Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress - Pdf 10

Identification of differentially expressed genes of the
Pacific oyster Crassostrea gigas exposed to prolonged
thermal stress
Anne-Leila Meistertzheim
1
, Arnaud Tanguy
2
, Dario Moraga
1
and Marie-The
´
re
`
se The
´
bault
1
1 Laboratoire des Sciences de l’Environnement Marin, Institut Universitaire Europe
´
an de la Mer, Universite
´
de Bretagne occidentale,
Plouzane
´
, France
2 Laboratoire Adaptation et Diversite
´
en Milieu Marin, Station Biologique, Roscoff, France
The fluctuating thermal nature of the marine environ-
ment induces physiological changes in ectotherms that
require molecular and gene expression adjustments [1].

Correspondence
M. T. The
´
bault, Laboratoire des Sciences
de l’Environnement Marin, UMR-CNRS
6539, Institut Universitaire Europe
´
en de la
Mer, Universite
´
de Bretagne Occidentale,
Place Nicolas Copernic, 29280 Plouzane
´
,
France
Fax: +33 2 98 49 86 45
Tel: +33 2 98 49 86 12
E-mail:
(Received 5 April 2007, revised 17 October
2007, accepted 19 October 2007)
doi:10.1111/j.1742-4658.2007.06156.x
Groups of oysters (Crassostrea gigas) were exposed to 25 °C for 24 days
(controls to 13 °C) to explore the biochemical and molecular pathways
affected by prolonged thermal stress. This temperature is 4 °C above the
summer seawater temperature encountered in western Brittany, France
where the animals were collected. Suppression subtractive hybridization
was used to identify specific up- and downregulated genes in gill and
mantle tissues after 7–10 and 24 days of exposure. The resulting libraries
contain 858 different sequences that potentially represent highly expressed
genes in thermally stressed oysters. Expression of 17 genes identified in

response of C. gigas to prolonged heat stress. We used
animals outside the season of reproductive develop-
ment and spawning in order to measure temperature
stress without the onset of reproduction. Using sup-
pression substractive hybridization (SSH), we identified
genes that were up- and downregulated 7–10 and
24 days after transfer from 13 to 25 °C. Subsequently,
genes likely to be associated with thermal stress were
quantified using quantitative real-time PCR.
Results
Suppression subtractive hybridization
SSH libraries were constructed from pooled gills and
mantle of C. gigas after 7–10 and 24 days of exposure
to different temperature treatments. The search for
homology using the blastx program revealed 858
different sequences, of which 536 ($ 62%) remain
unidentified. Expressed sequence tags (ESTs) similar to
genes potentially involved in a thermal response were
subsequently clustered into 15 distinct functional cate-
gories: cell differentiation (including cell migration,
adhesion, proliferation and apoptosis), cellular com-
munication (including signal transduction), cellular
stress (including inflammation and immune response),
cytoskeleton and cell structure (including cellular
matrix and cellular trafficking), detoxification, ener-
getic metabolism, lipid metabolism, receptors and
channels, regulation of nucleosides, nucleotides and
acid nucleic metabolism, reproduction, respiratory
chain, transcriptional processing, translational and
post-translational processing, general metabolism

(alternative name CCT) subunit 7, isoform b (chaper-
ones), inhibitor of kappa light polypeptide (inflamma-
tion); (c) antioxidant defense: non-selenium glutathione
peroxidase (EC 1.11.1.7); (d) metabolism of nitrogen
and ammonia detoxification: glutamine synthetase
(EC 1.4.1.13); (e) membrane fluidity: D9 desaturase
(EC 1.14.19.1); (f) energetic metabolism: d-lactate
dehydrogenase (d-LDH, EC 1.1.1.28, anaerobic metab-
olism), citrate synthase (EC 2.3.3.1, aerobic metabo-
lism); and (g) translational processing (translation
initiation factor eIF-2B delta subunit). Normalized
expression data are summarized in Table 1.
In the gills, all transcripts selected in the forward
SSH library at 25 °C, except citrate synthase, showed
an initial expression peak at days 3–7, followed by a
decrease at day 14, and then a smaller increase at days
17–24 at 25 °C compared with controls (13 °C)
(Fig. 2A and Table 1). The most differentially
expressed transcripts at 25 °C were HSPs, MTA-1 pro-
tein, chaperonin-containing TCP1 subunit 7, isoform b
and d-LDH. Gene expression was less pronounced in
mantle relative to the gills (Fig. 2). In the mantle, some
transcripts (HSP70, HSP23, MTA-1 protein, Rho1p,
A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas
FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6393
D9-desaturase and glutamine synthetase) showed a
peak of overexpression at days 14 and ⁄ or 17. In con-
trast to observations on gill tissue, mantle levels of
HSP12A, MTA-1 protein, Rho1p, D9-desaturase and
citrate synthase transcripts were significantly lower at

C. gigas responding to environmental stresses such as
hydrocarbons, pesticides and hypoxia [18–20]. Thus,
their gene products appear to be important for
Cell differentiation, migration, adhesion,
proliferation, apoptosis
Cellular communication, signal transduction
Cellular stress, inflammation, immune function
Cytoskeleton, structure, matrix and
cellular trafficking
Detoxification
Energetic metabolism
General metabolism, others functions
Lipid metabolism
Receptors and channel
Regulation of nucleoside, nucleotide
and nucleic acid metabolism
Reproduction
Respiratory chain
Transcriptional processing
Translational and post-translational
processing
Ribosomal proteins
A1 A2
B1 B2
3%
10%
9%
1%
5%
6%

8%
11%
3%
3%
14%
17%
28%
8%
5%
3%
Fig. 1. Functional classification of the sequences identified in SSH libraries which matched known genes corresponding to the 100% value.
SSH were made from pooled gills and mantle of C. gigas. Genes were clustered into 15 categories according to their putative biological
function. A1 and A2, 25 and 13 °C at 7–10 days; B1 and B2, 25 and 13 °C at 24 days.
Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al.
6394 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works
Relative expression
*
0
5
10
0
5
Heat shock protein 12A
10
0
5
10
Heat shock protein 23Heat shock protein 70
0
5

5
10
Metastasis associated
protein1
Ras family GTP-
binding protein Rholp
0
5
037141724
0
5
037141724
*
*
*
*
*
*
Chaperonin containing
TCP1, sub. 7
0
0
5
037141724
5
10
*
*
*
*

*
*
*
*
*
*
*
*
*
*
*
*
Exposure duration (days)
Exposure duration (days)
*
Citrate synthase
0
5
10
0
5
037141724
*
*
10
*
*
Huntingtin
interacting protein K
Inhibitor of kappa light

10
*
*
*
*
*
*
*
Non-selenium
glutathione peroxidase
10
Cathepsin L Cystatin B
0
5
0
5
10
0
5
10
15
0
5
0371417
24
0
5
03714
17
24

made using Student’s t-test. *Significant at the 5% level.
A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas
FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6395
metabolic adjustments during stress in general. How-
ever, the expression patterns observed were tissue spe-
cific with gills being more responsive than mantle. We
hypothesize that the observed patterns reflect func-
tional differences between these two tissues. A number
of genes that were highly expressed in gills showed
a biphasic expression pattern, consisting of a strong
short- and a moderate long-term response. Moreover,
after 7–10 days of exposure, we detected differential
expression of a number of genes that encode elements
of the transcription and translation machinery, includ-
ing transcription factors, ribosomal proteins and elon-
gation factors. After 24 days of exposure to elevated
temperature, the differential expression profile was
Table 1. Expression patterns in gills (G) and mantle (M) throughout the experiment at 25 versus 13 °C. For each gene, + (or –) represents
significant relative upregulation (or downregulation): + ⁄ ) from 1.2- to 2-fold; ++ ⁄ )) from 2- to 5-fold; +++ ⁄ )) from 5- to 10-fold; ++++
> 10-fold. NS, not significant. *P < 0.05, **P < 0.01, ***P < 0.001.
Days of exposure Tissue
3 7 14 17 24
G MG MGM GMGM
Cell proliferation and differentiation
MTA-1 + ++ NS NS NS +++ NS NS ++ NS
** * **
HYPK ++ ) + )) +++ ++ ++))
*** ** *** *** * *** *** *** *** ***
Ras family GTP-binding protein Rho1p ++ )) NS NS + ++ + + ++ NS
*** ** * ** ** ** ***

Membrane fluidity
Delta-9-desaturase +++ )) + NS NS ++ + +++ ++ NS
*** ** * ** ** *** ***
Energetic metabolism
Citrate synthase +++ )) ++ NS NS NS NS NS NS NS
*** ** ***
D-LDH +++ NS ++ NS NS NS ++ NS ++ NS
*** *** ** **
Translational processing
Translation initiation factor
eIF-2B delta subunit
+NSNSNSNS++++NS)) NS
*** ** ** **
Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al.
6396 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works
dominated by strong downregulation of genes involved
in protein synthesis, such as the translation initiation
factor eIF-2B delta subunit, suggesting a slowing of
protein synthesis. These findings may suggest that
transcription factors are regulated though a feedback
mechanism, inducing their own inactivation [21].
Changes in gene expression of organisms subjected to
thermal stress are known to involve major adjustments
in the expression of ribosomal genes and genes coding
for proteins involved in RNA metabolism and protein
synthesis. In fact, protein synthesis in marine snails
was inactivated at temperatures approaching lethal
values [22].
Under mild thermal stress at 25 °C, genes coding for
antistress proteins were differentially expressed. Protec-

one, located in the endoplasmic reticulum, plays an
important role in maintaining cell viability in response
to stress [28]. Among other chaperones, the chapero-
nin-containing TCP1 (subunit 7, isoform b) presented
the same expression pattern in response to heat stress
in our study. This complex, involved in folding actin,
tubulin and cyclin E, among other proteins [29], is also
upregulated in response to chemical stress [30]. Hence
TCP1 may play an important role in the recovery of
cells after protein damage, by assisting the folding of
cytoskeletal proteins that are actively synthesized
and ⁄ or renatured under these conditions. The upregu-
lation of all of these chaperones confirms the severity
of the thermal stress under our experimental condi-
tions.
A number of genes encoding structural components
of the cytoskeleton and proteins involved in contractile
functions (including actin, tubulin myosin and profilin)
were differentially expressed in C. gigas in response to
prolonged heat stress, some were induced and some
repressed. Rho1p, for example, encodes for a protein
involved in numerous processes including actin fila-
ment organization and is expressed in response to envi-
ronmental changes [31]. In this study, Rholp was
rapidly upregulated in gills and later in mantle during
warming. These results suggest that extensive cytoskel-
etal reorganization occurs in response to heat stress, as
reported for fish gills [3].
Furthermore, several genes associated with the regu-
lation of cell homeostasis were differentially expressed

and control of the balance between ATP supply and
A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas
FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6397
demand in the ciliated gill may become altered during
thermal stress. In C. gigas, stressors such as hydro-
carbons, herbicides, parasite infection or hypoxia
[18–20,35], affect the expression of genes involved in
energetic metabolism and our results show that
changes in transcript levels of a number of genes
involved in metabolic regulation also occur in response
to temperature. In gill tissue, prolonged heat stress
resulted in the rapid induction of several ATP-generat-
ing enzymes including the tricarboxylic acid cycle
citrate synthase, suggesting that there was a need for
rapid aerobic ATP production. In the early phase of
warming, the rapid induction of LDH in gills may
indicate that anaerobic metabolism is required. The
LDH that we identified was d-specific. Many system-
atic studies have shown that d-orl-specific LDHs are
present in all invertebrate groups [36]. We also
observed that the glutamine synthetase gene was up-
regulated in both tissues, as previously observed in
response to hydrocarbons, herbicides or hypoxia
[18–20]. In vertebrates, glutamine synthetase occupies a
central position in nitrogen metabolism and is linked
to amino acid turnover, nitrogen detoxification,
nucleotide biosynthesis and more generally to growth
[37]. Although the capacity for glutamine biosynthesis
is generally weak or absent in molluscs [38], a recent
study reported the accumulation of glutamine associ-

gills during the first week of thermal exposure. A simi-
lar thermal stress response, associated with oxidative
stress, has also been observed in other marine poikilo-
thermic species including molluscs [43,46–48].
Our results represent the first stages of investigation
into the molecular response of oysters to high tempera-
tures, focusing on early winter, outside the gametogen-
esis period. Future efforts will focus on the search for
functional polymorphism in some of the genes poten-
tially regulated by temperature in oyster populations
located at the limits of the species distribution area.
Experimental procedures
Thermal acclimation and experimental design
Adult oysters (length 85 ± 5 mm) were collected from La
Pointe du Chaˆ teau (Brittany, France) in November 2004
(seawater temperature 13 °C) and kept constantly immersed
at ambient temperature ($ 13 °C) in aerated 0.22-lm fil-
tered seawater tanks for 21 days. Groups of oysters were
then exposed to two laboratory-controlled temperature
regimes in 40 L tanks: 60 oysters were acclimated for
4 weeks to 25 °C(4°C above the temperature of seawater
encountered in summer in southern Brittany), and a control
group of 70 oysters was maintained in seawater at 13 °C.
Oysters were fed three times a week with a microalgal sus-
pension (containing Isochrysis galbana and Pavlova lutheri).
No oysters died during the experiment.
For each of the experimental conditions, oysters were
sampled at 0, 3, 7, 10, 14, 17 and 24 days following the
start of the treatments. Gill and mantle tissues were dis-
sected, rapidly frozen in liquid nitrogen and stored at

domly selected clones were single-pass sequenced using an
ABI 3730 sequencer with the sequencing kit ABI Big dye
terminator version 3.1 at the Genoscope Sequencing Center
(Evry, France). Sequences were then analyzed using BlastX
algorithm available from the National Center for Biotech-
nology Information (NCBI) and the EST sequences were
then submitted to its dbEST and GenBank databases (see
supplementary Tables S1–S4).
Real-time PCR analyses
Real-time PCR was used to analyse the expression profiles
of some selected genes involved in cell proliferation and dif-
ferentiation, cellular stress, antioxidant defence, metabolism
of nitrogen and ammonia detoxification, membrane fluidity,
energetic metabolism and translational processing. Total
RNA was extracted from gills and mantle of 10 oysters
exposed to 13 and 25 °C for 0, 3, 7, 10, 14, 17 and 24 days.
A pool of the 10 RNA samples was made for each tissue at
each sampling point in a proportional manner according to
the amount of total RNA collected from each animal.
Reverse transcription was performed on 20 l g RNA from
each pool using the oligo(dT) anchor primer (5¢-GAC
CACGCGTATCGATGTCGACT
(16)
V-3¢) and Moloney
murine leukaemia virus (M-MLV) reverse transcriptase
(Promega). Real-time PCR was performed in triplicate with
Table 2. Combinations of primers used in real-time PCR expression analysis.
Genes Primer sequences (5’- to 3’)
MTA-1 AATGCTGGCTCTCCCTCGAT
GCTTGGCTACTGGACCATCAA

D-LDH TTCGTTTTTCCCTCAAAGCATT
CGCCATATTGCTTGACAGCTACT
Translation initiation factor eIF-2B delta subunit GGCTGGTATCCCTTGCTCCTA
CACTTTAGTAGCCTCTTGCATTGC
Ribosomal 18S GTCTGGTTAATTCCGATAACGAACGGAACTCTA
TGCTCAATCTCGTGTGGCTAAACGCAACTTG
A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas
FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6399
5 lL cDNA (1 ⁄ 20 dilution) in a total volume of 20 lL,
using a 7300 Real-Time PCR System (Applied Biosystems,
Foster City, CA). The concentrations of the reaction
components were as follows: 1· Absolute QPCR SYBR
Green ROX Mix (ABgene, Epsom, UK) and 70 nm of
each primer. Oligonucleotide primer sequences used to
amplify specific gene products are shown in Table 2.
Reactions were realized with activation of Thermo-StartÒ
DNA polymerase at 95 ° C for 15 min followed by ampli-
fication of the target cDNA (45 cycles of denaturation at
95 °C for 30 s, annealing and extension at 60 °C for
1 min) and a melting curve programme from 95 to 70 °C
decreasing by 0.5 °C every 10 s. Readings were taken at
60 °C. Each run included a positive cDNA control (one
13 °C sample from the present experiment analyzed in
each amplification plate), a negative control (nonreverse-
transcribed total RNA) and blank controls (water) for
each primer pair. PCR products were then purified,
cloned and sequenced for confirmation.
For gene expression calculation, the threshold value
(Ct) was determined for each target as the number of
cycles at which the fluorescence rose appreciably above

is the amplification efficiency of the
reference (ribosomal 18S) and C
t
is the crossing threshold.
Statistical analysis
The variations in gene expression were analyzed with Stu-
dent’s t-tests between oysters exposed to 13 and 25 °C, using
statistica software (Statsoft, Maison-Alfort, France). These
statistical analyses were performed using the triplicate real-
time PCR assay values obtained for each sample; the graphs
(Fig. 2) present the mean values with standard deviations.
Acknowledgements
This research program was financially supported by
the national program PROGIG (Prolife
´
ration de
Crassostrea gigas, LITEAU II) and the PolyGIGAS
program of the Bureau des Ressources Ge
´
ne
´
tiques
(n°05 ⁄ 5210460 ⁄ YF). The authors are grateful to Helen
McCombie and Carolyn Friedman for English correc-
tions.
References
1 Hochachka PW & Somero GN (2002) Biochemical
Adaptation: Mechanism and Process in Physiological
Evolution. Oxford University Press, Oxford.
2 Podrabsky JE & Somero GN (2004) Changes in gene

chard J & Le Pennec M (2002) Autumn conditioning of
the oyster Crassostrea gigas: a new approach. Aquacul-
ture 210, 171–186.
10 Chavez-Villalba J, Cochard JC, Pennec M, Barret J,
Enriquez-Diaz M & Caceres-Martinez C (2003) Effects
of temperature and feeding regimes on gametogenesis
and larval production in the oyster Crassostrea gigas.
J Shellfish Res 22, 721–731.
11 Berthelin C, Kellner K & Mathieu M (2000) Storage
metabolism in the Pacific oyster (Crassostrea gigas)in
relation to summer mortalities and reproductive cycle
(west coast of France). Comp Biochem Physiol B 125,
359–369.
Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al.
6400 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works
12 Mann R (1979) Some biochemical and physiological
aspects of growth and gametogenesis in Crassostrea
gigas and Ostrea edulis grown at sustained elevated
temperatures. J Mar Biol Assoc UK 59, 95–110.
13 Ruiz C, Abad M, Sedano F, Garcia-Martin LO &
Sanchez Lopez JL (1992) Influence of seasonal environ-
mental changes on the gamete production and biochem-
ical composition of Crassostrea gigas (Thunberg) in
suspended culture in El Grove, Galicia, Spain. J Exp
Mar Biol Ecol 155, 249–262.
14 Klose A, Zigrino P, Dennhofer R, Mauch C & Hunzel-
mann N (2006) Identification and discrimination of
extracellularly active cathepsins B and L in high-inva-
sive melanoma cells. Anal Biochem 353, 57–62.
15 Levicar N, Kos J, Blejec A, Golouh R, Vrhovec I,

mier Y & Barrett JC (2004) Properties of switch-like
bioregulatory networks studied by simulation of the
hypoxia response control system. Mol Biol Cell 15,
3042–3052.
22 Tomanek L & Somero GN (1999) Evolutionary and
acclimation-induced variation in the heat-shock
responses of congeneric marine snails (genus Tegula)
from different thermal habitats: implications for limits
of thermotolerance and biogeography. J Exp Biol 202,
2925–2936.
23 Lindquist S (1986) The heat-shock response. Annu Rev
Biochem 55, 1151–1191.
24 Parsell DA & Lindquist S (1993) The function of
heat-shock proteins in stress tolerance: degradation and
reactivation of damaged proteins. Annu Rev Genet 27,
437–496.
25 Feder ME & Hofmann GE (1999) Heat-shock proteins,
molecular chaperones, and the stress response: evolu-
tionary and ecological physiology. Annu Rev Physiol 61,
243–282.
26 Clegg JS (1998) Induced thermotolerance and the heat
shock protein-70 family in the Pacific oyster Crassostrea
gigas. Mol Mar Biol Biotech 7, 21–30.
27 Haslbeck M (2002) sHsps and their role in the chaper-
one network. Cell Mol Life Sci 59, 1649–1657.
28 Bando Y, Ogawa S, Yamauchi A, Kuwabara K, Ozawa
K, Hori O, Yanagi H, Tamatani M & Tohyama M
(2000) 150-kDa oxygen-regulated protein (ORP150)
functions as a novel molecular chaperone in MDCK
cells. Am J Physiol Cell Physiol 278, C1172–C1182.

Eastern (Crassostrea virginica) and Pacific (C. gigas)
oysters. Gene 338, 121–131.
36 Long GL (1976) The stereospecific distribution and evo-
lutionary significance of invertebrate lactate dehydro-
genases. Comp Biochem Physiol B 55, 77–83.
A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas
FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6401
37 Walsh PJ & Mommsen TP (2001) Evolutionary consid-
erations of nitrogen metabolism and excretion. Fish
Physiol 20, 1–30.
38 Bishop SH, Ellis LL & Burcham JM (1983) Amino acid
metabolism in molluscs. Mollusca 1, 243–327.
39 Hiong KC, Peh WYX, Loong AM, Wong WP, Chew
SF & Ip YK (2004) Exposure to air, but not seawater,
increases the glutamine content and the glutamine syn-
thetase activity in the marsh clam Polymesoda expansa.
J Exp Biol 207, 4605–4614.
40 Tocher DR, Leaver MJ & Hodgson PA (1998) Recent
advances in the biochemistry and molecular biology of
fatty acyl desaturases. Prog Lipid Res 37, 73–117.
41 Nakamura MT & Nara TY (2004) Structure, function,
and dietary regulation of delta6, delta5, and delta9
desaturases. Annu Rev Nutr 24, 345–376.
42 Kraffe E, Marty Y & Guderley H (2007) Changes in
mitochondrial oxidative capacities during thermal accli-
mation of rainbow trout Oncorhynchus mykiss: roles of
membrane proteins, phospholipids and their fatty acid
compositions. J Exp Biol 210, 149–165.
43 Abele D, Heise K, Portner HO & Puntarulo S (2002)
Temperature-dependence of mitochondrial function and

The following supplementary material is available
online:
Table S1. Genes identified after 7–10 days at 25 °C.
Table S2. Genes identified after 7–10 days at 13 °C.
Table S3. Genes identified after 24 days at 25 °C.
Table S4. Genes identified after 24 days at 13 °C.
This material is available as part of the online article
from
Please note: Blackwell Publishing is not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al.
6402 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status