Investigation of the contribution of histidine 119 to the conduction
of protons through human Nox2
Tosti J. Mankelow*, X. Wen Hu, Kate Adams and Lydia M. Henderson
Department of Biochemistry, School of Medical Sciences, University of Bristol, UK
The conduction of protons through human Nox2 has pre-
viously been shown to be dependent upon His115. Align-
ment of sequences for both animal and plant Nox proteins
indicated that histidines 115 and 119 are both highly con-
served, while His111 was co nserved among animal homo-
logues of Nox1–4. T o investigate t he possible r ole that these
histidine residues m ight play in the conduction of proton s
through Nox2, we have introduced both paired and single
mutations into these histidine residues. Each construct was
used to generate a CHO cell line in which the expression of
the m utated Nox2 was assessed. Nox2 was e xpressed in e ach
of the C HO cell lines generated, however, the level of
expression of H111/115L in CHO cells was lower and that of
H111L very much reduced, compared to that of wild-type
Nox2. The arachidonic acid activated proton flux was
absent in the CHO cell lines expressing the mutations of
H111/115L, H111/119L or H115/119L, compared to that
observed for wild-type Nox2. Similarly only a small efflux of
protons was observed from CHO cells expressing either
H119L or H111L. In all c ases the expected proton flux was
elicited through the addition of the protonophore, carbonyl
cyanide m-chlorophenylhydrazone. Conclusions regarding
the role of His111 in the conduction of protons cannot be
drawn due to the reduced expression. We can, however,
conclude th at His119, in addition to His115, is required for
the conduction of protons through Nox2. His119 has been
identified as a highly conserved residue for w hich no fu nction

A number o f proteins with amino acid sequ ences similar
to that of the human gp91
phox
have been described in
human [2–4], mouse, rat, Caenorhabditis elegans, Dictyo-
stelium,rice[5],tomatoandArabidopsis [6,7] g enomes. The
identification of multiple sequences with similarity to
gp91
phox
within the human genome led to the need to
rename and number the family of proteins from p hox
(phagocyte oxidase) to Nox (NADPH oxidase-like). Of the
Nox family members, Nox2 is the originally described
human phagocyte protein gp91
phox
. In addition, genes
encoding dual oxidases (Duox), which contain both a
peroxidase and N ox have been identified in a number of
different genomes [8].
The generation of superoxide by the phagocytic NADPH
oxidase is associated with an e fflux of protons [9]. The
expression of wild-type Nox2 in CHO cells has previously
been shown to b e associated with the presence o f a
characterized arachidonic a cid activated proton cond uction
pathway [10,11]. T he membrane topology of gp91
phox
is
predicted to consist of 4–6 transmembrane domains located
within the N-terminal half of the protein followed by a
hydrophilic, cytosolic domain [12]. The third predicted

Eur. J. Biochem. 271, 4026–4033 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04340.x
whether introduced into the full-length Nox2 [13] or only
the N-terminal membrane spanning domains [14]. Similarly,
proton conduction was greatly reduced if all three hist idine
residues were mutated to leucine [13,14]. Therefore the
ability of Nox2 to act as proton conduction pathway has
previously b een demonstrated to be dependent upon
His115.
An alignment of the amino acid sequences for Nox
and Duox proteins available in the genome databases
demonstrated that His115 and His119 in human Nox2
are both conserved through out the animal and plant
sequences of Nox and Duox proteins (Fig. 1A). Only the
sequence of Arabidopsis RbohE appeared to lack the
His119 residue. However, t he introduction of a four
amino acid gap in the s equence improved the sequence
alignment and suggested that both His115 and 119 are
also conserved in RbohE (Fig. 1B). His111 is conserved
in Nox2 sequences from different animal species (Fig. 1).
Histidines 101, 115, 209 and 222 have been proposed to
function as the 5th and 6th coordinate ligands for the
two b-type hemes due to similarities in sequence position
and spacing of the histidine residues t o those of yeast
ferric reductase [15]. However, no function has previ-
ously been proposed for a conserved histidine residue at
position 119.
The contribution of His119 and/or His111 to the
conduction of protons through Nox2 has not previously
been investigated. To determine whether the mechanism for
the conduction of protons through Nox2 requires His111

Nox1 are incomplete partial sequences lacking
the N-terminus. There are s equences for
human Nox5 with and without the extended
N-terminal containing the EF-hands. The
residues numbers for both are shown. (B) The
introduction of a gap of four amino acids into
the RbohE sequence (residues 473–503) is
necessary to align the histidine re sidues with
those of the other Arabidopsis,plantand
human Nox2.
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4027
Materials and methods
The composition o f the salt solutions used are as described
previously [11,13].
Sequence alignment
The PubMed protein and nucleotide databases contain
sequence data for a number o f Nox and Duox proteins from
human, mouse, rat, cow, bison, pig, dolphin, rabbit, guinea-
pig, Japanese puffer fish, Dictyostelium, Arabidopsis, rice,
tomato, potato and C. elegans. Alignment o f these sequences
in species groups identified a region of sequence similarity
including and in a ddition to the previously described
conserved histidine at position 115 in human Nox2. The
amino acids with sequence homology to residues 100–131 of
human Nox2 were identified in each Nox and Duox
sequences and aligned using
GENEDOC
and
DNASTAR
.The

CHO91H111/115L (Nox2 with histidines 111 and 115
mutated to leucine); CHO91H115/119L (Nox2 with histi-
dines 115 and 119 mutated to leucine); CHO91H111/119L
(Nox2 with histidines 111 and 119 mutated to leucine);
CHO91H111L (Nox2 with histidine 111 only mutated to
leucine) and CHO91H119L (Nox2 w ith histidine 119 only
mutatedtoleucine).
All CHO cell lines were maintained in Ham’s F-12
nutrient mixtu re with GlutaMAX-I, 10% (v/v) fetal bovine
serum, 50 UÆmL
)1
penicillin and 50 lgÆL
)1
streptomycin.
The c ells were divided 1 : 2 once a week following
trypsinization [11].
Expression of the mutant Nox2 proteins
Verification of the expression of each of the mutant Nox2
proteins and determination of their cellular l ocalization
were assessed by i mmunostaining a nd confocal microscopy
as previously described [11,13]. The immunocytochemistry
was performed with an antipeptide [PRGVHFIFN
KENF(558–570)] polyclonal antibody [11,16] upo n each
of the CHO91 mutant cell lines. Expression of Nox2 was
driven from the inducible metallothionein promoter in
pMEP4 through the preincubation of the cells with 10 l
M
Cd
2+
for 16–24 h. The CHO cell lines were grown on r ound

His115/119Leu fwd TGCGATTC
TCACCATTGCACTTCTATTT His115/119Leu
His111/115Leu rev CAATGGTG
AGAATCGCAGAGAGAAGTGC His111/115Leu
4028 T. J. Mankelow et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Bio-Rad MRC 600 inverted confocal microscope and
presented as a Kalman average of five successively collected
scans, with excitation at 488 nm. The expression levels of all
the mutants were compared to that observed for wild-type
Nox2 in CHO91 cells (positive control). N onspecific
binding of the antibodies was assessed in nontransfected
CHO cells ± 10 l
M
Cd
2+
(negative co ntrol).
Transmembrane proton flux in mutant CHO91 cell lines
The conduction of protons through the arachidonate
activated, NADPH oxidase associated H
+
channel was
assessed as change in pH
i
with 2¢,7¢-bis-(2-carbox yethyl)-5-
(and -6-)-carboxyfluorescein, acetoxymethyl e ster (BCECF-
AM) for all m utant CHO91 cell lines, a s described
previously [11,13,14]. The pH of the external solution
was rapidly altered by the addition of HEPES (pH 6.6) or
Tris (pH 8.3). The addition of the potassium ionophore,
valinomycin, equilibrates K

The conduction of protons through Nox2 was previously
observed to be greatly redu ced in CHO cells expressing
Nox2 in which His115 h ad been mutated to L eu and when
all three histidines, 111, 115 and 119, were mutated to Leu
[13,14]. The alignment of Nox protein sequences indicates
that His119 is highly conserved and His111 is conserved in
Nox2 proteins from different animal species. However, the
contribution of histidines 111 and 119 to the conduction of
protons through Nox2 has not previously been invest igated
despite their p ossible location on the same face of an a-helix
as His115. To determine th e contribution of histidines 111
and 119 to the conduction of protons through human Nox2,
we have established CHO cells that express Nox2, into
which mutations to either paired or single histidine residues
within the third transmembrane domain have been intro-
duced. The exp ression of the r esulting protein and condu c-
tion of protons in re sponse to arachidonic acid was assessed
for each of the cell lines.
Expression of Nox2 histidine mutations in CHO cells
Table 1 contains the sequences o f the o ligonucleotide PCR
primers used to introduce the mutations of His fi Leu for
the three histidine residues of interest within the third
transmembrane domain of Nox2. Each of the three possible
combinations of pairs of histidine residues were mutated to
leucine ( 111/115, 115/119 and 111/119) and used to establish
stable CHO cell lines, CHO91H111/115L, C HO91H115/
119L and C HO91H111/119L. Transcription and t ransla-
tion of the Nox2 gene is under the control of an inducible
metalothionine promoter (10 l
M

able to that observed for CHO91 cells (Fig. 2A) as observed
previously [11,13,14].
Arachidonic acid activated proton conduction
The arachidonic acid activated proton conduction pathway
has previously been reported to be greatly reduced by the
mutation of His115 to Leu compared to that observed for
wild-type Nox2 [13,14]. To assess the contribution of
histidines 119 and 111 to the conduction of p rotons th rough
Nox2, the ability of CHO91H111/115L, CHO91H115/119L
and CHO91H111/119L cells to conduct protons in response
to stimulation by arachidonic acid was assessed. Electro-
chemical gradients for either proton influx (Fig. 3A–C) or
proton efflux (Fig. 3D,E) were imposed upon the cells prior
to the addition of arachidonic acid. CHO91H115/119L
(Fig. 3C) cells showed little change in pH
i
in response
to arachidonic acid compared with the response of
CHO91 ce lls (Fig. 3A) expressing human Nox2. A similar
low conduction of protons following the addition of
sodium arachidonate was observed for CHO91H111/115L
(Fig. 3E). The observed very low conduction of protons for
both CHO91H111/119L and CHO9H115/119L cells is as
would b e pred icted and may be the result s olely of the
mutation of His115 to Leu in both of these cell lines.
However, CHO91H111/119L cells failed to exhibit an
arachidonic acid activated conduction of protons whether
assessed as a proton influx (Fig. 3B) or as a proton efflux
(Fig. 3D). The subsequent addition of the protonophore,
carbonyl cyanide m-chlorophenylhydrazone, resulted i n the

Mutation of individual histidine residues in human Nox2
To investigate the individual roles of His111 and His119, in
the conduction of protons through Nox2, two CHO cells
lines were constructed, CHO91H111L and CHO91H119L,
in which the single His fi Leu mutations had been intro-
duced. The expression of Nox2 in which the histidine at
position 119 had been mutated to leucine was inducible in
CHO91H119L cells (Fig. 4A) and the protein was expressed
at a level comparable with that observed for wild-type
Nox2 (Fig. 2A). However, the expression of Nox2 in
CHO91H111L cells, in which the histidine at position 111
had been mutated to leucine, although enhanced by
activation of the inducible promoter, was observed t o be
significantly lower than that of w ild-type Nox2 (Figs 4B
and 2A).
CHO91H119L cells in the presence of a transmembrane
gradient for the efflux of protons exhibited a very small
conduction of protons following the addition of arachido-
nate (Fig. 4E). The efflux of protons was similar to that
observed for CHO91H111/119L cells (Fig. 3D). The efflux
of protons was only observed following the subsequent
addition of carbonyl cyanide m-chlorophenylhydrazone
(Fig. 4E). The reduction in proton efflux observed for
CHO91H119L cells is not due to a reduction in the level of
protein expression as a result of the introduction of this
mutation into Nox2. Therefore, we can conclude that the
reduced proton efflux is as a c onsequence of the mutation of
His119 to Leu, and therefore that His119 is required for the
conduction of protons through Nox2.
We note that proton efflux was also not observed

+
medium. In addition the efflux of protons w as assessed in both CHO91H111/119L (D)
and CHO91H111/115L (E) with c ells suspended i n a K
+
medium. (A–E) The opening of the proton conduction pathway and the t ransport of
protons was monitored as an alteration in i nternal pH, following the addition of 10 l
M
arachidonic a cid (AA). The maximum change in pH
i
was
determined following the addition of the protonophore, carbonyl cyanide m-chlorophenylhydrazone (CCCP; 66 l
M
) where indictated. The
requirement for a s econd addition of CCCP in (E), in order to elicit a full pHi change, probably results from a l arger number of cells. The buffering
capacity was asse ssed fo llowing the addition of 26 m
M
NaAc (F) to CHO91H115/119L, CHO91H111/119L, CHO91, CHO91H111/115L (left to
right) and the response of the BCECF-AM to pH was calibrated (G) in CHO91 (j), CHO91H111/119L (m), CHO91H115/119L (d)and
CHO91H111/115L ( r).
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4031
Discussion
It has previously been shown that His115 is required for the
conduction of proton s through human Nox2, in either the
full-length protein [13] or the N-terminal membrane domain
alone [14]. The third transmembrane domain of Nox2
contains three histidine residues separated from each other
by three amino acid residues [14]. In this paper we have
generated CHO cell lines expressing human Nox2 into
which double and single mutations to histidines 111, 115
and 119 had been introduced. Mutation of His119 to Leu

channel, thereby opening the M2 proton channel [22,25]. A
tryptophan o ccurs at position 125 of human Nox2, located
within the transmembrane domain that also contains
His111, 115, and 119. The model of this region as an
a-h elix places Trp125 two turns of the helix above His119
and not on the same face o f the helix. Therefore, the
distance and the orientation of His119 to Trp125 i s too
great to permit a cation–p interaction similar to that
described for the pH stimulated gating of the M2 protein
by the Trp41–His37 interaction [22,25].
A role f or cytosolic phospholipase A
2
(cPLA
2
)inthe
opening of the NADPH oxidase associated proton channel
has previously been demonstrated through the development
and use of a cPLA
2
deficient PLB-985 cell line (PLB-D cells)
[26–28]. Gating o f the proton channel formed by either full-
length human Nox2 [27] or just the N-terminal membrane
domain alone [28] have both been reported to be deficient in
PLB-D cells. The requirement for cPLA
2
for both the
activation of superoxide generation [26] and the gating of
the proton channel [27,28] can be over come by the addition
of arachidonate acid. The site of interaction with and the
mechanism by which arachidonate results in the activation

2+
(E) was determined as described in
the Materials and methods. The CHO91H119L cells were resuspended
in a K
+
medium and additions of 2.7 l
M
valinomycin, 5 m
M
Tris,
10 l
M
arachidonate (AA) and 6 6 l
M
carbonyl c yanide m-chlorophe-
nylhydrazone (CCCP) were m ade where indicated i n the figure (E).
4032 T. J. Mankelow et al.(Eur. J. Biochem. 271) Ó FEBS 2004
References
1. Segal, A.W., West, I., Wient jes, F., Nugent, J .H.A., Chavan, A.J.,
Haley, B., Garcia, R.C., Rosen, H. & Scrace, G. (1992) Cyto-
chrome b-245 is a flavocytochrome containing FAD and the
NADPH-binding s ite of the microbicidal oxidase of phagocytes.
Biochem. J. 284, 781–788.
2. Lambeth, J.D., Cheng, G., Arnold, R.S. & Edens, W.A. (2000)
Novel hom ologs of gp91
phox
. Trends in Bioc hem. Sci 25, 459–461.
3. Banfi, B., Molnar, G., Maturana, A., Steger, K., Hegedus, B.,
Demaurex, N. & Krause, K.H. (2001) A Ca
2+

Thyroid oxidase (THOX2) gene expression in the rat thyroid cell
line FRTL-5. Biochem. Biophys. Res. Commun. 277, 287–292.
9. Henderson, L.M., Chappell, J.B. & Jones, O.T. (1987) The
superoxide-generating NADPH oxidase of h uman neutrophils is
electrogenic and a ssociated w ith a n H
+
channel. Biochem. J. 246,
325–329.
10. Henderson, L.M. & Chappell, J.B. (1992) The NADPH-oxidase-
associated H
+
channel is opened by arachidonate. Biochem.
J. 283, 171–175.
11. Henderson, L.M., Banting, G. & Chappell, J.B. (1995) The ara-
chidonate-activable, NADPH oxidase-associated H
+
channel.
Evidence that gp91
phox
functions as an essential part of t he
channel. J. Biol. Chem. 270, 5909–5916.
12. Hend erson, L.M., Thomas, S., Banting, G. & Chap pell, J.B.
(1997) The arachidonate-activatable, NADPH oxidase-associated
H
+
channel is contained within the multi-membrane-spanning
N-terminal region of gp 91
phox
. Biochem. J. 325, 701–705.
13. Mankelow, T.J. & Henderson, L. M. (2003) Proton conduction

Antoniou, M. & Hay, A.J. (1996) Selective proton permeability
and pH regulation of the influenza virus M2 channel expressed in
mouse erythroleukaemia c ells. J. Physiol. 494, 329–336.
22. Okada, A., Miura, T. & Takeuchi, H. (2001) Protonation of
histidine and histidine–tryptophan interaction in the activation
of the M2 ion channel from influenza A virus. Biochemistry 40,
6053–6060.
23. Wang, C., Takeuchi, K., Pinto, L.H. & Lamb, R.A. (1993) Ion
channel a ctivity of influenza A virus M2 protein: c haracterizatio n
of the amantidine block. J. Virol. 67, 5 585–5594.
24. Wang, C., Lamb, R .A. & Pinto, L.H. (1995) Activation of the M2
ion channel of influenza virus: a ro le for the transmembrane
domain histidine residue. Biophys. J. 69, 1363–1371.
25. Tang, Y., Zaitseva, F., Lamb, R.A. & Pinto, L.H. (2002) The gate
of the influe nza virus M2 proton channel is formed by a single
tryptophan residue. J. Biol. Chem. 277, 39880–39886.
26. Dana, R., Leto, T.L., Male ch, H .L. & Levy, R. (1998) Essential
requirement of cytosolic phospholipase A
2
for activation o f the
phagocyte NADPH oxidase. J. Biol. Chem. 273, 441–445.
27. Lowenthal, A. & Levy, R. (1999) Essential requirement of cyto-
solic phospholipase A
2
for a ctivation of the H
+
channel in pha-
gocyte-like cells. J. Biol. Chem. 274, 21603–21608.
28.Mankelow,T.J.,Pessach,E.I.,Levy,R.&Henderson,L.M.
(2003) The requirement of cytosolic phospholipase A