Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein - Pdf 10

Identification of Ewing’s sarcoma protein as a
G-quadruplex DNA- and RNA-binding protein
Kentaro Takahama
1,
*, Katsuhito Kino
2,
*, Shigeki Arai
3
, Riki Kurokawa
3
and Takanori Oyoshi
1
1 Department of Chemistry, Faculty of Science, Shizuoka University, Japan
2 Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Kagawa, Japan
3 Division of Gene Structure and Function, Saitama Medical University Research Center for Genomic Medicine, Japan
Introduction
The current knowledge of Ewing’s sarcoma (EWS)
derives primarily from studies of a group of dominant
oncogenes that arise due to chromosomal transloca-
tions in which EWS is fused to a variety of cellular
transcription factors [1–3]. EWS fusion proteins are
very potent transcription activators that depend on the
EWS N-terminal domain and a C-terminal DNA-bind-
ing domain contributed by the fusion partner [4–9].
EWS ⁄ ATF1 is a potent constitutive activator of ATF-
dependent promoters [10]. The EWS N-terminal binds
directly to the RNA polymerase II subunit hsRPB7
and this interaction is thought to be important for
transactivation [11].
In contrast to EWS fusion proteins, however, the
normal function and the nucleic acid-binding proper-

Arg-Gly-Gly (RGG) domain of the C-terminal in EWS binds to the G-rich
single-stranded DNA and RNA fold in the G-quadruplex structure.
Furthermore, inhibition of DNA polymerase on a template containing a
human telomere sequence in the presence of RGG occurs in an RGG
concentration-dependent manner by the formation of a stabilized G-quad-
ruplex DNA–RGG complex. In addition, mutated RGG containing Lys
residues replacing Arg residues at specific Arg-Gly-Gly sites and RGG con-
taining Arg methylated by protein arginine N-methyltransferase 3 decrease
the binding ability of EWS to G-quadruplex DNA and RNA. These find-
ings suggest that the RGG of EWS binds to G-quadruplex DNA and
RNA via the Arg residues in it.
Abbreviations
dsHtelo, human telomere duplex DNA; EAD, Ewing’s sarcoma activation domain; EMSA, electrophoretic mobility shift assay; ETS, external
transcribed spacer; EWS, Ewing’s sarcoma; FMRP, fragile X mental retardation protein; GST, glutathione S-transferase; Htelo, human
telomere DNA; mut Htelo, mutated human telomere; mut rHtelo, mutated human telomere RNA; PRMT3, protein arginine
N-methyltransferase 3; RBD, RNA-binding domain; rHtelo, human telomere RNA; RRM, RNA recognition motif; ZnF, zinc finger.
988 FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS
(RBD) in the C-terminal region as multiple domains
involved in nucleic acid–protein interactions: an RNA
recognition motif (RRM) flanked by two regions in
Arg-Gly-Gly repeats (RGG) and a C
2
C
2
zinc finger
(ZnF) with an RGG domain in the C-terminal [16,17].
They bind to RNA as well as single- and double-
stranded DNA [18–20]. In the case of EWS, the
C-terminal amino acids that constitute RGG specifi-
cally bind to poly G and poly U RNA in vitro [8]. On

plex DNA have been investigated in vitro [28–36].
Hanakahi et al. [26] reported that the four RBD and
the Arg-Gly-Gly repeats of nucleolin, which is
involved in transcription, rRNA processing and ribo-
some assembly, can bind to G-quadruplex DNA
formed from the external transcribed spacer region of
human rDNA, ETS-1. We performed an EMSA of
EWS and ETS-1 to investigate the ability of EWS to
bind to G-quadruplex DNA (Fig. 1A, Table 1).
Recombinant EWS, which contains RBD in the C-ter-
minal region comprising RRM, ZnF and three RGG
(RGG1, RGG2 and RGG3) for binding to nucleic
acids, was expressed in Escherichia coli as proteins
fused to glutathione S-transferase (GST) and purified
using glutathione agarose.
32
P-labeled ETS-1 was first
incubated for 24 h in 100 mm KCl to allow for quad-
ruplex formation and then with GST-tag-digested
EWS for 1 h at room temperature. The EWS–DNA
complexes were resolved by 6% PAGE and visualized
by autoradiography. Binding analyses revealed that
EWS binds to the G-quadruplex formed from the
ETS-1, but not to the control single-stranded DNA.
Similar results were obtained with a human telomere
DNA (Htelo) in the presence of 100 mm K
+
(Fig. 1B,
Table 1). The results demonstrated that EWS binds to
Htelo, but not to human telomere duplex DNA (dsHt-


EWS
Fig. 1. Affinity of EWS for binding to G-quadruplex DNA. (A) EMSA
was performed with EWS (lanes 2 and 4) and
32
P-labeled ETS-1
(lanes 3 and 4) or ssDNA L (lanes 1 and 2). (B) EMSA was per-
formed with EWS (lanes 2, 4 and 6) and
32
P-labeled Htelo (lanes 3
and 4), dsHtelo (lanes 5 and 6) or ssDNA S (lanes 1 and 2). The
structures of DNAs used as probes are indicated above each lane.
The DNA–protein complexes were resolved by 6% PAGE and visu-
alized by autoradiography.
K. Takahama et al. Identification of Ewing’s sarcoma protein
FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS 989
comparing the behavior of various mutant recombi-
nant proteins, i.e. the EWS activation domain (EAD),
RGG1, RRM–RGG2–ZnF and RGG3, with regard to
Htelo (Fig. 2A). RGG3 interacted with Htelo in
EMSA, whereas the proteins containing EAD, RGG1
and RRM–RGG2–ZnF did not bind to Htelo
(Fig. 2B). The RGG domain in FMRP has a closely
spaced Arg-Gly-Gly repeat, which is necessary for
G-quadruplex structure binding [23,24]. RGG3,
containing 12 RGG repeats, of EWS binds to the
G-quadruplex structure, whereas RGG1, containing
six fewer RGG repeats than RGG3, does not
(Table 2). Additional binding studies demonstrated
that recombinant RGG3 does not bind to dsHtelo or

RGG3

D
E
RGG2
RGG3
dsHtelo – – 1x 10x 100x
F
Htelo – – 1x 10x 100x
RBD
RGG3
RGG3
Full
length
Primer
RGG3
Pausing
product
Fig. 2. Structural features of EWS and
DNA-binding specificities of RGG3. (A) Sche-
matic representation of the deletion mutants
constructed to map the Htelo-binding speci-
ficity of each one of the EWS. AD (residues
1–287); RGG 1 (288–347); RRM (residues
348–469); RGG 2 (residues 450–501); ZnF
(residues 502–544); RGG 3 (residues 545–
656). (B) DNA-binding activities of EAD (lane
2), RGG1 (lane 3), RRM–RGG2–ZnF (lane 4)
and RGG3 (lane 5). EMSA was performed
with these proteins and

in the presence of Li
+
, which did not form the
G-quadruplex as confirmed by CD spectroscopy, was
blocked. To further test whether RGG3 bound to
Htelo folds into a G-quadruplex, we analyzed the
binding between RGG3 and a mutated human telo-
mere (mut Htelo) that replaces G with T at positions 9
and 15, which destabilized the G-quadruplex forma-
tion, as confirmed by CD and UV spectroscopy
(Figs 2C, S2, Table 1). The analysis showed that
RGG3 binds to the folded Htelo G-quadruplex, but
not to unfolded mut Htelo despite containing one
TTAGGG sequence. Furthermore, competitive experi-
ments performed in the presence of cold competitor
Htelo or dsHtelo showed that Htelo effectively com-
peted for binding, whereas dsHtelo had no effect, even
at a 100-fold molar excess (Fig. 2D, E). These findings
suggest that RGG3 binds to G-quadruplex DNA with
structure specificity.
Having found that EWS binds to G-quadruplex con-
formations and not to single- and double-stranded
conformations by RGG3, we aimed to determine
whether RGG3 of EWS modulates the formation or
unwinding of Htelo G-quadruplex DNA. To determine
whether the RGG3 binding affected the stability of the
G-quadruplex structure of Htelo, we performed a poly-
merase stop assay as described previously [43]. The
32
P-labeled 25-mer primer annealed to the 3¢ end of

ments performed in the presence of cold competitor
rHtelo or mut rHtelo showed that rHtelo effectively
competed for binding, whereas the mut rHtelo had no
effect, even at a 100-fold molar excess (Fig. 3C, D).
These findings suggest that RGG3 also binds to
G-quadruplex RNA with structure specificity.
To elucidate the ability of RGG3 to bind the G-quad-
ruplex, various concentrations of RGG3 were incu-
bated with 5¢
32
P-labeled Htelo or rHtelo in a K
+
solution. As the RGG3 concentration increased, the
free DNA or RNA decreased, and the higher molecu-
lar weight complex increased (Fig. 4). The mobility
shift data were fitted to a hyperbolic equation to give
a K
d
of 13 ± 3 nm (Htelo) and 10 ± 2 nm (rHtelo).
In comparison with RGG3, the full-length EWS and
RBD containing RGG3 bound to Htelo with
Table 1. Sequence of oligonucleotides used in EMSA and CD spectroscopy. Oligonucleotides were diluted to 0.5 mM (base concentration)
in 50 m
M Tris ⁄ HCl (pH 7.5) in the presence of 100 mM KCl or 100 mM LiCl, as specified. Duplex annealing or quadruplex formation was
performed by heating samples to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin
–1
.
Name Sequence
ssDNAS d(CATTCCCACCGGGACCACCAC)
ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)

RGG3 and RBD to repress transcription activation by
EAD raised the possibility that RGG3 and RBD block
the interaction between the EAD and RNA polymer-
ase II subunit [11,45]. The interaction between the
EAD and RGG3 might inhibit the high-affinity Htelo
binding of RGG3.
To gain further insight into the induction of G-quad-
ruplex formations by RGG3 of EWS, we performed a
CD spectroscopic analysis that was conducted with
Htelo in the presence of various amounts of RGG3.
The CD spectrum of Htelo, a hybrid (3 + 1) form,
showed a strong positive band at 290 nm and a nega-
tive band at around 235 nm, whereas the addition of 1
ratio excess of RGG3 led to an increase in ellipticity
and shifted the spectrum from a strong positive band
to 265 nm (Fig. 5), which is characteristic of the paral-
lel form and consistent with the results of previous CD
studies [40–42]. These data indicate that RGG3 binds
to the Htelo G-quadruplex and changes the hybrid
(3 + 1) G-quadruplex formation of Htelo. Moreover,
it may provide a model showing the change from the
hybrid (3 + 1) G-quadruplex to the parallel form with
the association of RGG3. Incubation of rHtelo with
RGG3 did not alter the G-quadruplex RNA, however,
as demonstrated by CD spectrum analysis (data not
shown).
Rajpurohit et al. [46] reported that binding of the
recombinant hnRNP A1 protein to single-stranded
nucleic acid is reduced upon enzyme methylation of
Arg. To evaluate the role of Arg in RGG3 on G-quad-

plex RNA binding (Fig. S5). These findings indicate
RGG3
Htelo
rHtelo
RGG3


B
A
rHtelo
mut
rHtelo


RGG3
RGG3
rHtelo – – 1x 10x 100x
RGG3
D
C
mut
rHtelo – – 1x 10x 100x
RGG3
Fig. 3. Protein–nucleic acid complexes. (A) EMSA was performed
with RGG3 (lanes 2 and 4) and
32
P-labeled Htelo (lanes 1 and 2) or
rHtelo (lanes 3 and 4). (B) EMSA was performed with RGG3 (lanes
2 and 4) and
32

reported to bind to double-stranded DNA in these
promoters. The c-fos and ErbB2 promoters contain
G-rich sequences that could potentially form G-quad-
ruplex structures [51,52]. On the basis of a combina-
tion of in silico and experimental approaches, Verma
et al. [53,54] reported an enriched sequence with the
potential to adopt the G-quadruplex motifs near tran-
scription start sites. These findings suggest that
G-quadruplex motif-mediated regulation is a more
common mode of transcription control. On the other
hand, Dejardin & Kingston [55] purified human
telomeric chromatin using proteomics of isolated
RGG3 (nM) 0 4 8 16 32 64 125 250
B
A
RGG3 (nM) 0 4 8 16 32 64 125 250
RGG3 concentration (n
M)
0.6
0.4
0.2
0
0 50 100 150 200 250
RGG3 concentration (nM)
0 50 100 150 200 250
0.8
1
0.6
0.4
0.2

)
240
260
280
300
320
–2
0
2
4
6
220
Hybrid (3 + 1) form
Parallel form
Fig. 5. CD of Htelo in the presence of various amounts of RGG3.
Titration of Htelo with RGG3 (1.2, 1.0, 0.8, 0.6, 0.4, 0.2, 0.1 and 0
equiv. of RGG3) in 100 m
M KCl and 50 mM Tris ⁄ HCl (pH 7.5). The
concentration of DNA was 0.2 m
M base concentration. Line colors:
black = 0 equiv.; blue = 0.1 equiv.; cyan = 0.2 equiv.; green = 0.4
equiv.; light green = 0.6 equiv.; yellow = 0.8 equiv.; orange = 1.0
equiv.; red = 1.2 equiv.
K. Takahama et al. Identification of Ewing’s sarcoma protein
FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS 993
chromatin segments and identified that the protein
translocated in liposarcoma, which is related to EWS
as a subgroup within the RNP family of RNA-binding
proteins containing RRM and RGG domains, binds to
telomeres. Further studies are required to identify the

KOD -Plus- mutagenesis kit (Toyobo, Japan). To construct
pGEX–KGG3-2, PCR was performed with pGEX–RGG3 as
a template and the following primers: KGG3-2 forward
d(AAA GGT GGC AAA GGT GGA GAC AGA GGT
GGC TT) and KGG3-2 reverse d(GAA CAT TCC ACC
GGG ACC ACC AC). pGEX–KGG3-4 was generated by
PCR using pGEX–KGG2 as a template and the following
primers: KGG3-4 forward d(AGA CAA AGG TGG CTT
CAA AGG TGG CCG) and KGG3-4 reverse d(CCA CCT
TTG CCA CCT TTG AAC A). PCR was conducted with
pGEX–KGG3-4 as a template and the following primers:
KGG3-6 forward d(GGC AAA GGC ATG GAC AAA
GGT GGC TTT GG) and KGG3-6 reverse d(ACC TTT
GAA GCC ACC TTT GTC TCC ACC), for pGEX–KGG3-
6. All reactions were performed according to the manu-
facturer’s protocol for the KOD-Plus- mutagenesis kit
(Toyobo). Escherichia coli strain BL21 (DE3) pLysS-
competent cells were transformed with the vectors, and the
transformants were grown at 37 °C in a Luria Bertani
medium containing ampicillin (0.1 mgÆmL
)1
). Protein expres-
sion was induced at A
600
= 0.6 with 0.1 mm isopropyl
b-d-1-thiogalactopyranoside. The cells were then grown for
an additional 16 h at 25 °C and harvested by centrifugation
(6400 g for 20 min). Pellets were resuspended in buffer A
(100 mm Tris ⁄ HCl pH 7.5, 150 mm NaCl, 1 mm EDTA acid
and 1 mm dithiothreitol) and lysed by sonication (model

545 656
587 610
AC
Fig. 6. Identification of significant residues at RGG3 for G-quadruplex binding ability. (A) Ability of RGG3 to bind to Htelo in the presence (+)
or in the absence ()) of PRMT3 or AdoMet. RGG3 (lanes 2, 4 and 6) was incubated with (lanes 1, 2, 5 and 6) or without (lanes 3 and 4)
PRMT3 in a potassium buffer with (lanes 3–6) or without (lanes 1 and 2) AdoMet. (B) Schematic illustration of amino acids 587–610 within
RGG3 (residues 545–656). The point mutations are shown in bold. (C) EMSA of RGG3 (lane 2), KGG3-2 (lane 3), KGG3-4 (lane 4) and KGG3-
6 (lane 5) using Htelo. The DNA–protein complexes were resolved by 6% PAGE and visualized by autoradiography.
Identification of Ewing’s sarcoma protein K. Takahama et al.
994 FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS
with buffer C (50 mm Tris ⁄ HCl pH 7.5, 100 mm KCl and
1mm dithiothreitol) or buffer D (50 mm Tris ⁄ HCl pH 7.5,
100 mm LiCl and 1 mm dithiothreitol) by dialysis. The
protein concentrations were determined using the BCA
Protein Assay Kit (Thermo Scientific, USA). For all experi-
ments, GST-tag was digested according to the manu-
facturer’s instructions (GE Healthcare, Precision Protease,
Little Chalfont, UK), and 20 nmol of each protein was
incubated with 20 lg RNase A (Nippon Gene, Tokyo,
Japan) at 4 °C for 16 h before use.
EMSA
Labeled oligonucleotides were diluted to 0.2 mm (base con-
centration) in 50 mm Tris ⁄ HCl (pH 7.5) in the presence of
100 mm KCl or 100 mm LiCl, as specified. Duplex anneal-
ing or quadruplex formation was performed by heating
samples to 95 °C on a thermal heating block and cooling to
4 °C at a rate of 2 °CÆmin
)1
. Binding reactions were
performed in a final volume of 20 lL using 100 fmol of

DNA polymerase stop assay
This assay was adapted from the method described by
Han et al. [43]. The 25-mer primer was 5¢-labeled with
32
P, mixed with the 76-mer template DNA and annealed
as described above. The polymerase reaction was per-
formed in a final volume of 20 lL using 20 fmol of the
duplex and various amounts of purified RGG3 in a bind-
ing buffer (50 mm Tris ⁄ HCl pH 7.5, 1 mm dithiothreitol,
100 lgÆmL
)1
bovine serum albumin, 1 lgÆmL
)1
calf thy-
mus DNA and 100 mm KCl). RGG3 was incubated with
the duplex for 1 h at room temperature. The polymerase
extension reaction was initiated by adding Taq polymer-
ase, dNTP (1 mm each) and MgCl
2
(10 mm). The reaction
was incubated at 30 °C for 10 min and then stopped by
adding an equal volume of a stop buffer (95% formamide,
10 mm EDTA, 10 mm NaOH, 0.1% bromophenol blue
and 0.1% xylenecyanol). Extension products were sepa-
rated on a 12% polyacrylamide (acrylamide ⁄ bisacryla-
mide = 19 : 1) gel; 1· TBE was used, both in the gel and
as the electrophoresis buffer. Electrophoresis was per-
formed at 1500 V for 1 h at 4 °C, and gels were visualized
on a phosphorimager.
CD spectroscopy

Immunol 220, 143–150.
3 Rauscher FJ III (1997) Chromosome translocation-
mediated conversion of a tumor suppressor gene into a
dominant oncogene: fusion of EWS1 to WT1 in
desmoplastic small round cell tumors. Curr Top
Microbiol Immunol 220, 151–162.
4 Brown AD, Lopez-Terrada D, Denny CT & Lee KAW
(1995) Promoters containing ATF-binding sites are
K. Takahama et al. Identification of Ewing’s sarcoma protein
FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS 995
de-regulated in cells that express the EWS ⁄ ATF1
ontogeny. Oncogene 10, 1749–1756.
5 Fujimura Y, Ohno T, Siddique H, Lee L, Rao VN &
Reddy ESP (1996) The EWS-ATF-1 gene involved in
malignant melanoma of soft parts with t(12;22)
chromosome translocation, encodes a constitutive
transcriptional activator. Oncogene 12, 159–167.
6 May WA, Lessnick SL, Braun BS, Klemsz M,
Lewis BC, Lunsford LB, Hromas R & Denny CT
(1993) The Ewing’s sarcoma EWS ⁄ FLI-1 fusion gene
encodes a more potent transcriptional activator and is a
more powerful transforming gene than FLI-1. Mol Cell
Biol 13, 7393–7398.
7 Ohno T, Rao VN & Reddy ESP (1993) EWS ⁄ Fli-1 chi-
meric protein is a transcriptional activator. Cancer Res
53, 5859–5863.
8 Ohno T, Ouchida M, Lee L, Gatalica Z, Rao VN &
Reddy ES (1994) The EWS gene, involved in Ewing
family of tumors, malignant melanoma of soft parts
and desmoplastic small round cell tumors, codes for an

cyte nuclear factor 4-mediated transcription. J Biol
Chem 278, 5427–5432.
15 Hume DA, Sasmono T, Himes SR, Sharma SM,
Bronisz A, Constantin M, Ostrowski MC & Ross IL
(2008) The Ewing sarcoma protein (EWS) binds directly
to the proximal elements of the macrophage-specific
promoter of the CSF-1 receptor (csf1r) gene. J Immunol
180, 6733–6742.
16 Delattre O, Zucman J, Plougastel B, Desmaze C, Melot
T, Peter M, Kovar H, Joubert I, de Jong P, Rouleau G
et al. (1992) Gene fusion with an ETS DNA-binding
caused by chromosome translocation in human
tumours. Nature 359, 162–166.
17 Li KKC & Lee KAW (2000) Transcription activation
by the Ewing’s Sarcoma (EWS) oncogene can be
cis-repression by the EWS RNA-binding domain. J Biol
Chem 275, 23053–23058.
18 Perrotti D, Bonatti S, Trotta R, Martinez R, Skorski T,
Salomoni P, Grassilli E, Iozzo RV, Copper DR &
Calabretta B (1998) TLS ⁄ FUS, a pro-oncogene
involved in multiple chromosomal translocations, is a
novel regulator of BCR ⁄ ABL-mediated leukemogenesis.
EMBO J
15, 4442–4455.
19 Bertolotti A, Lutz Y, Heard DJ, Chambon P & Tora L
(1996) hTAF
II
68, a novel RNA ⁄ ssDNA the pro-onco-
proteins TLS ⁄ FUS and EWS is associated with both
TFIID and RNA polymerase II. EMBO J 15, 5022–

28 Fang G & Cech TR (1993) The b subunit of Oxytricha
telomere-binding protein promotes G-quartet formation
by telomeric DNA. Cell 74, 875–885.
Identification of Ewing’s sarcoma protein K. Takahama et al.
996 FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS
29 Fukuda H, Katahira M, Tsuchiya N, Enokizono Y,
Sugimura T, Nagano M & Nakagama H (2002) Unfold-
ing of quadruplex structure in the G-rich strand of the
minisatellite repeat by the binding protein UP1. Proc
Natl Acad Sci USA 99, 12685–12690.
30 Etzioni S, Yafe A, Khateb S, Weisman-Shomer P,
Bengal E & Fry M (2005) Homodimeric MyoD
preferentially binds tetraplex structures of regula-
tory muscle-specific genes. J Biol Chem 280,
26805–26812.
31 Zaug AJ, Podell ER & Cech TR (2005) Human POT1
disrupts telomeric G-quadruplexes allowing telomerase
extension in vitro. Proc Natl Acad Sci USA 102, 10864–
10869.
32 Salas TR, Petruseva I, Lavrik O, Bourdoncle A,
Mergny J-L, Favre A & Saintome C (2006) Human
replication protein A unfolds telomeric G-quadruplexes.
Nucleic Acids Res 34, 4857–4865.
33 Thakur RK, Kumar P, Halder K, Verma A, Kar A,
Paret J-L, Basundra R, Kumar A & Chowdhury S
(2009) Metastases suppressor NM23-H2 inter-
action with G-quadruplex DNA within c-MYC
promoter nuclease hypersensitive element induces
c-MYC expression. Nucleic Acids Res 37,
172–183.

40 Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y,
Petel DJ, Luu KN & Pjan AT (2009) Structure of the
human telomere in K
+
solution: a stable basket-type
G-quadruplex with only two G-tetrad layers. JAm
Chem Soc 131, 4301–4309.
41 Singh V, Azarkh M, Exner TE, Hartig JS &
Drescher M (2009) Human telomeric quadruplex
conformations studied by pulsed EPR. Angew Chem Int
Ed 48, 9728–9730.
42 Balagurumoorthy P, Brahmachari SK, Mohanty D,
Bansal D & Sasisekharan V (1992) Hairpin and parallel
quartet structures for telomeric sequences. Nucleic Acids
Res 20, 4061–4067.
43 Han H, Hurley LH & Salazar M (1999) A DNA poly-
merase stop assay for G-quadruplex-interactive com-
pounds. Nucleic Acid Res 27, 537–542.
44 Martadinate H & Phan AT (2009) Structure of propel-
ler-type parallel-strand RNA G-quadruplexes, formed
by human telomeric RNA sequence in K solution.
J Am Chem Soc 131, 2570–2578.
45 Alex D & Lee KAW (2005) RGG-boxes of the EWS
oncoprotein repress a range of transcriptional activation
domains. Nucleic Acids Res 33, 1323–1331.
46 Rajpurohit R, Paik WK & Kim S (1994) Effect of enzy-
mic methylation of heterogeneous ribonucleoprotein
particle A1 on its nucleic-acid binding and controlled
proteolysis. Biochem J 304, 903–909.
47 Pahlich S, Bschir K, Chiavi C, Belyanskaya L &

analyses reveal G-quadruplex DNA motifs as conserved
cis-regulatory elements in human and related species.
J Med Chem 51, 5641–5649.
K. Takahama et al. Identification of Ewing’s sarcoma protein
FEBS Journal 278 (2011) 988–998 ª 2011 The Authors Journal compilation ª 2011 FEBS 997
54 Verma A, Yadav VK, Basundra R, Kumar A &
Chowdhury S (2009) Evidence of genome-wide G4
DNA-mediated gene expression in human cancer cell.
Nucleic Acids Res 37, 4194–4204.
55 Dejardin J & Kingston RE (2009) Purification of pro-
teins associated with specific genomic loci. Cell 136,
175–186.
Supporting information
The following supplementary material is available:
Fig. S1. Affinity of RGG3 for binding to a G-quadru-
plex DNA and RNA.
Fig. S2. CD spectra of DNAs and RNAs.
Fig. S3. Binding affinity of EWS and RBD to
Htelo.
Fig. S4. In vitro arginine methylation of RGG3 by
PRMT3.
Fig. S5. Identification of significant residues at RGG3
for rHtelo binding ability.
Fig. S6. Ability of RGG3 and RGG3 methylated by
PRMT3 to bind to G-quadruplex.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status