Human enhancer of rudimentary is a molecular partner
of PDIP46/SKAR, a protein interacting with DNA
polymerase d and S6K1 and regulating cell growth
Amelia Smyk
1
, Magdalena Szuminska
1
, Katarzyna A. Uniewicz
1
, Lee M. Graves
2
and Piotr Kozlowski
1
1 Institute of Biochemistry, Warsaw University, Warsaw, Poland
2 Department of Pharmacology, University of North Carolina at Chapel Hill, NC, USA
The enhancer of rudimentary (ER) gene has been iden-
tified in eukaryotic organisms ranging from protists to
plants to humans with the exception of fungi, in which
this gene has not been isolated so far [1–5]. Moreover,
it seems to be absent in the sequenced genomes of Sac-
charomyces cerevisiae and Schizosaccharomyces pombe.
Keywords
ER; POLDIP3; pyrimidine; RNA recognition
motif; yeast two-hybrid system
Correspondence
P. Kozlowski, Institute of Biochemistry,
Warsaw University, Miecznikowa 1,
02-096 Warsaw, Poland
Fax: +48 22 5543116
Tel: +48 22 5543108
E-mail:

spectrometry. The bipartite region of PDIP46 ⁄ SKAR interacting with ER
comprising residues 274–421 encompasses the docking site for S6K1 within
the RRM and two serines phosphorylated by S6K1. ER and both isoforms
of PDIP46 ⁄ SKAR share the same nuclear localization in the mammalian
cells and their genes display a ubiquitous pattern of expression in a variety
of human tissues, so the interaction between ER and PDIP46 ⁄ SKAR has
an opportunity to occur universally in mammalian cells. Because
PDIP46 ⁄ SKAR is involved in the regulation of cell growth its interaction
with ER may suggest some function for ER in that control.
Abbreviations
CK2, casein kinase II; DCoH/PCD, dimerization cofactor of hepatocyte nuclear factor 1 (HNF1)/pterin-4a-carbinolamine dehydratase; EGFP,
enhanced green fluorescent protein; ER, enhancer of rudimentary; FCP1, TFIIF-associating component of CTD phosphatase; GAL4, galactose
utilization gene 4; GST, glutathione S-transferase; HNF1, hepatocyte nuclear factor 1; IPTG, isopropyl thio-b-
D-galactoside; MEK1, mitogen-
activated protein kinase or extracellular signal-regulated kinase 1; PDIP46, polymerase d interacting protein 46; RRM, RNA recognition motif;
S6K1, S6 kinase 1; SKAR, S6K1 Aly ⁄ REF-like target; SP5, suppressor of Ty 5; X-gal, 5-bromo-4-chloroindol-3-yl b-
D-galactoside.
4728 FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS
In the genomes of the species possessing ER no para-
logs have been identified so far [1–5]. ER genes code
for small proteins that usually consist of 100–105
amino acids [1–5]. However, in plants ER proteins
have some additional amino acids at their N-termini
[2,5]. Analysis of ER amino acid sequences has not
shown the presence of any known protein motifs or
domains that could reveal their possible biochemical
or cellular function or their intracellular localization;
only one or two putative casein kinase II (CK2) phos-
phorylation sites have been identified within them [2].
Yet their comparisons have revealed that ER proteins

flies appeared otherwise normal, the gene was named
enhancer of rudimentary [1]. There are two ER tran-
scripts in Drosophila that differ only in the length of
the 3¢ UTR caused by alternative polyadenylation; the
shorter one is found in equal amounts in adult flies of
both sexes, the longer one is found in the nurse cells of
the ovaries and in the preblastoderm embryos [1].
After gastrulation, the maternal transcript disappears
and the zygotic transcript and protein are found in a
subset of cells expressing DmcycE, which encodes
cyclin E, and undergoing DNA replication [2]. In
Drosophila the severity of the wing truncation is
thought to reflect the level of r expression [11].
Although the effects of the P element generated muta-
tion in ER are due to a drastic reduction in the
amounts of both of its transcripts, it does not seem
that ER acts as a regulator of r as this mutation does
not significantly affect the level of the r transcript in
adult flies [1]. It was also excluded that ER is one of
the genes for the enzymes in the biosynthesis or degra-
dation of pyrimidines [1]. Rather, it was suggested that
it may be involved in the regulation of the metabolism
of pyrimidines [1]. The Drosophila ER contains two
sites for CK2 that undergo phosphorylation in vitro
resulting in a putative shift in the secondary structure
of ER which suggests that CK2 may regulate the activ-
ity of ER [2].
The Xenopus ER was identified as one of the pro-
teins interacting with dimerization cofactor of hepato-
cyte nuclear factor 1 (HNF1)/pterin-4a-carbinolamine

ER transcript in two nondividing mammalian cell lines
examined, primary hepatocytes and adult liver was
very low, whereas it was easily detected in rapidly pro-
liferating cells of four different hepatoma cell lines [2].
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4729
The human ER was found to be one of the proteins
copurifying with suppressor of Ty 5 (SPT5), a tran-
scription elongation factor, when an extract from cells
expressing FLAG epitope-tagged SPT5 was subjected
to FLAG antibody affinity chromatography [16]. In a
similar approach, the human ER was reported to
copurify with TFIIF-associating component of CTD
phosphatase (FCP1), a phosphatase specific for the
carboxy-terminal domain of the large subunit of RNA
polymerase II; this interaction was also confirmed by
coimmunoprecipitation [17]. It was proposed that ER
might be involved in the regulation of transcription as
a counteracting protein of FCP1 and SPT5, positive
transcription elongation factors for RNA polym-
erase II [17]. A 32 amino acid fragment of ER isolated
from the swine small intestine, referred to as peptide
3910, also showed antibacterial activity [18]. Recently,
the high-resolution crystal structures of the human and
murine ER proteins were reported [5,19,20]. These
studies demonstrated that ER folds into a single
domain consisting of a four-stranded antiparallel b
sheet with three amphipathic a helices situated on one
face of the b sheet that does not have significant struc-
tural homologs in databases. The studies also showed

Yeast two-hybrid screening
The yeast two-hybrid system with the full-length
human ER protein as a bait was employed. The cloned
cDNA of the human ER gene was inserted into the bait
plasmid, pHybLex ⁄ Zeo in frame with the LexA DNA
binding domain coding sequence. The obtained con-
struct (pHybLex ⁄ Zeo-ER) was transformed into the
L40 yeast strain alone and together with the prey plas-
mid, pYESTrp2, encoding the B42 transcriptional acti-
vation domain. The resulting strains were tested for the
transactivation of two reporter genes, HIS3 and lacZ
exhibiting neither the capability to grow in the absence
of histidine nor a detectable b-galactosidase activity
(the His
–
LacZ
–
phenotype, for both plasmids in L40;
Fig. 1). Thus, the ability of ER to nonspecifically trans-
activate the reporter genes was excluded. Roughly one
third of the human lung cDNA library in the
pYESTrp2 plasmid with 5.95 · 10
6
independent clones
was screened by transformation into the L40 strain
expressing the bait. There were 364 histidine proto-
trophs after a 6-day selection, of which 83 also dis-
played b-galactosidase activity [yielded blue color in
the 5-bromo-4-chloroindol-3-yl b-d-galactoside (X-gal)
colony-lift filter assay]. Using PCR followed by agarose

formed into the L40 strain. The obtained strain (YL7)
did not exhibit activity of the reporter genes (data not
shown). Next, the YL7 strain was transformed with (i)
the empty bait plasmid, pHybLex ⁄ Zeo, (ii) the original
bait plasmid, pHybLex ⁄ Zeo-ER, or (iii) the irrelevant
bait plasmid, pHybLex ⁄ Zeo-Lamin, and the obtained
strains were again tested for the activity of the reporter
genes. The interaction was specific, as only the YL7
strain expressing ER as a bait exhibited the His
+
LacZ
+
phenotype, whereas the YL7 strains expressing
either the LexA DNA binding domain alone or this
domain fused to lamin, were not able to grow on a
medium lacking histidine and did not show the
b-galactosidase activity (Fig. 1).
There are at least two splicing variants of the human
POLDIP3 gene encoding proteins of 421 amino acids
with a molecular mass of 46 kDa and 392 amino acids
with a molecular mass of 43 kDa, which differ only by
an insertion of 29 amino acids in the middle of the
protein. These proteins are also known either as
PDIP46 (polymerase d interacting protein 46) isoform
1 and 2, respectively, or as SKAR (S6K1 Aly ⁄ REF-
like target) isoform a and b, respectively [23,24]. The
L7 cDNA insert was found to consist of 666 bp con-
taining the 3¢ end of the POLDIP3 coding sequence
(with the stop codon) and coded for 163 amino acids
present at the C-terminus of both isoforms of

try (MS ⁄ MS) analysis that revealed the presence of
three peptide sequences derived from the PDIP46 ⁄
SKAR protein in the examined protein sample
(Fig. 3D). One of these peptides, TIQVPQQK (resi-
dues 148–155) overlaps the region encoded by the
extra exon characteristic of isoform 1 ⁄ a of PDIP46 ⁄
SKAR.
Fig. 2. Proteins encoded by the POLDIP3 gene and the L7 insert.
(A) Schematic representation of both isoforms of the PDIP46 ⁄
SKAR protein encoded by POLDIP3 and the truncated form of
PDIP ⁄ SKAR encoded by the L7 insert. The region corresponding to
the RNA recognition motif (RRM) is shaded in gray and amino acids
encoded by an extra exon present in the isoform 1 ⁄ a are represen-
ted as the striped box. Numbering of the truncated protein encoded
by the L7 insert is according to the isoform 1 ⁄ a. (B) Amino acid
sequence of PDIP46(1) ⁄ SKAR(a). Amino acids encoded by an extra
exon present in the isoform 1 ⁄ a are in bold. Amino acids of the
RNA recognition motif are shaded in gray. Amino acids encoded by
the L7 insert are underlined. Two serines (383 and 385) phosphoryl-
ated by S6K1 are double underlined. The ends of the RRM on both
panels are as in [24], however, according to PROSITE the RRM is
shifted by three residues toward the C-terminus [280–351 in
PDIP46(1) ⁄ SKAR(a)] [27].
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4731
Comparison of the intracellular localizations of
the human ER and PDIP46/SKAR proteins
We examined the intracellular localization of the
human ER and PDIP46 ⁄ SKAR proteins fused with
enhanced green fluorescent protein (EGFP) in the

RNA isolated from 61 different
human adult tissues, seven human fetal tissues and
eight human cancer cell lines that was normalized to
eight different housekeeping genes was used to accu-
rately determine tissue expression profiles of the
human ER and POLDIP3 genes. High stringency
hybridization with the
32
P-labeled cloned human ER
cDNA probe showed that ER is expressed in all tis-
sues and cell lines examined (Fig. 5A). The level of the
ER transcript showed a very modest variation across
all polyA
+
RNA samples and, in this respect, was
similar to the pattern of the human housekeeping gene
coding for ubiquitin (data provided by the array
manufacturer, Clontech). In adults, the highest level of
the ER transcript was observed in the pituitary gland
and it was 2.5-fold higher than that in the peripheral
blood leukocytes in which the lowest level of the tran-
script was detected. In fetal tissues, the ER transcript
was the most abundant in the lung, whereas in the
brain its level was the lowest (2-fold difference).
After stripping, the array was reprobed for the
POLDIP3 expression with the radiolabeled partial
cDNA probe, which was unable to discriminate between
AB
C
D

est level was observed in the brain (1.7-fold difference).
Yeast two-hybrid analysis of the interaction
between the human proteins ER and PDIP46/
SKAR
In order to analyze the details of the interaction between
the human ER and PDIP46 ⁄ SKAR proteins a series of
constructs (A–K) in the pYESTrp2 plasmid coding for
fragments of the truncated form of the PDIP46 ⁄ SKAR
protein encoded by the L7 insert was generated. In sub-
sequent experiments, each construct was transformed
into the L40 yeast strain expressing the full-length
human ER protein. The interaction between the gener-
ated fragments of PDIP46 ⁄ SKAR and ER was analyzed
by the yeast two-hybrid assay employing the histidine
prototrophy and b-galactosidase assays as earlier. The
positive and negative species are summarized in Fig. 6
as ‘+’ and ‘–’, respectively. The 148 amino acid long
region of PDIP46 ⁄ SKAR that was found to interact
with ER constitutes the C-terminal part of PDIP46 ⁄
SKAR comprising residues 274–421 [PDIP46 ⁄
SKAR(K); all position numbering according to isoform
1 ⁄ a of PDIP46 ⁄ SKAR]. This region is not continuous
and could be further split into two subregions. The
larger one (subregion I) comprised residues 274–368
[PDIP46 ⁄ SKAR(D)] encompassing all amino acids of
the RNA recognition motif (residues 277–348, Fig. 2)
and the smaller one (subregion II) comprised residues
379–421 [PDIP46 ⁄ SKAR(I)] with an at least 10 amino
acid gap between them suggesting a bipartite nature of
the interface on the PDIP46 ⁄ SKAR side.

(upper) and HeLa cells (lower) were transi-
ently transfected with plasmids coding for
ER-EGFP (A), PDIP46(1) ⁄ SKAR(a)-EGFP (B),
PDIP46(2) ⁄ SKAR(b)-EGFP (C) or MEK1-
EGFP used as a control (D) and their
localization was determined by direct
fluorescence of EGFP in living cells. Repre-
sentative images obtained with a confocal
laser scanning microscope are shown.
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4733
molecular partners of ER. In the present study,
employing the yeast two-hybrid screening and using
the human ER as bait, the C-terminal fragment of
PDIP46 ⁄ SKAR was found to interact with ER. The
binding was specific, as only interaction between
PDIP46 ⁄ SKAR and ER was positive, whereas neither
PDIP46 ⁄ SKAR nor ER was able to activate reporter
genes alone or in the presence of negative control pro-
teins. Recombinant PDIP46 ⁄ SKAR and ER were able
to bind each other in vitro in the GST pull-down assay
and ER fused to GST pulled down a protein of
46 kDa from a nuclear extract that was identified as
PDIP46 ⁄ SKAR by tandem mass spectrometry, thus
providing independent confirmations of the interaction
identified by the yeast two-hybrid assay.
Here, we also address the issue of the intracellular
localization of ER. The Xenopus ER was predomin-
antly localized in the cytoplasm with only minute
amounts in the nucleus, whereas DCoH ⁄ PCD was pre-

and detected by indirect immunofluorescence in meth-
anol-fixed cells [4], whereas in the present study the
human ER was EGFP-tagged and direct fluorescence
detection in living cells was performed.
The revised intracellular localization of ER is instru-
mental in validating the results of the performed
screen. Both isoforms of PDIP46 ⁄ SKAR are also
A
B
C
Fig. 5. Comparison of the expression profiles of the ER and
POLDIP3 genes. Array of 76 polyA
+
RNA samples isolated from
various human adult and fetal tissues and cancer cell lines was
hybridized with the radiolabeled ER cDNA probe (A) and after
stripping again with the radiolabeled POLDIP3 cDNA probe (B). The
used POLDIP3 probe detects both POLDIP3 transcripts. The tissue
origin and position of the examined polyA
+
RNAs are shown in (C).
Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR A. Smyk et al.
4734 FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS
localized in the same cell compartment as ER, the nuc-
leus, in a pattern that is hardly distinguishable from
that of ER, thereby arguing in favor of the possibility
of the interaction between ER and PDIP46 ⁄ SKAR in
the cell. Furthermore, both genes, ER and POLDIP3,
coding for PDIP46 ⁄ SKAR are expressed in the same
set of human tissues and cell lines. Therefore, it is

the RNA recognition motif (RRM) in both its iso-
forms showing the highest homology to the Aly ⁄ REF
family of RNA binding proteins so it was named
SKAR for S6K1 Aly ⁄ REF-like target. S6K1 binds
PDIP46 ⁄ SKAR within the RRM (amino acids 277–
348) and phosphorylates two serines at positions 383
and 385 (Fig. 2). Interestingly, we have found that the
bipartite region of PDIP46 ⁄ SKAR interacting with
ER (amino acids 274–421) encompasses both the
RRM (subregion I) and two serines phosphorylated by
S6K1 (subregion II) (Fig. 6). The significance of this
observation is not clear at the present time, however,
a plausible hypothesis is that the interaction of
Fig. 6. Identification of the PDIP46 ⁄ SKAR region interacting with ER using the yeast two-hybrid assay. Yeasts L40 expressing the full-length
ER from the original bait plasmid, pHybLex ⁄ Zeo-ER were transformed with a series of the pYESTrp2-based plasmids coding for fragments
of the truncated form of the PDIP46 ⁄ SKAR protein encoded by the L7 insert [PDIP46 ⁄ SKAR(A-K)] and the b-galactosidase X-gal colony-lift fil-
ter and histidine prototrophy assays were performed. Results are shown as ‘+’ and ‘–’ in the presence (both tests were positive) and
absence (both tests were negative) of the interaction, respectively. The RNA recognition motif (RRM) is shaded in gray. Two serines (383
and 385) phosphorylated by S6K1 are indicated. Numbering is according to isoform 1 ⁄ a of PDIP46 ⁄ SKAR. The dotted lines indicate the ends
of the two subregions capable of interacting with ER individually.
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4735
PDIP46 ⁄ SKAR with ER could block the PDIP46 ⁄
SKAR phosphorylation by S6K1. S6K1 is involved in
the cell and organism growth control; mice with a
knockout in S6K1 display the small mouse phenotype;
a decrease in the size of the whole organism, and over-
expression of S6K1 in mammalian cells results in the
increased cell size [32,33]. PDIP46 ⁄ SKAR seems to be
involved in the same processes because an RNAi

should be noted in this context that the truncated
wings in the Drosophila r mutants display a reduction
in total number of cells per wing and a reduction in
the area of individual cells [8]. If indeed ER is
involved in the cell growth control a mutation in ER
could add to the effects of an r mutation leading to
the enhancement of the wing truncation with no direct
influence on the metabolism of pyrimidines.
Experimental procedures
cDNA cloning and DNA constructs
cDNAs of the human genes, ER and POLDIP3 (both iso-
forms) corresponding to their coding sequences (including
the first ATG and stop codons) were obtained using total
RNA from HeLa cells, AMV reverse transcriptase and
gene-specific primers from 3¢ UTRs of these genes to syn-
thesize the first strand followed by PCR amplifications with
a high-fidelity DNA polymerase, Pfx (Invitrogen, Carlsbad,
CA, USA) and pairs of gene-specific primers from the
beginning and end of their coding sequences, based on
the records from the DDBJ ⁄ EMBL ⁄ GenBank databases
(accession numbers U66871, AL160111 and AL160112;
Table 1). All three PCR products coding for 104 amino
acids (ER), 421 amino acids (isoform 1 ⁄ a of PDIP46 ⁄
SKAR) and 392 amino acids (isoform 2 ⁄ b of PDIP46 ⁄
SKAR) after adding 3¢ A overhangs with Taq DNA polym-
erase were inserted into the pCR2.1 plasmid (Invitrogen),
transformed into the bacterial host strain Escherichia coli
XL1 Blue MRF¢ and their fidelity was verified by nucleo-
tide sequencing.
For the following plasmid constructs all necessary

the stop codon) into PstI site of pEGFP-N1 in-frame with
EGFP. A series of pYESTrp2 ⁄ PDIP46 ⁄ SKAR(A–K) plas-
mids was generated by subcloning the tested fragments of
the L7 cDNA insert (with the stop codon) into BamHI
and NotI sites of pYESTrp2 (Invitrogen) in-frame with
B42. For pEGFP-N1 ⁄ MEK1 the rat MEK1 cDNA was
amplified (with the first ATG codon and without the stop
codon) using the pAX142-MEK1(WT) plasmid [37] as a
Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR A. Smyk et al.
4736 FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS
template and was inserted into HindIII and BamHI sites
of pEGFP-N1 in-frame with EGFP.
Yeast two-hybrid screening
The Hybrid Hunter yeast two-hybrid system from Invitrogen
was employed. The pHybLex ⁄ Zeo-ER plasmid conferring
resistance to zeocin was transformed into the yeast strain
L40 [MATa his3D200 trp1-901 leu2-3112 ade2 LYS2::(4-
lexAop-HIS3) URA3::(8lexAop-lacZ) GAL4]. Five independ-
ent zeocine-resistant transformants expressed the chimeric
protein LexA-ER at the same level [checked in crude lysates
by western blotting by using the anti-(LexA) rabbit polyclo-
nal antibody] and displayed no activation of HIS3 and lacZ
Table 1. Primer sets for construction of plasmids used in this study.
Plasmid Primer set
pCR2.1 ⁄ ER ATTTCATCTAATACAGTC
GCGGGATCCACGATGTCTCACACCATTTTGC
GCGGAATTCTTATTTCCCAGCCTGTTGGGCCTG
pCR2.1 ⁄ PDIP46(1) ⁄ SKAR(a) CTTCTGGCTGCCTCACTCC
GCGCGATATCGCAAGATGGCGGACATCTCCCTGG
CTCAAAGCTTGATTTTGAATTCTGTG

⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) GCGGGATCCCAGCCCATCCTGCTGCGGCTG
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(H) GCGGGATCCCAGCCCATCCTGCTGCGGCTG
ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(I) GCGGGATCCCGCAGGGTGAACTCTGCCTCC
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(J) GCGGGATCCCCCCCTGCCGAAGTGGACCCT
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(K) GCGGGATCCCTCAGCCCATTGGAAGGCACC
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4737
reporter genes (no growth on a minimal medium lacking
histidine and lack of the b-galactosidase activity in the
colony-lift filter assay [38], respectively). A randomly chosen
transformant displaying neither HIS3 nor lacZ activity after
introducing the empty prey plasmid, pYESTrp2 was used
further as a bait strain.
The human lung cDNA expression library in pYESTrp2
(5.95 · 10
6
independent clones, Invitrogen #A213-01) was
transformed into the bait strain according to the manu-
facturer’s recommended protocol with the efficiency of
2.2 · 10
6
tryptophan prototrophs. Using primers specific for
the prey plasmid (included in the Hybrid Hunter kit), cDNA

and production of GST-ER was induced at A
600
of 0.8
(0.1 mm IPTG, 3 h, 37 °C). Cells were harvested by centrif-
ugation, resuspended in lysis buffer recommended by the
resin supplier and lysed by sonication. ER-FLAG was puri-
fied using Ni-nitrilotriacetic acid resin (Qiagen) under
native conditions according to the manufacturer’s protocol
while GST-, GST-PDIP46 ⁄ SKAR(L7)- or GST-ER-coated
beads were purified using glutathione-agarose as suggested
by the supplier (Sigma, St Louis, MO, USA). All purified
proteins were analyzed by SDS ⁄ PAGE followed by staining
with Coomassie brilliant blue, showing near homogeneity.
GST pull-down assay with recombinant proteins
For the GST pull-down assay, GST-PDIP46 ⁄ SKAR(L7)-
coated beads, GST-coated beads or beads alone (20 lLof
the 50% slurry each) were incubated for 2 h at 4 °C with
gentle rotation with ER-FLAG in a final volume of 1 mL
of binding buffer [137 mm NaCl; 20 mm Tris ⁄ HCl, pH 7.5;
10% (v ⁄ v) glycerol; 1% (v ⁄ v) Triton X-100; 2 mm EDTA;
0.1 mm phenylmethanesulfonyl fluoride]. Following incuba-
tion, beads were pelleted and washed four times with 1 mL
of binding buffer and twice with 1 mL of NaCl ⁄ P
i
and
boiled in sample loading buffer. Protein samples were
resolved on a 15% SDS ⁄ polyacrylamide gel and electro-
blotted to a poly(vinylidene difluoride) membrane (Bio-
Rad, Hercules, CA, USA). The membrane was incubated
with the anti-FLAG epitope M2 monoclonal antibody

12 mL of binding buffer 1 ⁄ 10 of bound protein was
resolved on a 10% SDS ⁄ polyacrylamide gel and stained
with silver [40].
Mass spectrometry
A protein band was excised from a gel and analyzed by
tandem mass spectrometry at Laboratory of Mass Spectr-
ometry, Institute of Biochemistry and Biophysics PAS,
Warsaw, Poland. Briefly, after reduction and alkylation by
dithiothreitol and iodoacetamide, respectively, the protein
was in-gel digested with trypsin [42]. The resulting pep-
tides were analyzed on a nano-HPLC-ESI-LTQ-FT-ICR
platform (a Finnigan LTQ FT hybrid mass spectrometer;
Thermo, Waltham, MA, USA) using collision-induced
dissociation for ion fragmentation. For protein identifica-
tion MS ⁄ MS spectra were searched against the NCBInr
database by using the mascot algorithm (Matrix Science,
London, UK) [41] supplemented by manual analysis of
spectra.
Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR A. Smyk et al.
4738 FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS
Mammalian cell transfections and EGFP
visualization
Human HeLa cells were maintained in Dulbecco’s modified
Eagle’s medium with 10% (v ⁄ v) fetal bovine serum and anti-
biotics (100 UÆmL
)1
penicillin and 100 lgÆmL
)1
streptomy-
cin) on plates in a humidified 5% carbon dioxide atmosphere

32
P]dATP[aP] (Amersham) with a QIA-
quick nucleotide removal kit (Qiagen). High stringency
hybridization was carried out in a rotation hybridization
oven at 65 °C overnight. Denatured human C
0
t1 DNA
(Roche, Mannheim, Germany), sheared salmon testis DNA
(Sigma) and 1.5 · 10
7
c.p.m. of the radiolabeled probe were
added to PerfectHyb Plus hybridization buffer (Sigma). The
membrane was washed at 65 °C four times for 20 min with
2· NaCl ⁄ Cit, 1% SDS and twice for 10 min with 0.5·
NaCl ⁄ Cit, 0.1% SDS and exposed for three days to an
X-ray film with an intensifying screen at )70 °C. Stripping
of the membrane was performed according to the manufac-
turer’s instructions. After assuring of the positive result of
the stripping procedure by another exposure to an X-ray
film, the array was reprobed with the labeled 237 bp frag-
ment of POLDIP3 corresponding to amino acids 280–358
of isoform 1 ⁄ a of PDIP46 ⁄ SKAR as above. The autoradio-
grams were digitized and the signal intensities were quanti-
tated using the quantity one software (Bio-Rad).
Acknowledgements
We thank Dr A. Czubaty for advice on the GST pull-
down from a nuclear extract, Drs M. Dadlez and
J. Debski for help with the mass spectrometry analysis,
and Drs S. Bartoszewski, R. Derlacz and J. Fronk for
critical reading of the manuscript. This work was

8 Fausto-Sterling A & Hsieh L (1976) Studies on the
female-sterile mutant rudimentary of Drosophila melano-
gaster. I. An analysis of the rudimentary wing pheno-
type. Dev Biol 51, 269–281.
9 Porter LA & Rawls JM Jr (1984) The Dhod locus of
Drosophila: mutations and interrelationships with other
loci controlling de novo pyrimidine biosynthesis. Mol
Gen Genet 193, 27–32.
10 Lastowski DM & Falk DR (1980) Characterization of
an autosomal rudimentary-shaped wing mutation in
Drosophila melanogaster that affects pyrimidine synth-
esis. Genetics 96, 471–478.
11 Tsubota SI & Fristrom JW (1981) Genetic and
biochemical properties of revertants at the r locus in
Drosophila melanogaster . Mol Gen Genet 183, 270–276.
A. Smyk et al. Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR
FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS 4739
12 Mendel DB, Khavari PA, Conley PB, Graves MK,
Hansen LP, Admon A & Crabtree GR (1991)
Characterization of a cofactor that regulates dimerization
of a mammalian homeodomain protein. Science 254,
1762–1767.
13 Citron BA, Davis MD, Milstien S, Gutierrez J, Mendel
DB, Crabtree GR & Kaufman S (1992) Identity of
4a-carbinolamine dehydratase, a component of the
phenylalanine hydroxylation system, and DCoH, a
transregulator of homeodomain proteins. Proc Natl
Acad Sci USA 89, 11891–11894.
14 Thony B, Auerbach G & Blau N (2000) Tetrahydro-
biopterin biosynthesis, regeneration and functions.

20 Li H, Inoue M, Yabuki T, Aoki M, Seki E, Matsuda T,
Nunokawa E, Motoda Y, Kobayashi A, Terada T,
Shirouzu M, Koshiba S, Lin YJ, Guntert P, Suzuki H,
Hayashizaki Y, Kigawa T & Yokoyama S (2005) Solu-
tion structure of the mouse enhancer of rudimentary
protein reveals a novel fold. J Biomol NMR 32, 329–334.
21 Seehaus K & Tenhaken R (1998) Cloning of genes by
mRNA differential display induced during the
hypersensitive reaction of soybean after inoculation with
Pseudomonas syringae pv. Glycinea. Plant Mol Biol 38,
1225–1234.
22 Graves LM, Guy HI, Kozlowski P, Huang M,
Lazarowski E, Pope RM, Collins MA, Dahlstrand EN,
Earp HS & 3rd & Evans DR (2000) Regulation of
carbamoyl phosphate synthetase by MAP kinase.
Nature 403, 328–332.
23 Liu L, Rodriguez-Belmonte EM, Mazloum N, Xie B &
Lee MYWT (2003) Identification of a novel protein,
PDIP38, that interacts with the p50 subunit of DNA
polymerase d and proliferating cell nuclear antigen.
J Biol Chem 278, 10041–10047.
24 Richardson CJ, Broenstrup M, Fingar DC, Julich K,
Ballif BA, Gygi S & Blenis J (2004) SKAR is a specific
target of S6 kinase 1 in cell growth control. Curr Biol
14, 1540–1549.
25 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang
Z, Miller W & Lipman DJ (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25, 3389–3402.
26 Burd CG & Dreyfuss G (1994) Conserved structures

Dev 16 , 1472–1487.
34 Leighton IA, Dalby KN, Caudwell FB, Cohen PTW &
Cohen P (1995) Comparison of the specificities of p70,
S6 kinase and MAPKAP kinase-1 identifies a relatively
specific substrate for p70, S6 kinase: the N-terminal
kinase domain of MAPKAP kinase-1 is essential for
peptide phosphorylation. FEBS Lett 375, 289–293.
35 Maniatis T & Reed R (2002) An extensive network of
coupling among gene expression machines. Nature 416 ,
499–506.
Enhancer of rudimentary interacts with PDIP46 ⁄ SKAR A. Smyk et al.
4740 FEBS Journal 273 (2006) 4728–4741 ª 2006 The Authors Journal compilation ª 2006 FEBS
36 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
37 Whitehead IP, Lambert QT, Glaven JA, Abe K,
Rossman KL, Mahon GM, Trzaskos JM, Kay R, Der
Campbell SL & CJ (1999) Dependence of Dbl and Dbs
transformation on MEK and NF-jB activation. Mol
Cell Biol 19, 7759–7770.
38 Breeden L & Nasmyth K (1985) Regulation of the yeast
HO gene. Cold Spring Harb Symp Quant Biol 50, 643–
650.
39 Czubaty A, Girstun A, Kowalska-Loth B, Trzcinska
AM, Purta E, Winczura A, Grajkowski W & Staron K
(2005) Proteomic analysis of complexes formed by human
topoisomerase I. Biochim Biophys Acta 1749, 133–141.
40 Shevchenko A, Wilm M, Vorm O & Mann M (1996)
Mass spectrometric sequencing of proteins from silver-
stained polyacrylamide gels. Anal Chem 68, 850–858.