Functional expression of olfactory receptors in yeast and
development of a bioassay for odorant screening
Jasmina Minic
1
, Marie-Annick Persuy
1
, Elodie Godel
1
, Josiane Aioun
1
, Ian Connerton
2
,
Roland Salesse
1
and Edith Pajot-Augy
1
1 INRA, Neurobiologie de l’Olfaction et de la Prise Alimentaire, Re
´
cepteurs et Communication Clinique, Jouy-en-Josas, France
2 Division of Food Sciences, School of Biosciences, University of Nottingham, Loughborough, Leicestershire, UK
The olfactory receptors (ORs) are a large group of
proteins belonging to subfamily I of G protein coupled
receptors (GPCRs) that bind odorant ligands. These
receptors are predicted to contain seven transmem-
brane helices that change their relative orientation
upon odorant stimulation, resulting in the conforma-
tional change of the receptor and productive inter-
action of its intracellular loops with G
olf
, the a subunit

ing. Functional expression of the rat I7 OR and its trafficking to the
plasma membrane was achieved under optimized experimental conditions in
the budding yeast Saccharomyces cerevisiae. The membrane expression of
the receptor was shown by Western blotting and immunolocalization meth-
ods. Moreover, we took advantage of the functional similarities between
signal transduction cascades of G protein-coupled receptor in mammalian
cells and the pheromone response pathway in yeast to develop a novel
biosensor for odorant screening using luciferase as a functional reporter.
Yeasts were engineered to coexpress I7 OR and mammalian G
a
subunit, to
compensate for the lack of endogenous Gpa1 subunit, so that stimulation
of the receptor by its ligands activates a MAP kinase signaling pathway
and induces luciferase synthesis. The sensitivity of the bioassay was signifi-
cantly enhanced using mammalian G
olf
compared to the G
a15
subunit,
resulting in dose-dependent responses of the system. The biosensor was
probed with an array of odorants to demonstrate that the yeast-borne I7
OR retains its specificity and selectivity towards ligands. The results are
confirmed by functional expression and bioluminescence response of human
OR17-40 to its specific ligand, helional. Based on these findings, the bioas-
say using the luciferase reporter should be amenable to simple, rapid and
inexpensive odorant screening of hundreds of ORs to provide insight into
olfactory coding mechanisms.
Abbreviations
Endo H, endoglycosidase H; GPCR, G protein-coupled receptor; KLH, keyhole limpet hemocyanin; OR, olfactory receptor; PMSF,
phenylmethylsulfonyl fluoride; PNGase F, peptide N-glycosidase F; S14, somatostatin-14; SSTR2, somatostatin receptor subtype 2; PBST,

b
2
-adrenergic receptor [18], the N-terminal extension of
rhodopsin [19] or the membrane import sequence of the
serotonin receptor [20]. Functional expression of mouse
71 OR was dramatically increased upon coexpression
with the b
2
-adrenergic receptor, but not that of rat I7
or human OR17-40 receptors [21]. This suggested that
different ORs may require distinct GPCR partners to
drive surface expression, maybe through their persistent
physical association. An alternative approach for the
functional expression of ORs utilized an adenovirus
vector to deliver OR cDNAs to the sensory neurons of
olfactory epithelia [4,8]. However, this approach has
practical limitations due to the difficulty in maintaining
olfactory neurons in primary culture, the inconsistency
of viral-mediated gene transfer, and the cost if it was to
be applied to a large number of ORs.
The aim of this study was to optimize the baker’s
yeast Saccharomyces cerevisiae as a host system for
properly expressing an OR at the plasma membrane,
and for its efficient coupling to a signaling pathway
that produces a measurable response to odorant stimu-
lation. The yeast system was chosen for several rea-
sons. Firstly, S. cerevisiae has been successfully used
for functional expression of many GPCRs [22–28]. Sec-
ondly, yeast constitutes an attractive system to study
membrane receptors providing a null background for

transduction pheromone pathway were either deleted
or functionally replaced by their mammalian or
mutant counterparts to optimize S. cerevisiae for
GPCR structure–function investigations [22,26,29,33].
In the present study we have used the rat I7 OR as
a model to investigate the OR expression in yeast since
its preferred ligands (octanal, heptanal, nonanal) and
their effective concentration ranges have already been
determined [4,8,10,19]. We recently described how
S. cerevisiae can successfully be engineered as a repor-
ter system for odorant detection [34]. Two different
yeast strains expressing an odorant receptor were only
able to grow on selective media following specific
odorant ligand stimulation. However, this growth
reporter had very limited sensitivity and was poorly
adapted to the transitory nature of the response. Thus,
methodological improvements were drastically needed
for this system to be ultimately used for pharmacologi-
cal screening purposes. Here, we use luciferase as a
rapid reporter to study the I7 OR pharmacology. We
have optimized the experimental conditions for the
production of the I7 OR in yeast and used biochemical
and immunological methods to estimate the levels of
receptor expression and its cellular localization.
Results
Yeast transformations
Functional expression of the I7 or OR17-40 receptor
was achieved in the yeast strain MC18 modified to
allow sensitive bioassay based on synthesis of lucif-
erase upon odorant stimulation. Strain MC18 has been

Biochemical characterization of the yeast I7 OR
To examine the presence of the I7 protein in unin-
duced and induced yeast cells, membrane preparations
were analyzed by immunoblotting using a polyclonal
antibody raised against I7. No immunoreactivity was
detected in control membrane preparations from either
nontransformed MC18 yeast cells or cells transformed
with the initial pJH2-somatostatin receptor subtype 2
(SSTR2) plasmid (Fig. 3A). In the case of yeast cells
transformed with the pJH2-I7 expression vector two
immunoreactive bands were observed at approximately
40 and 51 kDa (Fig. 3A). The calculated molecular
weight for the I7 OR is 39 kDa, it is therefore likely
that the 40 kDa band corresponds to the receptor
monomer. The 51 kDa band may correspond to a gly-
cosylated form of the receptor since I7 OR contains
two N-glycosylation sites, one at the N terminus and
another in the second extracellular loop.
To determine if the I7 receptor is glycosylated in
S. cerevisiae, the membrane fraction from the induced
yeast cells was digested with either endoglycosidase H
(Endo H) or peptide N-glycosidase F (PNGase F).
Figure 3B shows that t he 51-kDa b and i s sensitive to both
Endo H and PNGase F digestion, resulting in almost
Fig. 1. mRNA of the rat I7 OR or human OR17-40 receptor in trans-
formed yeast strains. Total RNAs from either uninduced or induced
strains transformed with pJH2-I7 or pJH2-OR17-40 expression vec-
tors were subjected to RT-PCR using specific primers to demon-
strate that mRNA synthesis of the ORs occurs even in uninduced
cells. I7 cDNA in pJH2-I7 plasmid and OR17-40 cDNA in pJH2-

expressed in yeast, we developed a luciferase reporter
bioassay. Initially, the bioassay was configured using a
control yeast strain transformed to coexpress luciferase
under control of FUS1 with the SSTR2 receptor and
Gpa1. When this strain was incubated with either
a-factor to stimulate endogenous a-factor receptor
(Ste2), or with somatostatin 14 (S14) to stimulate
SSTR2 receptor, luciferase activity was observed to
increase in a dose-dependent manner (data not shown).
Thus, the bioassay provides an effective readout of
GPCR–ligand interaction and we therefore applied the
assay to monitor the I7 or OR17-40 activity.
Figure 4A summarizes differential luciferase-medi-
ated luminescence detected in the yeast strains expres-
sing I7 OR, grown at various conditions, following
their stimulation with 5 lm heptanal, octanal or non-
anal. In this set of experiments the effects of yeast
growth temperature and GAL1 ⁄ 10 promoter induction
were tested in order to optimize I7 OR functional
expression. As some GPCRs were reported to fold and
traffic better to the plasma membrane when their
expression level is restricted by reduced temperatures
[36,37], we examined I7 OR activity in yeasts grown
at 30 or 15 °C. Indeed, luciferase-mediated responses
to odorants were dependent on the yeast growth tem-
perature. The temperature shift to 15 °C markedly
improved the functional response of the receptor
(Fig. 4A).
The luciferase reporter activity was compared in
uninduced and galactose-induced conditions since a

a15
in strains from Fig. 4A were compared. The
immunoblot analysis indicated that the levels of G
olf
and G
a15
in membrane fractions are constant regard-
less of the temperature and galactose induction, while
the level of the I7 OR is higher in membrane fractions
from yeasts induced by galactose at 15 °C (Fig. 4B).
Thus, the highest level of both membrane-associated
and active I7 OR were obtained in yeast induced by
galactose at 15 °C. Therefore, we chose to perform
pharmacological analysis on the yeast coexpressing I7
and G
olf
under these conditions.
Pharmacological characterization of the yeast
I7 OR
Previous pharmacological investigations of the I7 OR
expressed in mammalian cells have shown that recep-
tor responses to odorants are dose dependent [10,38].
In this study, the yeast-borne I7 OR was stimulated by
heptanal, octanal or nonanal over the concentration
range from 5 · 10
)14
to 5 · 10
)4
m. All three ligands
evoked luciferase reporter activity in a dose-dependent

dilutions on the luciferase bioassay performed with
S14 stimulation of a control yeast strain coexpressing
SSTR2, Gpa1 and the luciferase reporter. Only final
odorant concentrations of the three aldehydes above
10
)4
m were toxic for yeast cells, and this was ascribed
to the presence of the organic solvent (dimethyl sulfox-
ide) itself, which was deleterious for the yeast cells. So
the bioluminescence response as a function of odorant
concentration is significant up to 5 · 10
)5
m. The nar-
row bell-shaped dose–response curves in the range
from 5 · 10
)8
m to 5 · 10
)5
m indeed define the opera-
tional range of the I7 receptor.
We also examined receptor specificity by testing
whether a panel of nine various odorants might be
recognized by the yeast I7 OR. Among these, octanol,
A
B
Fig. 4. Effects of galactose induction and temperature on functional
expression of the I7 OR in yeast. (A) Luciferase bioluminescence
was measured following yeast stimulation by odorants in two
strains expressing either I7 OR and G
olf

m).
Similarly, the commonly used odorants isoamyl-acet-
ate, lyral, lilial, pyridine, diacetyl and cyclohexyl-acet-
ate, tested over the same concentration range, failed to
induce any luciferase activity. These findings are con-
sistent with those obtained with the I7 OR expressed
in mammalian cells [8,10] and strongly suggest that
yeast expressed I7 OR retains the ligand selectivity and
specificity equivalent to its mammalian expressed coun-
terpart.
The yeast-expressed OR17-40 was stimulated with
helional in the concentration range 5 · 10
)14
to
5 · 10
)4
m, yielding a bioluminescence dose–response
curve shown in Fig. 5B, with a threshold concentration
of 6 · 10
)8
m, and maximal amplitude for 5 · 10
)6
m.
As in the case of I7 OR, this curve is bell shaped, and
finely tuned for helional concentrations between
5 · 10
)5
m and 5 · 10
)7
m. In order to test OR17-40

in vacuoles (arrowheads) and sometimes associated
with vacuole membranes (open arrowheads). No gold
grains were observed on sections where the primary or
the secondary antibody was omitted. The presence of
the gold particles associated with the plasma mem-
brane indicates that at least some of the I7 molecules
produced are inserted at the site commensurate with
their ability to sense the external environment.
Fig. 5. Differential bioluminescence dose–response upon odorant stimulation of yeast-expressed olfactory receptors. Measurements were
performed on yeast transformed to coexpress the I7 OR, G
olf
and the luciferase reporter (A), and on yeast coexpressing the human OR17-
40, G
olf
, and the luciferase reporter (B). These strains were induced with 2% galactose at 15 °C. Dose–response curves are plotted as a dif-
ference of bioluminescence response to odorants relative to controls obtained by replacing odorants with water.
J. Minic et al. Expression of olfactory receptors in yeast for screening
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS 529
The I7 OR quantification by ELISA-type test
To quantify the level of I7 OR associated with mem-
branes, an ELISA-type test was carried out using the
specific anti-I7 IgG. As purified I7 receptor is not avail-
able the calibration curve was generated by serial dilu-
tion of keyhole limpet hemocyanin (KLH)-coupled I7
antigenic N-terminal 15-amino acid peptides. Fig. 8A
shows this calibration curve as well as the negative con-
trol obtained by probing KLH alone. Using the KLH-
coupled I7 peptide as a standard, the I7 antigen con-
centration in the range 1–100 lm could be measured
accurately (SD < 10%). Fig. 8B shows the ELISA

Fig. 6. Immunofluorescence confocal microscopy of the I7 OR
in yeast. Optical (left panels) and confocal (right panels) visualiza-
tion of spheroplasts from nontransformed MC18 yeast and yeast
transformed with pJH2-I7 expression vector (induced at 15 °C).
Immunolabeling was performed with the anti-I7 IgG and an
Alexa488-coupled secondary antibody on nonpermeabilized sphero-
plasts. Scale bar, 5 lm.
Fig. 7. Ultrastructural localization of the I7 OR in yeast. Yeast strain
transformed with pJH2-I7 expression vector and induced at 15 °C
was immuno-labeled with the primary anti-I7 IgG and 10 nm gold-
conjugated secondary antibody. Gold grains are present on the
plasma membrane (long arrows) and vesicles near the plasma
membrane (double arrows). They are also associated with endo-
plasmic reticulum cisternae (short arrows), the vacuole (arrow-
heads) and sometimes with vacuolar membrane (open arrows).
Bar, 0.25 lm.
Expression of olfactory receptors in yeast for screening J. Minic et al.
530 FEBS Journal 272 (2005) 524–537 ª 2004 FEBS
activity. By taking advantage of structural and func-
tional similarities between yeast and mammalian
GPCR signaling pathways, this assay enables the
quantitative measurement of receptor activity, or alter-
nately the detection of its ligands. Using known lig-
ands of I7 OR (heptanal, octanal and nonanal), we
successfully demonstrated that they act as agonists as
already experienced in mammalian cells. Odorants of
the same carbon chain length but with different func-
tional groups failed to induce any luciferase activity
demonstrating that the yeast borne receptor retains its
ligand specificity and selectivity. In addition, validation

The signal can be significantly enhanced through G
a
subunit engineering. The intense reporter activity regis-
tered demonstrates that the receptor naturally coupling
G
a
protein, G
olf
, is able to interact efficiently with
both the heterologous OR and the endogenous G
bc
complex, Ste4 ⁄ Ste18. The efficient coupling of G
olf
to
the pheromone response pathway was previously dem-
onstrated when it complemented a Gpa1 null mutation
in S. cerevisiae [35]. This is in contrast to a chimeric
Gpa1–G
olf
, which showed poor coupling efficiency
with either the OR and ⁄ or Ste4 ⁄ Ste18 [34]. We also
observed higher sensor sensitivity with G
olf
than with
the promiscuous G
a15
commonly used for pharmacolo-
gical studies of recombinant ORs. This probably arises
from the poor affinity of G
a15

improved expression, since on Western blots a signifi-
cant increase in receptor level was observed in the
membrane fraction. Under these conditions, neither
aggregation of possibly misfolded receptors within the
yeast, nor yeast vacuole overloading with species inten-
ded for degradation were observed by immunogold
labeling. Thus, it appears that galactose induction at
15 °C provides adequate conditions for functional
receptor expression. It remains unclear how S. cerevisi-
ae responds to mild low temperatures and at which
stage of the folding ⁄ trafficking process the reduced
temperatures have an effect. Recently it was reported
that in S. cerevisiae a temperature downshift to 10–
18 °C leads to an induction of specific ‘cold shock pro-
teins’, some of which are able to serve as molecular
chaperones [39]. Such proteins could be involved in the
upregulation of I7 OR functional expression observed
at 15 °C. However, other mechanisms that arise upon
lowering the temperature must also be considered. For
instance, lower temperature may positively affect the
yield of properly folded proteins [40–42]. Also, it is
interesting to note that reduced temperatures increase
the content in higher sterols within yeast cell mem-
branes [43]. This may not only improve receptor inser-
tion into the plasma membrane [44], but also allow
correct receptor activity [45].
The achievement of receptor plasma membrane
insertion was demonstrated by confocal immunofluo-
rescence microscopy of nonpermeabilized spheroplasts
and by ultrastructural immunogold analysis. In addi-

pensive screening assay with an extended dynamic
range, in which the many orphan ORs could be inves-
tigated against the extraordinary large number of nat-
urally occurring odorants. Although optimization is
certainly required for transfer to a high throughput
format, this method demonstrates a potential for con-
veniently screening a large number of organic mole-
cules as novel GPCR ligands which could serve as
leads for drug discovery.
Experimental procedures
Odorants and other reagents
Odorant solutions were prepared just before use as des-
cribed previously [10,34]. Octanal, nonanal, heptanal, diace-
tyl, cyclohexyl-acetate, octanol, octanon, octanoic acid,
isoamyl-acetate, pyridine were from Sigma-Aldrich (Saint
Quentin, Fallavier, France). Helional was a generous gift
from Givaudan-Roure (Du
¨
bendorf, Switzerland), courtesy
of B Schilling. Lyral and lilial were kindly provided by
Roche (Meylan, France).
Complete protease inhibitor cocktail, Endo H and PNG-
ase F were from Roche Diagnostics GmbH (Mannheim,
Germany). NaCl ⁄ P
i
pH 7.4 was from Oxoid (Basingstoke,
Hampshire, England). Phenylmethylsulfonyl fluoride
(PMSF), KLH, poly(l-lysine) (M
r
> 300 000), meta-perio-

CCC-3¢), and checked for the presence and sequence of the
new insert, as in the case of pJH2-I7.
Plasmids pJH2-I7 and pJH2-OR17-40 carry a galactose
inducible GAL1 ⁄ 10 promoter. The expression vector also
contains a GAL4 gene under the control of the GAL10 pro-
moter. The induction of the yeast, by galactose containing
media, results in overexpression of GAL4, in turn inducing
an increase of the expression of the OR gene under control
of GAL1. The pJH2 vector contains the URA3-selectable
marker.
Two G
a
protein expression vectors, pRGP-G
olf
,or
pRGP-G
a15
were used. The pRGP-G
olf
vector with the
cDNA of G
olf
under control of Gpa1 promoter was repor-
ted by Crowe et al. [35]. The pRGP-G
a15
expression vector
was obtained by replacing G
olf
coding sequence by the G
a15

, in the range 1–2). The pres-
ence of plasmids in transformed cells was verified by PCR
on nucleic acid extracts. Induction of I7 expression was per-
formed as reported for the SSTR2 induction [24] with the
exception of the temperature. In brief, the cells were washed
to remove glucose and cultured for 4–6 h in the selection
media containing 3% lactate, then pelleted and diluted to a
D
600
0.5 and finally cultured in the selection media A con-
taining 2% galactose at either 30 or 15 °C for about 18 or
60 h, respectively. All subsequent experiments with either
uninduced or induced yeasts were carried out with cells in
exponential growth phase (D
600
in the range 1–3).
RNA extraction and RT-PCR
RNA was extracted from yeast cells following the hot aci-
dic phenol procedure. RT-PCR was performed on DNAse-
treated RNA extracts. Primers used for RT-PCR were: for
the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT
AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG
AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC
TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG
CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT
GACCGCCTCCC-3¢); for G
olf
(5¢-GGTACCGCTGCAA

Pharmacia Biotech Europe). The membrane was blocked
J. Minic et al. Expression of olfactory receptors in yeast for screening
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS 533
with 5 lgÆmL
)1
polyvinyl alcohol for 1 min. This reaction
was stopped by soaking the membrane in 4.5% nonfat
dried milk in NaCl ⁄ P
i
. Membranes were incubated over-
night at 4 °C with rabbit anti-I7 polyclonal antibody raised
against its N-terminal 15 amino acids (custom made by
Neosystem, Strasbourg, France), rabbit anti-G
olf
(1 : 500,
Santa Cruz Biotechnology, Santa Cruz, CA, USA) or goat
anti-G
a16
(1 : 500, Santa Cruz Biotechnology) at 1 lgÆmL
)1
in 4.5% nonfat dried milk in NaCl ⁄ P
i
. After washing,
membranes were incubated for 1 h at room temperature
with either biotin conjugated anti-rabbit IgG (Sigma)
(1 : 1000) and streptavidin-horseradish peroxidase conju-
gate (Amersham Pharmacia Biotech Europe) (1 : 1000) or
anti-goat IgG conjugated to horseradish peroxidase
(1 : 2000) diluted in the same buffer. Blots were revealed
using the enhanced chemiluminescence (ECL) detection kit

KLH-coupled-antigenic peptide (0–1 · 10
)13
mol) were
deposited in the poly(l-lysine) (0.01%) coated wells of a
96-well plastic plate for 1 h at 37 °C. Corresponding dilu-
tions of KLH alone, membrane fraction of nontransformed
yeast, or membrane fraction of yeast transformed with the
pJH2-SSTR2 plasmid and thus expressing the SSTR2
receptor instead of the I7 OR [24] were also deposited as
negative controls. The plates were saturated for 2 h in the
blocking buffer [3% (v ⁄ v) goat serum, 3% (w ⁄ v) BSA in
NaCl ⁄ P
i
], then incubated overnight at 4 °C with the anti-I7
IgG in blocking buffer (1 : 200). After rinsing three times
with 0.05% (v ⁄ v) Tween, NaCl ⁄ P
i
(PBST) and three times
with NaCl ⁄ P
i
the plates were incubated for 1 h at 37 °C
with the secondary anti-rabbit biotinylated antibody
(1 : 500) and horseradish streptavidine peroxidase (1 : 500)
in blocking buffer. After extensive washing with PBST and
NaCl ⁄ P
i
, 3,3¢,5,5¢-tetramethylbenzidine kit from Kirkegaard
& Perry Laboratories (Gaithersburg, MD, USA) was used
to yield a colorimetric reading.
Immunodetection and confocal microscopy

0.15 m NaCl, pH 8.2, and twice with NaCl ⁄ P
i
. Slides were
mounted with Vectashield antifading mounting medium
(Vector Laboratories, Inc., Burlingame, CA, USA) and
stored at 4 °C in the dark until viewed. Immunolabeled
spheroplasts were observed with a Carl Zeiss LSM 310 con-
focal laser scanning microscope. Images were treated using
imagej and Adobe photoshop (Adobe Systems, San Jose,
CA, USA) softwares.
Immunodetection and electron microscopy
Yeast cell fixation and embedding were carried out accord-
ing to the protocol described by Sander et al. [23]. Briefly,
cells were fixed with 4% (v ⁄ v) paraformaldehyde,
2.5% (v ⁄ v) glutaraldehyde and 1% (w ⁄ v) meta-periodate in
0.1 m cacodylate buffer pH 7.3, for 3.5 h at room tempera-
ture. Afterwards, the cells were washed twice with this buf-
fer and incubated overnight in buffered glycine (2%). The
following day, cells were postfixed in 1% OsO
4
in caco-
dylate buffer for 1 h, washed with water, subsequently trea-
ted with aqueous 2% (w ⁄ v) uranyl acetate for 1 h and
enclosed in 2% (w ⁄ v) agar-agar. After consolidation at
4 °C and fixation in 2.5% (v ⁄ v) glutaraldehyde for 15 min,
the pellet was cut into 1 mm
3
pieces. These were dehydra-
ted in a graded ethanol series and embedded in epoxy resin
(LX112, Ladd Research Industries, Inland Europe, Con-

⁄ BSAc applied
1.5 h at room temperature. After extensive washing in
NaCl ⁄ P
i
⁄ BSAc and NaCl ⁄ P
i
, the antigen–antibody complex
was stabilized with 2.5% glutaraldehyde in NaCl ⁄ P
i
. The
sections were then contrasted using Reynolds’ lead citrate
before observation. Controls for the immunocytochemical
reaction were carried out by replacing either the primary or
the secondary antibody by the incubation buffer in the
reaction sequence. The sections were finally viewed under a
CM12 Philips electron microscope.
Functional assay in vivo
Two million cells in 200 lL culture media were incubated
with an odorant for 60 min at room temperature to
induce the reaction scheme summarized in Fig. 1. The
yeast cells were then pelleted and resuspended in 200 lL
25 mm glycylglycin buffer (pH 7.8), 1 mm EDTA, 8 mm
MgSO
4
,1%(v⁄ v) Triton X-100, 15% (v ⁄ v) glycerol, 1 mm
dithiothreitol. Samples were homogenized for 20 s with a
Potter in an Eppendorf tube and luciferase activity was
recorded from 100 lL placed in a Lumat LB 9501 lumi-
nometer (Berthold Technologies, Bad Wildbad, Germany).
The reaction was initiated by injection of 2.2 mm luciferin

Chem 273, 17979–17982.
2 Ronnett GV & Moon C (2002) G proteins and olfactory
signal transduction. Annu Rev Physiol 64, 189–222.
3 Wess J (1997) G-protein-coupled receptors: molecular
mechanisms involved in receptor activation and selectiv-
ity of G-protein recognition. FASEB J 11, 346–354.
4 Zhao H, Ivic L, Otaki JM, Hashimoto M, Mikoshiba K
& Firestein S (1998) Functional expression of a mam-
malian odorant receptor. Science 279, 237–242.
5 Malnic B, Hirono J, Sato T & Buck LB (1999) Combi-
natorial receptor codes for odors. Cell 96, 713–723.
6 Gaillard I, Rouquier S, Pin JP, Mollard P, Richard S,
Barnabe C, Demaille J & Giorgi D (2002) A single
olfactory receptor specifically binds a set of odorant
molecules. Eur J Neurosci 15, 409–418.
7 Reed RR (2004) After the holy grail: establishing a
molecular basis for mammalian olfaction. Cell 116, 329–
336.
8 Araneda RC, Kini AD & Firestein S (2000) The mole-
cular receptive range of an odorant receptor. Nat
Neurosci 3, 1248–1255.
9 Touhara K (2002) Odor discrimination by G protein-
coupled olfactory receptors. Microsc Res Tech 58, 135–
141.
10 Levasseur G, Persuy MA, Grebert D, Remy JJ, Salesse
R & Pajot-Augy E (2003) Ligand-specific dose–response
of heterologously expressed olfactory receptors. Eur J
Biochem 270, 2905–2912.
11 Oka Y, Omura M, Kataoka H & Touhara K (2004)
Olfactory receptor antagonism between odorants.

19 Krautwurst D, Yau KW & Reed RR (1998) Identifica-
tion of ligands for olfactory receptors by functional
expression of a receptor library. Cell 95, 917–926.
20 Hatt H, Lang K & Gisselmann G (2001) Functional
expression and characterization of odorant receptors
using the Semliki Forest virus system. Biol Chem 382,
1207–1214.
21 Hague C, Uberti MA, Chen Z, Bush CF, Jones SV,
Ressler KJ, Hall RA & Minneman KP (2004) Olfactory
receptor surface expression is driven by association with
the beta2-adrenergic receptor. Proc Natl Acad Sci USA
101, 13672–13676.
22 King K, Dohlman HG, Thorner J, Caron MG &
Lefkowitz RJ (1990) Control of yeast mating signal
transduction by a mammalian beta 2-adrenergic recep-
tor and Gs alpha subunit. Science 250, 121–123.
23 Sander P, Grunewald S, Bach M, Haase W, Reilander H
& Michel H (1994) Heterologous expression of the
human D2S dopamine receptor in protease-deficient
Saccharomyces cerevisiae strains. Eur J Biochem 226,
697–705.
24 Price LA, Kajkowski EM, Hadcock JR, Ozenberger BA
& Pausch MH (1995) Functional coupling of a mamma-
lian somatostatin receptor to the yeast pheromone
response pathway. Mol Cell Biol 15, 6188–6195.
25 David NE, Gee M, Andersen B, Naider F, Thorner J &
Stevens RC (1997) Expression and purification of the
Saccharomyces cerevisiae alpha-factor receptor (Ste2p),
a 7-transmembrane-segment G protein-coupled receptor.
J Biol Chem 272, 15553–15561.

terminal region essential for receptor phosphorylation.
J Biol Chem 278, 47466–47476.
34 Pajot-Augy E, Crowe M, Levasseur G, Salesse R &
Connerton I (2003) Engineered yeasts as reporter sys-
tems for odorant detection. J Recept Signal Transduct
Res 23, 155–171.
35 Crowe ML, Perry BN & Connerton IF (2000) Golf
complements a GPA1 null mutation in Saccharomyces
cerevisiae and functionally couples to the STE2 phero-
mone receptor. J Recept Signal Transduct Res 20, 61–73.
36 Jaquette J & Segaloff DL (1997) Temperature sensitivity
of some mutants of the lutropin ⁄ choriogonadotropin
receptor. Endocrinology 138, 85–91.
37 Hansen MK, Tams JW, Fahrenkrug J & Pedersen PA
(1999) Functional expression of rat VPAC1 receptor in
Saccharomyces cerevisiae. Receptors Channels 6,
271–281.
38 Araneda RC, Peterlin Z, Zhang X, Chesler A &
Firestein S (2004) A pharmacological profile of the alde-
hyde receptor repertoire in rat olfactory epithelium.
J Physiol 555, 743–756.
39 Kandror O, Bretschneider N, Kreydin E, Cavalieri D &
Goldberg AL (2004) Yeast adapt to near-freezing tem-
peratures by STRE ⁄ Msn2,4-dependent induction of
trehalose synthesis and certain molecular chaperones.
Mol Cell 13, 771–781.
40 Arora D & Khanna N (1996) Method for increasing the
yield of properly folded recombinant human gamma
interferon from inclusion bodies. J Biotechnol 52, 127–
133.