Subunit composition of the glycyl radical enzyme
p
-hydroxyphenylacetate decarboxylase
A small subunit, HpdC, is essential for catalytic activity
Paula I. Andrei
1
, Antonio J. Pierik
1
, Stefan Zauner
2
, Luminita C. Andrei-Selmer
3
and Thorsten Selmer
1
1
Laboratorium fu
¨
r Mikrobiologie, Fachbereich Biologie, Philipps-Universita
¨
t, Marburg, Germany;
2
Institut fu
¨
r Zellbiologie und
angewandte Botanik, Fachbereich Biologie, Philipps-Universita
¨
t, Marburg, Germany;
3
Institut fu
¨
r Klinische Immunologie und
enzymes; S-adenosyl-methionine radical enzymes; Tanne-
rella forsythensis.
Clostridium difficile is a spore forming, strict anaerobic
bacterium that causes gastrointestinal infections in humans
ranging from asymptomatic colonization to severe diar-
rhoea, pseudomembranous colitis, toxic megacolon, colon
perforation and occasionally death [1]. C. difficile-associated
diarrhoea is very common in hospitalized patients, partic-
ularly after the normal intestinal flora has been disturbed by
an antibiotic or an antineoplastic treatment [2,3]: the normal
gut microbiota has to be disrupted before C. difficile
infection can become established. The production of toxic
fermentation end products may allow an ongoing suppres-
sion of the endogenous microflora and therefore may play an
important role in the progression of the disease.
The formation and tolerance of p-cresol by C. difficile as
the end product of tyrosine fermentation is well known [4,5].
The enzyme responsible is p-hydroxyphenylacetate decarb-
oxylase (Hpd, E.C. 4.1.1 ) [6] which was previously purified
in an almost inactive state [7]. Based on the N-terminal
amino acid sequence of the protein, an ORF was detected
in the unfinished genome of C difficile strain 630 provided
by the C. difficile Sequencing Group at the Sanger Center.
The encoded 902-amino acid protein was most similar to
pyruvate formate lyase-like proteins of unknown function
and showed a typical glycyl radical consensus sequence
motif (VRVAGF) in the C-terminal region. Moreover, the
decarboxylase gene (hpdB) was located in a putative operon
together with a gene encoding an activating enzyme (hpdA),
which is required to form the kinetically stable glycyl radical
decarboxylase; SAM, S-adenosyl-methionine; TFA, trifluoroacetic
acid; RBS, ribosome binding sites.
Enzymes: p-Hydroxyphenylacetate decarboxylase (EC 4.1.1 );
pyruvate formate lyase (EC 2.3.1.54); ribonucleotide reductase
(EC 1.17.4.1); benzylsuccinate synthase (EC 4.1 ).
(Received 8 January 2004, revised 15 March 2004,
accepted 6 April 2004)
Eur. J. Biochem. 1–6 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04152.x
Cloning and sequencing of the genes
The individual cloning steps were carried out in E. coli
DH5a or GM 2159 strains. Genomic DNA of C. difficile
strain DSM 1296
T
was used as a template for PCR
amplification of the hpd-genes. The primers were deduced
from the genomic sequence provided by the Sanger Centre
C. difficile Sequencing Group (http://www.sanger.ac.uk/
Projects/C_difficile/blast_server.shtml). KpnIandClaI
endonuclease cleavage sites were introduced upstream and
downstream of the coding sequence in order to facilitate
cloning (Table 1). To minimize PCR errors, a Hi-Fidelity
DNA polymerase (Hi-Fidelity-PCR Enzyme mix, Abgene)
was used. The amplified hpdA and hpdB genes were cloned
into pBluescript II SK(+) (Stratagene). Three clones of
three individual PCR products were sequenced from
double-stranded DNA in order to obtain the type strain
sequences. The hpdC gene was sequenced directly using the
PCR product as template.
In order to allow an in-frame cloning of the individual
genes in expression vectors, mutagenic primers were used
(DE3)pLysS (Novagen). The
growth conditions (media, temperature, oxygen) and the
concentration of the inducers were varied in order to
establish optimal conditions for the production of soluble
proteins.
HpdB/C and HpdC were produced by E. coli BL21
TM
(DE3) Codon Plus-RIL harbouring pET-DX4 and pET-X1
plasmids, respectively. The cells were grown aerobically in
LB medium supplemented with glucose (0.2%), carbenicil-
lin (100 lgÆmL
)1
) and chloramphenicol (50 lgÆmL
)1
)at
28–30 °C (pET-DX4) and 37 °C (pET-X1). Isopropyl
thio-b-
D
-galactoside was added (1 m
M
)atD
578
of 0.5–0.8.
After 3 h the cells were collected by centrifugation and
stored frozen at )20 °C.
Purification of HpdB and HpdB/C
All purification steps were performed in an anoxic chamber
(Coy Laboratories, Ann Arbor, MI, USA) in a N
2
/H
uffer A. The cell suspension was sonicated at 50 W, for
4 · 5 min with a Branson sonifier (Branson Ultrasonics,
Danbury, CT, USA) on ice. Cell debris and membranes
were removed by centrifugation (100 000 g,60min).The
supernatant was loaded on a Resource-Q column (6 mL),
which was equilibrated with buffer A. The decarboxylase
complex was eluted in a linear gradient of 0–450 m
M
NaCl
in 120 mL buffer A. The fractions containing HpdB/C were
concentrated using a Vivapure device with a 100 kDa cut-
off membrane (Vivascience, Germany) and loaded on a
prepacked Superdex 200 HR 10/30 gel filtration column.
The column was run in 150 m
M
NaCl in buffer A.
The elution and purity of the proteins were monitored by
Table 1. Amplification primers. s, Sense-strand; as, antisense-strand.
Name Nucleotide sequence (5 fi 3¢) Recognition site
DCNtermKpnI ATTCTGGTACCGTTTTATACTAATTATAGAAAGATTAAGG KpnI
DCCtermClaI AAATTCAATCGATCACTATGCTTTCTCATATTTTACACC ClaI
sDecNheI GAAATGGCTAGCAGTAAAGAAGACAAAATAAG NheI
asDCBamHI ATGCTTTCTCGGATCCTACACCCCTTCATACTCTGTTCTAGC BamHI
ActNtermKpnI TGTGTTGGTACCGAGAAAGAAGACTGGG KpnI
ActCtermClaI TATTTATCGATAAAAACCACATAAAAAAGG ClaI
ActNterNheI GTGTTTAATGGCTAGCCAAAAGCAATTAGAAGGC NheI
ActCterBamHI CTTGTATTGGATCCTAGAAAGCTGTCTCATGACC BamHI
ActSacII GGACATCCGCGGTATGAGTAGTCAAAAGC SacII
InterNterm CAATTAATGGTACCTGTTGCTGGGTTTACTCAATATTGG KpnI
InterCterm CCTTCTAATCGATTTTGACTACTCATTAAACACATGCC ClaI
NaCl, 5 m
M
dithiothre-
itol, and homogenized by sonication. Cell debris was
removed by centrifugation (60 min at 100 000 g). The clear
supernatant was applied onto the column equilibrated with
buffer B. Non-bound protein was washed off with buffer B
prior to elution of HpdA with desthiobiotin (2.5 m
M
)in
buffer B. The enzyme was concentrated in 2 mL Vivaspin
centrifugation devices with a cut-off of 10 kDa (final
concentrations > 1 mgÆmL
)1
) and stored anoxically at
)20 °C.
Reconstitution of the Hpd activity
in vitro
All reconstitution steps were carried out under strict anoxic
conditions. The recombinant HpdB/C was tested for
catalytic competence using endogenous HpdA in cell-free
extracts of C. difficile. Therefore, cell-free extracts from
C. difficile and E. coli Bl21
TM
(DE3) Codon Plus-RIL/pET-
DX4 (85 lgÆmL
)1
and 28 lgÆmL
)1
total protein, respect-
for 3 h in the presence of 0.5 m
M
sodium dithionite,
0.57 m
M
SAM and 17 lg HpdB/C in a final volume of
100 lL100m
M
Tris/HCl pH 7.5, 5 m
M
(NH
4
)
2
SO
4
,5m
M
dithiothreitol, 1 m
M
MgCl
2
(100 lL) at 4 °C. To follow
the decarboxylation, 25 m
M
substrate (1 mL) was added.
Aliquots were taken at defined time points and assayed for
p-cresol formation by HPLC as described previously [7].
MALDI-TOF MS of HpdC
Partially purified decarboxylase from C. difficile and recom-
C. difficile strain 630, which encoded both the glycyl radical
subunit of the decarboxylase (HpdB) and its activating
enzyme (HpdA). A detailed analysis of the sequence taking
into account putative ribosome binding sites (RBS) estab-
lished a third ORF (hpdC) located between hpdB and
hpdA (Fig. 1). During the initial purification of the decar-
boxylase from C. difficile this small protein (85 amino acids,
9.5 kDa) was overlooked. However, the low activity yield of
the purification was attributed to the loss of a low molecular
mass cofactor [6,7].
Based on the genomic DNA sequence of C. difficile strain
630, specific primers were deduced in order to amplify the
genes encoding the two putative decarboxylase subunits and
its activase by PCR from genomic DNA of the type strain
DSM 1296
T
. The type strain sequences have been deposited
in the EMBL Nucleotide Sequence Database under the
accession numbers AJ543425 (hpdB), AJ543426 (hpdC)and
AJ543427 (hpdA). Within the hpdB gene, nine nucleotides
were exchanged between the type strain and strain 630, but
only two of these replacements changed the amino acid
sequence (M670I and E806D). The gene of the small
subunit (hpdC) contained two exchanged nucleotides, which
were silent at the amino acid level. In hpdA, one nucleotide
differed, leading to one amino acid exchange (I165V).
The recombinant proteins were produced in E. coli from
inducible expression vectors. Suitable endonuclease cleavage
sites were introduced by PCR mutagenesis in order to allow
in-frame cloning of the genes. While the BamHI sites
Codon Plus-RIL was efficient for both polypeptides and
resulted in soluble protein.
Though no formation of p-cresol was observed in cell-free
extracts from E. coli coexpressing hpdB and hpdC,a
catalytically competent protein was produced. As shown
in Fig. 2, the decarboxylase was rapidly activated by HpdA
from cell-free extracts of C. difficile yielding a specific
activity of 90 mUÆmg
)1
corrected for an almost negligible
background activity of the C. difficile extract, demonstra-
ting the production of a functional recombinant enzyme.
While strict anoxic conditions were required to achieve
activation, the process was equally effective for cell-free
extracts containing HpdB/C prepared from aerobically or
anaerobically grown cells. No p-cresol formation was
detected in the Resource-Q fractions containing separated
subunits HpdB or HpdC. These results show that HpdC is
essential for p-cresol formation and establish this polypep-
tide as a subunit of p-Hpd.
The decarboxylase was originally purified from cell-free
extracts of C. difficile by successive anion exchange chro-
matography on DEAE-Sepharose and Resource-Q fol-
lowed by size exclusion chromatography on Superdex 200
[7]. The DEAE Sepharose column led to a loss of 95% of
the activity and was therefore omitted throughout this work
without significantly affecting purity. The presence of both
HpdB and HpdC in these preparations was demonstrated
both on SDS/PAGE and by MALDI-TOF MS (see below)
and < 10% of the initial activity was lost in the first step.
essentially free of HpdC, partially purified enzyme obtained
from Source 15Q anion exchange column was subject
to a solid phase extraction procedure. The molecular
mass observed for HpdC in these preparations was
Fig. 2. Activation of the recombinant HpdB/C complex. Cell-free
extract from C. difficile (85 lgÆmL
)1
)wasincubatedat30°Cinthe
presence of 20 m
M
pHPA, in the absence (d)orpresence(s)of
0.23 m
M
SAM. In the presence of E. coli extract containing HpdB/C
(n), a rapid activation of the recombinant decarboxylase was
observed. The activation was strictly dependent on the endogenous
HpdA from C. difficile and SAM (data not shown).
Fig. 1. Location of the hpdC gene. Potential
clostridial ribosomal binding sites are boxed
and the start codons are shaded grey. The
amino acid sequence of HpdC is shown in
bold letters together with the C-terminal end
of HpdB and the N-terminal of HpdA.
4 P. I. Andrei et al. (Eur. J. Biochem.) Ó FEBS 2004
9508 ± 9 Da. This value is in good agreement with the
predicted molecular mass of 9504 Da for HpdC. The mass
spectrum of recombinant HpdC was strikingly different:
in addition to a signal indicating a molecular mass of
9510 ± 9 Da, a second signal with equal intensity was
observed at 9590 ± 9 Da. The 80-Da mass increment
mass fraction of < 10 kDa during the purification.
A closer analysis of the DNA sequence provided by the
Sanger Center, taking into account the possible ribosomal
binding sites, showed a third ORF, hpdC, located between
the decarboxylase and the activase genes. The hpdC gene
starts directly downstream of the decarboxylase gene (hpdB),
and overlaps the 5¢-region of hpdA. It encodes an 85-amino
acid, cysteine rich polypeptide (9.4% cysteine). In contrast
with the well-studied glycyl radical enzymes pyruvate
formate-lyase and class III ribonucleotide reductase, which
are homodimeric enzymes (for review see [11,12]), the
findings reported in this paper suggest a hetero-oligomeric
structure of the decarboxylase in the catalytically competent
enzyme. A hetero-oligomeric structure has been described for
the benzylsuccinate synthase of Thauera aromatica and
related organisms [13,14]. Whereas the small subunits form
a stable complex with the glycyl radical subunit in benzyl-
succinate synthase and therefore copurify, the complex of
HpdB and HpdC is apparently much weaker and rapidly
dissociates during the purification.
The first evidence for an important structural function of
HpdC in the decarboxylase arose from the observation that
HpdB produced by E. coli/pET-D3 exclusively yielded
insoluble protein, whereas coexpression of hpdB and hpdC
gave a soluble, catalytically competent enzyme, which was
smoothly activated by cell-free extracts of C. difficile.
An important, probably regulatory function of HpdC
became evident during the purification of the recombinant
protein. The molecular mass data immediately suggested a
phosphorylation of HpdC, which could affect the oligo-
proteins (S) and the positions of HpdB and HpdC are indicated.
Ó FEBS 2004 Subunit composition of p-Hpd (Eur. J. Biochem.)5
decarboxylase with one radical site per HpdB dimer. The
recombinant, octameric complex of HpdB and HpdC is
smoothly activated using either endogenous HpdA from
C. difficile extracts or recombinant HpdA from E. coli
extracts. The specific activity of the recombinant decarb-
oxylase is higher (7 UÆmg
)1
) than the highest activity
observed for the homo-dimeric enzyme purified from
C. difficile (< 0.5 UÆmg
)1
), but is still significantly lower
than the estimated maximum value. These findings suggest
that the recombinant decarboxylase and the recombinant
activating enzyme are functional; however, the reconstitu-
tion of the system using individually purified enzymes
in vitro is difficult due to an essential requirement for an as
yet unknown factor present in the cell extracts of both
C. difficile and E. coli. Apparently, this factor is lost during
purification and limiting when cell-free extracts are used to
restore activity (P. I. Andrei and M. Blaser, unpublished
data), suggesting that higher specific activities might be
obtained by providing the missing compound.
Interestingly, a small fraction of the recombinant decarb-
oxylase dissociated during the purification. While the
resulting homo-dimers of nonactivated HpdB thus obtained
remained soluble and have been purified, all attempts to
detect activity in these preparations failed. It will be
manuscript. We also like to thank the Max-Planck Institute for
Terrestrial Microbiology for the access to MALDI-TOF MS and EPR.
This work was supported by grants from the priority program ÔRadicals
in Enzymatic CatalysisÕ of the Deutsche Forschungsgemeinschaft
(DFG) and is dedicated to Prof. Dr Achim Kro
¨
ger. Prof. Dr Kro
¨
ger
was a member of the reviewing panel of the priority program and died
on 11 June 2002.
References
1. Spencer, R.C. (1998) Clinical impact and associated costs of
Clostridium difficile-associated disease. J. Antimicrob. Chemother.
Suppl. C41, 5–12.
2. Fedorko, D.P., Engler, H.D., O’Shaughnessy, E.M., Williams,
E.C., Reichelderfer, C.J. & Smith, W.I. Jr (1999) Evaluation of
two rapid assays for detection of Clostridium difficile toxin A in
stool specimens. J. Clin. Microbiol. 37, 3044–3047.
3. Borriello, S.P. & Wilcox, M.H. (1998) Clostridium difficile infec-
tions of the gut: the unanswered questions. J. Antimicrob.
Chemother. Suppl. C41, 67–69.
4. Elsden, S.R.H.M.G. & Waller, J.M. (1976) The end products of
the methabolism of aromatic amino acids by Clostridia. Arch.
Microbiol. 107, 283–288.
5. Hafiz, S. & Oakley, C.L. (1976) Clostridium difficile:isolationand
characteristics. J. Med. Microbiol. 9, 129–136.
6. D’Ari, L. & Barker, H.A. (1985) p-Cresol formation by cell-free
extracts of Clostridium difficile. Arch. Microbiol. 143, 311–312.
7. Selmer, T. & Andrei, P.I. (2001) p-Hydroxyphenylacetate
and a common nucleotide binding fold. EMBO J. 1, 945–951.
6 P. I. Andrei et al. (Eur. J. Biochem.) Ó FEBS 2004