Limited mutagenesis increases the stability of human
carboxypeptidase U (TAFIa) and demonstrates the
importance of CPU stability over proCPU concentration
in down-regulating fibrinolysis
Wolfgang Knecht
1
, Johan Willemse
3
, Hanna Stenhamre
1
, Mats Andersson
2
, Pia Berntsson
1
,
Christina Furebring
2
, Anna Harrysson
1
, Ann-Christin Malmborg Hager
2
, Britt-Marie Wissing
1
,
Dirk Hendriks
3
and Philippe Cronet
1
1 AstraZeneca R & D Mo
¨
lndal, Mo
lndal, 431 83 Mo
¨
lndal, Sweden
Fax: + 46 317763753
Tel: + 46 317065341
E-mail: [email protected]
(Received 5 November 2005, accepted
19 December 2005)
doi:10.1111/j.1742-4658.2006.05110.x
Procarboxypeptidase U [proCPU, thrombin-activatable fibrinolysis inhib-
itor (TAFI), EC 3.4.17.20] belongs to the metallocarboxypeptidase family
and is a zymogen found in human plasma. ProCPU has been proposed to
be a molecular link between coagulation and fibrinolysis. Upon activation
of proCPU, the active enzyme (CPU) rapidly becomes inactive due to its
intrinsic instability. The inherent instability of CPU is likely to be of major
importance for the in vivo down-regulation of its activity, but the under-
lying structural mechanisms of this fast and spontaneous loss of activity of
CPU have not yet been explained, and they severely inhibit the structural
characterization of CPU. In this study, we screened for more thermostable
versions of CPU to increase our understanding of the mechanism underly-
ing the instability of CPU’s activity. We have shown that single as well as
a few 2–4 mutations in human CPU can prolong the half-life of CPU’s
activity at 37 °C from 0.2 h of wild-type CPU to 0.5–5.5 h for the mutants.
We provide evidence that the gain in stable activity is accompanied by a
gain in thermostability of the enzyme and increased resistance to proteo-
lytic digest by trypsin. Using one of the stable mutants, we demonstrate
the importance of CPU stability over proCPU concentration in down-regu-
lating fibrinolysis.
Abbreviations
BEVS, Baculovirus expression vector system; CLT, clot lysis time; CPB, carboxypeptidase B; CPU, carboxypeptidase U; EPP, error prone
prevented crystallization of CPU and the use of struc-
turally based drug design methods. A three-dimen-
sional model of human proCPU based on the structure
of human pancreas procarboxypeptidase B, a closely
related protease exhibiting a higher stability, has been
published recently by Barbosa Pereira et al. [17].
Recently, it was reported independently by two
separate groups that CPU prevents clot lysis from
proceeding into the propagation phase through a
threshold-dependent mechanism [18,19]. The study of
this threshold phenomenon and, more generally, the
study of the effect of CPU on fibrinolysis, are also
severely complicated by its intrinsic instability of
activity.
‘Directed evolution’ approaches allow the random
generation of a large number of mutants followed by
selection for the desired features. Several proteins have
been changed towards more desired properties using this
approach. Some examples include deoxyribonucleo-
side kinases for changed substrate specificities [20,21],
phosphotriesterase for improved catalytic rates [22],
haem peroxidase for exotic environments (for example,
inside a washing machine) [23], or amylase and sub-
tilisin for improved thermostability [24,25].
In this study, we present the generation of CPU
mutants with highly stable activity obtained by
molecular evolution techniques and selection for
decreased thermo-inactivation. To achieve this we used
a directed evolution approach comprising the genera-
tion of random libraries and recombination of advan-
B (CPB) [26] (Fig. 2), these mutants were chosen to
replace hydrophobic amino acids of human CPU with
more hydrophilic residues located on the surface of
porcine CPB. In addition, the T347I naturally occur-
ring variation in CPU was reported to double the
half-life (T1 ⁄ 2) of its activity at 37 °C [11] and was
therefore included. We found that the T347I mutant,
when tested in cell culture supernatant, was only 50%
more stable than our WT CPU with threonin at posi-
tion 347 (Table 1). Recently, Barbosa Pereira et al.
[17] proposed, on the basis of their model of human
CPU, that the two consecutive I at positions 204 and
205 are exposed to the surface, and because they are
quite unique to CPU, might be of importance for the
process of CPU’s activity destabilization. When we
changed these two amino acids to their counterpart in
porcine CPB (I204Y ⁄ I205E), the T1 ⁄ 2 of the mutants’
activity was unchanged compared with WT CPU (data
not shown).
In order to create a high number of mutants, ran-
dom mutagenesis was done using either error prone
PCR (EPP) or creating a library of mutants with the
Genemorph PCR mutagenesis kit (GMK, Stratagene,
La Jolla, CA, USA). Sequencing of the full open read-
ing frame (ORF) of randomly picked clones from these
two approaches revealed a base mutation frequency of
0.41 ± 0.22% and 0.55 ± 0.23% per clone in 19
clones from the EPP library and in 17 clones from the
Fig. 2. Multiple alignment of human preproCPU, human preproCPB and porcine proCPB. The amino acid sequences of human preproCPU
(accession number AAP35582.1), human preproCPB (accession number P15086) and porcine proCPB (accession number 1NSA) were
izing mutations identified in the first screening step
(Table 1) FIND
TM
was used. For the first round of
FIND
TM
approach, the following clones from Table 1
were used in two different combinations: in F1.1:
EPP1, EPP2, GMK1, GMK2 and, in F1.2: all clones
in Table 1 except WT. FIND
TM
libraries were
expressed and 5000 clones of each library screened for
improved thermostability. Table 2 summarizes clones
derived from this step. As shown in Table 2, six clones
with improved T1 ⁄ 2 of their activity compared to the
parental clones could be found in the F1.1 treatment,
while only two clones were found in the F1.2 treat-
ment with improved or equal properties, despite the
higher number of clones put into this library. It should
also be mentioned here that the FIND
TM
treatment
not only recombined existing mutations, but also intro-
duces new mutations as observed in six out of the
eight selected clones (Table 2).
To ascertain the combination of mutations that are
very close in sequential space, the GMK2 clone
(Table 1) was modified by site-directed mutagenesis to
create the mutants YQ and YP, and the T1⁄ 2 of their
Clone
Amino acid
changes
in CPU
T1 ⁄ 2at
37 °C
(min)
Method of
generation
EPP1 K166N, H357Q 31 Error prone PCR
EPP2 I251T, H357P 31 Error prone PCR
EPP3 I180F
a
, H357Q 55 Error prone PCR
GMK1 H315R, S327C 60 Genemorph
GMK2 H355Y 47 Genemorph
A L376Q 16 Site-directed
B T347I 18 Site-directed
WT – 12
a
This mutation was not present in all PCR products derived from
this clone.
Table 2. Half-life (T1 ⁄ 2) of different CPU mutants’ activity at 37 °C
derived from the first round of FIND
TM
treatment and site-directed
mutagenesis. WT and mutant CPU were expressed in 3T3 cells
and their stability was accessed in the cell culture supernatant. The
remaining enzymatic activity after incubation of CPU or its mutants
at 37 °C was determined using a HPLC assay. New mutations, not
and 3). Libraries created from these clones by FIND
TM
technology were expressed, screened and characterized
as described in material and methods. A total of about
14 200 clones were screened. Table 4 summarizes clones
derived from this second round of FIND
TM
. The
same mutation combination as in the best clone made
by site-directed mutagenesis (YQ + S327C) was also
generated by this second round of FIND
TM
treatment
and identified by the screening. The subsequently
increased activity stabilization during the different steps
of directed evolution and screening is illustrated in
Fig. 3, displaying the most stable clones found in each
step.
From the mutants created, seven clones (F1.2.A;
F1.1.F, YQ, YQ + S327C, F1.2.A + R315H,
F1.1.F + N348S, F1.1.F + H355Y) were chosen for
expression using the BEVS and purification of the
mutants for analysis as purified protein. WT proCPU
and mutants were expressed in Sf9 insect cells as
C-terminal His-tagged proteins and purified from the
supernatant of a 1-L culture using IMAC. Figure 4
shows as examples the homogenity of the WT
proCPU-CHis and YQ proCPU-CHis preparations
(0-min samples).
The parameters determined for these mutants are
H357Q
0.7 (2.2)
F1.2.A + R315H
b
S327C, H355Y 4.3 (2.2)
F1.1.F + N348S
b
S327C, H357Q 2.4 (2.9)
F1.1.F + H355Y
b
S327C, S348N, H355Y,
H357Q
4 (2.9)
F1.1.F + S327P S327P, S348N, H357Q 0.3
c
(2.9)
YQ + S348N S348N, H355Y, H357Q 2.4 (3)
YQ + T347I T347I, H355Y, H357Q 3.5 (3)
YQ + S327P S327P, H355Y, H357Q 1.1 (3)
YQ + N350S N350S, H355Y, H357Q 1.4 (3)
YQ + S327C
b,d
S327C, H355Y, H357Q 26 (3)
WT – 0.2
a
Very low expression level did not allow T1 ⁄ 2 determinations for
GMK2 + T347I.
b
These mutants were expressed in insect cells and
have an 8xHis tag as described in Experimental procedures.
T1 ⁄ 2at
37 °C (h)
F2.A I251T, H355Y, H357Q 2
F2.B
I204T, Y230C, S348N,
H357Q
2.9
F2.C
a
S327C, H355Y, H357Q 6.8
WT – 0.2
a
Identical to YQ + S327C (see Table 3).
Stable human CPU mutants W. Knecht et al.
782 FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS
incubation at 22 °C for 24 h (Table 5). Mutants
YQ + S327C, F1.2.A and F1.1.F + H355Y were
again the most stable and only one mutant, F1.1.F +
N348S, lost more than 50% of its activity.
In order to exclude profound effects of the muta-
tions on enzymatic activity and inhibitor binding affin-
ity, the K
m
for hippuryl-l-arginine (Hip-Arg), the
specific activity at 24 mm Hip-Arg and the IC
50
for the
specific inhibitor PCI were determined. As can be seen
in Table 5, the K
m
°C(h)
Activity left after
24 h at 22 °Cin
% (mean ± SD)
K
m
(mM)
Specific
activity
(UÆmg
)1
)
IC
50
PTCI
(l
M)
WT 0.2 (0.2) 20 ± 11 2.2 53 (1.9) 0.2
F1.2.A R C Y 5.2 (2.2) 89 ± 8.9 3.7 98 (2.4) 0.04
F1.1.F C N Q 2.2 (2.9) 56 ± 6.3 0.7 41 (1.8) 0.13
YQ Y Q 1.5 (3) 78 ± 7.9 0.9 88 (1.6) 0.16
YQ + S327C C Y Q 5.5 (26; 6.8) 81 ± 7.8 1.1 121 (2.3) 0.16
F1.2.A + R315H C Y 1.3 (4.3) 63 ± 2.2 1.5 150 (2.5) 0.06
F1.1.F + N348S C Q 1 (2.4) 45 ± 3.3 0.6 64 (3.7) 0.12
F1.1.F + H355Y C N Y Q 4.9 (4) 86 ± 6.6 1 89 (4.4) 0.18
W. Knecht et al. Stable human CPU mutants
FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS 783
the same level as for WT-proCPU until it is cleaved
away and proCPU activated to CPU. The activities
ranged from 1.6 to 4.4 UÆmg
YQ proCPU-CHis. The drop in T
m
from pH 7.4 to
pH 4.5 was 12.8 °C for WT proCPU-CHis but only
2.3 °C for YQ proCPU-CHis. This indicates a role of
H355 and ⁄ or H357 in the thermal stability of proCPU.
Furthermore, we digested WT proCPU-CHis and YQ
proCPU-CHis with bovine trypsin (Fig. 4), which
resulted in the case of WT proCPU-CHis in one
prominent degradation product of approximately
25 kDa and a weak, probably intermediate band at
about 38 kDa (arrows in Fig. 4A), while for YQ
proCPU-His, a strong band at 38 kDa became visible
but none was visible at about 25 kDa. Subsequently,
N-terminal sequencing of these bands identified a clea-
vage site between R352 and Y353 in WT proCPU-
CHis, but not in the YQ mutant. Consequently, the
two mutations of YQ make the mutant less sensitive
to tryptic digestion close to the positioning of its two
mutations.
Next, we compared the affinity of the enzyme for
synthetic and physiological substrates, and determined
the K
m
constants of native CPU from plasma, recom-
binant WT CPU and YQ CPU for Hip-Arg and bra-
dykinin using an arginine kinase-based kinetic assay
[27]. Data are presented in Table 6. No differences
were seen in the K
m
K
m
values are expressed in lMÆL
)1
and are the mean ± SEM of a
duplicate measurement.
Native CPU WT YQ
Bradykinin 39 ± 2 44 ± 6 35 ± 5
Hip-Arg 840 ± 21 825 ± 44 774 ± 39
Stable human CPU mutants W. Knecht et al.
784 FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS
The hypothesis that CPU down-regulates fibrinolyis
by a threshold dependent mechanism was recently pub-
lished [18,19]. As long as the CPU activity remains
above this threshold (reported to be 8 UÆL
)1
), fibrinoly-
sis does not accelerate but stays in its initial phase [19].
The study of this threshold phenomenon is severely
complicated by the intrinsic instability of CPU’s activ-
ity. YQ proCPU-CHis was consequently tested for its
antifibrinolytic potential in an in vitro clot lysis assay
and used for confirmation of the threshold hypothesis.
We reconstituted proCPU-depleted plasma with
increasing amounts of the activated stable YQ mutant
or with WT CPU (CPU activities ranging from 0 to
237 UÆL
)1
) and used these in clot lysis experiments, as
described previously [19,28]. Recovery of the added
different YQ CPU concentrations. Increasing the
enzyme activity below the ‘threshold value’ did not
show a significant increase in CLT. However, each
doubling of the CPU activity in excess of the ‘thresh-
old value’ increased CLT with one CPU mutant half
life. Plotting log (CPU activity added) versus CLT
clearly confirms the CPU threshold hypothesis. The
estimated threshold value in our experiments was
12 UÆL
)1
which corresponds very well with the
8UÆL
)1
described by Leurs et al. [19].
Figure 7 illustrates the linear relationship between
CPU stability and CLT. Adding 40 UÆL
)1
WT CPU to
proCPU-depleted plasma increases CLT by 22 min.
However, the addition of 40 UÆL
)1
YQ CPU (with a
7.5- fold increased stability) increases CLT by
153 min, which corresponds very well with the increase
one theoretically can expect (i.e. 7.5 · 22 min). When
the selective CPU inhibitor PTCI (20 lgÆmL
)1
) was
added from the start, no significant prolongation of
CLT was seen by adding YQ or WT CPU.
numerous potentially exposed hydrophobic amino
acids in CPU. Exposed hydrophobic residues lead to
aggregation, and replacing exposed hydrophobic resi-
dues with more polar residues has been reported to
stabilize proteins [29,30]. Of the 12 hydrophobic to
hydrophilic point mutations carried out in CPU, only
one, L376Q (clone A), had a stabilizing effect, in this
case, of about 33%. All the other mutants either did
not change the T1 ⁄ 2 of CPU’s activity more than
± 20%, or, in the case of I147S, did not express at all
(data not shown), suggesting that the instability does
not result from hydrophobically driven aggregation of
the protein. This is further confirmed by the existence
of a natural variant of CPU, where T347 is subsituted
by an I. Although accentuating the hydrophobic
character of the protein surface, the mutation induces
a stabilization of the protein (Table 1 and [11]).
Random evolution of the enzyme has allowed us to
identify mutants of 2.5 to five-fold increased T1 ⁄ 2in
activity (Table 1), with one or two mutations per clone.
The following first round of FIND
TM
treatment pro-
longed T1⁄ 2 from 12 min for the WT to 4.4 h for clone
F1.1.C. Further combination by rational site-directed
deletion or addition of mutations (Table 3) resulted in
more than half of the cases in a decrease of T1 ⁄ 2. A fur-
ther round of FIND
TM
treatment did not improve T1 ⁄ 2
6.8 h in mammalian cell culture medium and 26 h in
insect cell culture medium. For mutants containing the
S327C mutation, conditions, such as pH, determining
how fast oxidation of the cystein might occur, may
play a role.
Because most of the purification and in vitro assays
are carried out at room temperature, we also determined
the activity after 24-h incubation at 22 °C. Of all puri-
fied mutants, three showed a remaining activity of more
than 80% after 24-h incubation at 22 °C versus 20% for
the WT, and two of these three showed a more than 25-
fold increase in T1 ⁄ 2 of activity at 37 °C. The decreased
K
m
and mostly increased specific activity may partially
reflect the improved stability of activity, especially at
low substrate concentrations during K
m
determinations,
resulting in a higher velocity than for WT CPU and
thereby decreasing the observed K
m
in comparison to
WT CPU. This hypothesis is supported by the use of
a newly developed continuous coupled enzyme assay
instead of the discontinuous HPLC assay that demon-
strated similar K
m
values of the native and WT, and the
YQ mutant CPU with a synthetic and physiological
here and the reasons for the increased stability of
activity if connected to structural changes be rationally
explained? The three residues correspond to P300,
Y327 and P329 in porcine CPB (numbering according
to Fig. 2). Keeping a strict orientation of the side
chains, replacing P300 with a serine would leave the
H-bond to the OH group of the side-chain nonsatis-
fied, thereby destabilizing the protein. Based on the
CPB structure, H355 lies in close proximity to a cluster
of charged residues: R324, K326, H330 and E360.
Introducing a Q at position 355 is likely to favour the
formation of H-bonds with one or several of these resi-
dues, attenuating the charge repulsions between some
of the basic amino acids. The stabilization induced by
the replacement of H357 by a Y is more difficult to
explain, but the aromatic nature of the side chain is
likely to interact favourably with the hydrophobic clus-
ter made up of I316, F318, A337 and V341. Another
contribution to the low stability of the WT proCPU is
the close spatial proximity of the three His residues at
330, 355 and 357. In the YQ mutant, two histidines
are replaced by nonionizable amino acids. Although
not very pronounced at physiological pH, partial
charges on the His could induce a destabilizing
charge–charge repulsion effect. This hypothesis is sup-
ported by the findings that WT proCPU-CHis is less
stable in thermal unfolding at low pH, when H330,
H355 and H357 would be protonated, while the drop
of stability of YQ proCPU-CHis is a lot less pro-
nounced (Fig. 5b).
FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS 787
provides a good estimation of why the CPU stability is
a more important factor than the proCPU concentra-
tion in prolonging CLT and the linear relationship
between CPU stability and clot lysis time was
clearly demonstrated (Fig. 7). Because increased antifi-
brinolytic activity and a higher risk of thrombosis can
theoretically be caused by a higher proCPU level or,
more importantly, by increased CPU stability (e.g.
related to the 347 Thr ⁄ Ile polymorphism), the study of
the naturally occurring functional polymorphism at
position 347 should be included in clinical settings
evaluating proCPU as a thrombotic risk factor.
In summary, of seven selected and purified mutants,
three showed a remaining activity of more than 80%
after 24 h incubation at 22 °C versus 20% for the WT;
two of these showed a more than 25-fold increase in
half-life activity at 37 °C. The mutants harbour a lim-
ited number of mutations, presumably on the surface
of the molecule, and present sufficiently similar enzy-
matic activity to be comparable to the WT molecule.
In vitro characterization of YQ in comparison with WT
CPU with respect to activation, physiological CPU
substrates like bradykinin and in clot lysis assays
revealed no differences between mutant and WT CPU,
except for a prolongation of clot lysis time proportional
to the increase in T1⁄ 2 of activity of the mutant. The
YQ mutant was also used to demonstrate the import-
ance of CPU stability over proCPU concentration in
down-regulating fibrinolysis. It is therefore very likely
using the Genemorph PCR mutagenesis kit (Stratagene)
according to the manufacturer’s instructions.
Random recombination of mutated preproCPU
cDNAs
Random recombination of mutated preproCPU cDNAs
was performed using in vitro molecular evolution of protein
function procedure (now known as Fragment-INduced
Diversity (FIND
TM
) technology) according to the methods
disclosed in UK Patent Publication No. GB 2370 038 A
(UK Patent Office, London, UK).
Generation of stable mouse cell lines expressing
proCPU and mutant proCPUs
A retroviral gene delivery and expression system was used to
express proCPU and mutant proCPUs. The WT and mutant
preproCPU cDNA pooled from directed or random muta-
genesis or FIND
TM
treatment were ligated into the multiple
cloning site of a retroviral vector [pFB-neo (Stratagene)].
DNA of the retroviral vectors was transformed into
XL1-Blue electroporation-competent cells (Stratagene)
according to the manufacturer’s instructions. The resulting
colonies were cultured (3 h, 37 °C, 220 r.p.m.) for subse-
quent plasmid purification.
3T3 cells (ATCC, Boras, Sweden) and a MMLV-based
packaging cell line suitable for use with the retroviral vector
[35] were cultured (37 °C, 5% CO
2
Stable human CPU mutants W. Knecht et al.
788 FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS
Screening for decreased CPU thermoinactivation
Ten microlitres of supernatant from the cultivation plates
was transferred to 384-well microtitre plates using a
Multimek pipetting robot (Beckman Coulter, Fullerton,
CA, USA). Activation of proCPU to CPU was achieved by
addition of 5 lL (24 nm thrombin from human plasma,
Sigma-Aldrich and 48 nm thrombomodulin from rabbit
lung (American Diagnostica, Stanford, CT, USA) in 20 mm
Hepes pH 7.4 containing 5 mm CaCl
2
and incubated at
room temperature for 10 min. The activation was stopped
by addition of 5 lL20lm phenylalanyl-prolyl-arginyl-
chloromethyl ketone (Calbiochem, Darmstadt, Germany) in
20 mm Hepes pH 7.4 containing 5 mm CaCl
2
.
The thermal stability was assessed by incubating activa-
ted CPU at 37 °C for 20–240 min and determining the
activity of CPU before and after the incubation period
using a colorimetric assay allowing high throughput (hippu-
ricase assay, Professor D. Hendriks, University of Antwer-
pen, Belgium) [37].
Clones that showed significantly higher activity
after the selected time-period than the WT or the best
parental clones used in generation of the libraries
screened were picked and transferred to new 384-well
microtitre plates.
land) according to the manufacturer’s instructions. The PCR
products were subcloned into pGEM-T for sequencing.
Expression of WT proCPU in insect cells
To express WT proCPU, the ORF of preproCPU was
amplified in a PCR reaction using pAM245 as the template
and the following primers: forward: CPU-for1 (tgctctagagcg
gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-
rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat
gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga
tgatgatgatgatgatgct tatcgtcatcgtcc).
The resulting PCR fragment was digested with
NotI ⁄ KpnI and ligated into the NotI ⁄ KpnI sites of pFAST-
Bac1 (Invitrogen). The primers C-HIS1rev and C-HIS2rev
introduced the coding sequence for an octa-His tag at the
C-terminus of proCPU (amino acid sequence of the tag:
LEPGDDDDKHHHHHHHHSGS). The resulting plasmid
was named pAM1079. Recombinant Baculovirus for
expression of recombinant proCPU with C-terminal octa-
His tag (proCPU-CHis) was generated starting from
pAM1079 with the Bac-to-Bac
Ò
Baculovirus Expression
System (Invitrogen), according to the manufacturer’s
instructions.
Expression of mutant proCPUs in insect cells
The ORF of selected mutant preproCPUs were amplified
by PCR using the following primers: forward: GateCPUfor
(ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca
gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate-
HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat
SF9 insect cells (Invitrogen) were kept in shaker culture
(27 °C, 105 r.p.m.) in Sf-900II SFM medium (Invitrogen)
and were infected at a multiplicity of infection (MOI) > 1.
The supernatant was harvested after 3–5 days by centrifuga-
tion for 45 min at 6000 g. The supernatant was subsequently
concentrated approximately four times using vivaflow
50 units with a MWCO 10.000 (Vivascience, Hannover,
Germany). The concentrated supernatant was dialyzed over-
night against 50 mm NaH
2
PO
4
, 300 m m NaCl pH 7 (buffer
A). The dialyzed supernatant was loaded on a Talon
TM
Superflow
TM
(Clontech, Mountain View, CA, USA) column.
The column was first washed with five column-volumes of
buffer, then with a gradient up to 45 mm imidazole in buffer
A (five column-volumes), followed by five column–volumes
of 45 mm imidazole in buffer A. Elution of proCPU-CHis
was carried out by a linear gradient (two column-volumes)
from 45 to 125 mm imidazole in buffer A.
ProCPU-CHis containing fractions were pooled and buf-
fer exchanged into 20 mm Hepes, 150 mm NaCl, pH 7.4,
using PD10 columns (Amersham Biosciences, Uppsala,
Sweden) according to the manufacturer’s instructions.
Characterization of purified WT and mutant
proCPUs
is the concentration x, where y ¼ 50%.
K
m
was measured using the HPLC assay with activated
(mutant) CPUs (activation as described above) using the
substrate Hip-Arg and the substrate concentration was
plotted against rate (product) formation. The Michaelis-
Menten equation was then fitted to the data using non-
linear fitting in GraFit 4.0. The specific activity of the
purified proteins was determined with 24 mm Hip-Arg. K
m
constants of WT, YQ and native CPU for Hip-Arg and
bradykinin were also determined using a coupled enzyme
assay for CPU activity [27]. One unit of enzyme activity
was defined as the amount of enzyme required to hydro-
lyze 1 lmol of Hip-Arg per minute at 37 °C under the
conditions described.
Further characterization of a selected mutant (YQ)
K
m
constants of YQ CPU-CHis for Hip-Arg and bradyki-
nin were also determined using a coupled enzyme assay for
CPU activity [27] and compared with WT CPU-CHis and
native CPU (purified according to the protocol described
by Schatteman et al. [6]).
Thermal unfolding of WT and YQ proCPU-CHis was
monitored using the fluorescent dye Sypro orange (Molecu-
lar probes) at 10Æ concentration and 15 lgÆmL
)1
protein in a
Polyclonal antiproCPU antibodies from rabbit have been
described previously [39]. Two milligrams of antiproCPU
antibodies were coupled to 0.5 g CNBr-activated Sepharose
(Amersham), as described by the manufacturer. Twenty-five
millilitres of human citrated plasma was incubated with
1 mL of antiproCPU sepharose for 2 h at room tempera-
ture and the gel slurry was then separated from the plasma
by filtration. This was repeated twice more. The depleted
plasma showed no measurable proCPU, as detected by the
reference HPLC-assisted assay.
ProCPU-depleted plasma was reconstituted with increas-
ing amounts of activated WT and YQ proCPU (CPU activ-
ities ranging from 0 to 237 U L
)1
) and used in clot-lysis
experiments, as described by Leurs et al. [19] with some
Stable human CPU mutants W. Knecht et al.
790 FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS
minor modifications [28]. Briefly, in each well of a 96-well
microtitre plate, 70 lL proCPU depleted plasma was mixed
with 20 lL t-PA in 20 mm Hepes, 0.1% Tween 20 pH 7.4
(final t-PA concentration 40 ngÆmL
)1
). Forty microlitres
0.9% NaCl and 10 lL activated WT or YQ in 20 mm He-
pes, 5 mm CaCl
2
pH 7.4 were added, and subsequently
clotting was initiated by adding 20 lL 100 mm CaCl
2
3 Nesheim M (2003) Thrombin and fibrinolysis. Chest
124, 33S–9S.
4 Schatteman K, Goossens F, Leurs J, Verkerk R,
Scharpe S, Michiels JJ & Hendriks D (2001)
Carboxypeptidase U at the interface between coagula-
tion and fibrinolysis. Clin Appl Thromb ⁄ Hemost 7,
93–101.
5 Eaton DL, Malloy BE, Tsai SP, Henzel W & Drayna D
(1991) Isolation, molecular cloning, and partial charac-
terization of a novel carboxypeptidase B from human
plasma. J Biol Chem 266, 21833–21838.
6 Schatteman KA, Goossens FJ, Scharpe SS & Hendriks
DF (2000) Proteolytic activation of purified human pro-
carboxypeptidase U. Clin Chim Acta 292, 25–40.
7 Bajzar L, Manuel R & Nesheim ME (1995) Purification
and characterization of TAFI, a thrombin-activable
fibrinolysis inhibitor. J Biol Chem 270, 14477–14484.
8 Redlitz A, Tan AK, Eaton DL & Plow EF (1995)
Plasma carboxypeptidases as regulators of the plasmino-
gen system. J Clin Investig 96, 2534–2538.
9 Wang W, Boffa MB, Bajzar L, Walker JB & Nesheim
ME (1998) A study of the mechanism of inhibition of
fibrinolysis by activated thrombin-activable fibrinolysis
inhibitor. J Biol Chem 273, 27176–27181.
10 Wang W, Hendriks DF & Scharpe SS (1994) Carboxy-
peptidase U, a plasma carboxypeptidase with high affi-
nity for plasminogen. J Biol Chem 269, 15937–15944.
11 Schneider M, Boffa M, Stewart R, Rahman M, Kos-
chinsky M & Nesheim M (2002) Two naturally occur-
ring variants of TAFI (Thr-325 and Ile-325) differ
the fibrinolytic system is modulated by basic carboxypep-
tidases, but the magnitude of the antifibrinolytic effect of
activated thrombin-activable fibrinolysis inhibitor is
masked by its instability. J Biol Chem 279, 27896–27904.
19 Leurs J, Nerme V, Sim Y & Hendriks D (2004) Carbox-
ypeptidase U (TAFIa) prevents lysis from proceeding
into the propagation phase through a threshold-depen-
dent mechanism.[see comment]. J Thromb Haemost 2,
416–423.
20 Knecht W, Munch-Petersen B & Piskur J (2000) Identi-
fication of residues involved in the specificity and
regulation of the highly efficient multisubstrate deoxyri-
bonucleoside kinase from Drosophila melanogaster. J
Mol Biol 301, 827–837.
W. Knecht et al. Stable human CPU mutants
FEBS Journal 273 (2006) 778–792 ª 2006 The Authors Journal compilation ª 2006 FEBS 791
21 Christians FC, Scapozza L, Crameri A, Folkers G &
Stemmer WP (1999) Directed evolution of thymidine
kinase for AZT phosphorylation using DNA family
shuffling. Nature Biotechnol 17, 259–264.
22 Griffiths AD & Tawfik DS (2003) Directed evolution of
an extremely fast phosphotriesterase by in vitro com-
partmentalization. EMBO J 22, 24–35.
23 Cherry JR, Lamsa MH, Schneider P, Vind J, Svendsen
A, Jones A & Pedersen AH (1999) Directed evolution
of a fungal peroxidase. Nat Biotechnol 17, 379–384.
24 Kim YW, Choi JH, Kim JW, Park C, Cha H, Lee SB,
Oh BH, Moon TW & Park KH (2003) Directed evolu-
tion of Thermus maltogenic amylase toward enhanced
thermal resistance. Appl Environ Microbiol 69, 4866–
32 Stromqvist M, Hansson L, Andersson JO, Johansson T,
Edlund M, Enoksson M, Goossens F, Scharpe S &
Hendriks D (2004) Properties of recombinant human
plasma procarboxypeptidase U produced in mammalian
and insect cells. Clin Chim Acta 347, 49–59.
33 Cadwell RC & Joyce GF (1992) Randomization of
genes by PCR mutagenesis. PCR Methods Applic 2,
28–33.
34 Cadwell RC & Joyce GF (1994) Mutagenic PCR. PCR
Methods Applic 3, S136–S140.
35 Miller AD (1997) Development and applications of re-
torviral vectors. In Retroviruses (Coffin M, Hughes SH
& Varmus HE, eds), pp. 437–473. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York.
36 Krebs DL, Yang Y, Dang M, Haussmann J & Gold
MR (1999) Rapid and efficient retrovirus-mediated gene
transfer into B cell lines. Methods Cell Sci 21, 57–68.
37 Schatteman KA, Goossens FJ, Leurs J, Kasahara Y,
Scharpe SS & Hendriks DF (2001) Fast homogeneous
assay for plasma procarboxypeptidase U. Clin Chem
Lab Med 39, 806–810.
38 Schatteman KA, Goossens FJ, Scharpe SS, Neels HM
& Hendriks DF (1999) Assay of procarboxypeptidase
U, a novel determinant of the fibrinolytic cascade, in
human plasma. Clin Chem 45, 807–813.
39 Stromqvist M, Schatteman K, Leurs J, Verkerk R,
Andersson JO, Johansson T, Scharpe S & Hendriks D
(2001) Immunological assay for the determination of
procarboxypeptidase U antigen levels in human plasma.
Thromb Haemost 85, 12–17.