream of the luciferase gene
by means of PCR. The primers used for this PCR were as
follows: Per1 forw, GCGACGTCTTAAACTCCATTC
TGGGACCATCTCC; Per1 rev, GCACCGGTGGCGTTT
TTATCTTTTTGTATT; Per2 forw, GCGACGTCTTAAC
AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GCAC
CGGTGGCAAACAGGTCATAAAAAGACAC; Per3 fo-
rw, GCGACGTCTTAAGTGACTGTGAGGATGAAC
CTTC; Per3 rev, GCACCGGTTCACGTTTTACATGTA
CAGAGTTTA. Mutants of the Per 3¢UTR luciferase
reporters were constructed using the QuickChangeÒ Multi
Site-Directed Mutagenesis Kit (Stratagene), according to
the manufacturer’s protocol. Luc-Per1-3¢UTR-Mut was cre-
ated using the following primer: GGCGTTTTTATCT

GACAGUCCACAUGGAGUUGCUGUUACACUUGA.
For these experiments, 10–20 ng of Luc-Per-3¢UTR (or
mutant constructs) and 2.5 ng of Renilla were used.
Flow cytometry
The separation of low-GFP-expressing miR-Lib-containing
cells was performed by cell sorting using the FACSAria cell
sorter from Becton Dickinson. The validation of miRNA
hits was performed as described previously, using HeLa
cells stably expressing GFP-Per-3¢UTR [13].
Quantitative RT-PCR and real-time TaqMan PCR
Total RNA was extracted from cell lines using TRIzol
reagent, according to the manufacturer’s protocol. The syn-
thesis of cDNA with Superscript III reverse transcriptase
(Invitrogen) was primed with random hexamers. The prim-
ers used for the detection of Bmal1 levels (Fwd,
GGCCGAATGATTGCTGAGGAAATCATGG; Rev,
TTACAGCGGCCATGGCAAGTCACTAAAG) and glyc-
eraldehyde-3-phosphate dehydrogenase (GAPDH) (Fwd,
CATCCACTGGTGCTGCCAAGGCTGT; Rev, ACAACC
TGGTCCTCAGTGTAGCCCA) were designed to amplify
100–200 bp fragments. Analyses were carried out using
SYBR Green PCR Master Mix (Applied Biosystems) and
the ABI Prism 7000 system (Amersham-Pharmacia). The
results were normalized with respect to GAPDH expres-
sion. The mRNA levels were quantified according to the
DDCt method.
TaqManÒ microRNA assays (Applied Biosystems),
which include RT primers and TaqMan probes, were
used to quantify the expression of mature miRNA-192
(AB: 4373108) and miRNA-194 (AB: 4373106). Gene

light responses in the suprachiasmatic circadian clock
and oscillating transcripts outside of brain. Neuron 20,
1103–1110.
7 Preitner N, Damiola F, Lopez-Molina L, Zakany J,
Duboule D, Albrecht U & Schibler U (2002) The
orphan nuclear receptor REV-ERBalpha controls
circadian transcription within the positive limb of the
mammalian circadian oscillator. Cell 110, 251–260.
8 Toh KL, Jones CR, He Y, Eide EJ, Hinz WA, Virshup
DM, Ptacek LJ & Fu YH (2001) An hPer2 phosphory-
lation site mutation in familial advanced sleep phase
syndrome. Science 291, 1040–1043.
9 Eide EJ, Vielhaber EL, Hinz WA & Virshup DM
(2002) The circadian regulatory proteins BMAL1 and
cryptochromes are substrates of casein kinase Iepsilon.
J Biol Chem 277, 17248–17254.
10 Siepka SM, Yoo SH, Park J, Song W, Kumar V, Hu
Y, Lee C & Takahashi JS (2007) Circadian mutant
Overtime reveals F-box protein FBXL3 regulation of
cryptochrome and period gene expression. Cell 129,
1011–1023.
11 Cardone L, Hirayama J, Giordano F, Tamaru T,
Palvimo JJ & Sassone-Corsi P (2005) Circadian clock
control by SUMOylation of BMAL1. Science 309,
1390–1394.
12 Cheng HY, Papp JW, Varlamova O, Dziema H, Russell
B, Curfman JP, Nakazawa T, Shimizu K, Okamura H,
Impey S et al. (2007) microRNA modulation of circa-
dian-clock period and entrainment. Neuron 54, 813–829.
13 le Sage C, Nagel R, Egan DA, Schrier M, Mesman E,

20 Shearman LP, Jin X, Lee C, Reppert SM & Weaver
DR (2000) Targeted disruption of the mPer3 gene: sub-
tle effects on circadian clock function. Mol Cell Biol 20,
6269–6275.
21 Hino K, Tsuchiya K, Fukao T, Kiga K, Okamoto R,
Kanai T & Watanabe M (2008) Inducible expression of
microRNA-194 is regulated by HNF-1alpha during
intestinal epithelial cell differentiation. RNA 14, 1433–
1442.
22 Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM,
Schepeler T, Orntoft TF, Andersen CL & Dobbelstein
M (2008) p53-Responsive microRNAs 192 and 215 are
capable of inducing cell cycle arrest. Cancer Res 68,
10094–10104.
23 Georges SA, Biery MC, Kim SY, Schelter JM, Guo J,
Chang AN, Jackson AL, Carleton MO, Linsley PS,
Cleary MA et al. (2008) Coordinated regulation of cell
cycle transcripts by p53-inducible microRNAs, miR-192
and miR-215. Cancer Res 68, 10105–10112.
24 Correa A, Lewis ZA, Greene AV, March IJ, Gomer
RH & Bell-Pedersen D (2003) Multiple oscillators regu-
late circadian gene expression in Neurospora. Proc Natl
Acad Sci USA 100, 13597–13602.
25 Sun Y, Koo S, White N, Peralta E, Esau C, Dean NM
& Perera RJ (2004) Development of a micro-array to
detect human and mouse microRNAs and characteriza-
tion of expression in human organs. Nucleic Acids Res
32, e188.
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5454 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status