Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation - Pdf 10

Functional analysis of the basic helix-loop-helix transcription factor
DEC1 in circadian regulation
Interaction with BMAL1
Fuyuki Sato
1
, Takeshi Kawamoto
1
, Katsumi Fujimoto
1
, Mitsuhide Noshiro
1
, Kiyomasa K. Honda
1
,
Sato Honma
2
, Ken-ichi Honma
2
and Yukio Kato
1
1
Department of Dental and Medical Biochemistry, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima, Japan;
2
Department of Physiology, Hokkaido University Graduate School of Medicine, Sapporo, Japan
The basic helix-loop-helix transcription factor D EC1 is
expressed i n a circad ian manner in t he suprachiasmatic
nucleus where it s eems to play a role in regulating the
mammalian circadian rhythm by suppressing the
CLOCK/BMAL1-activated promoter. The interaction of
DEC1 with BMAL1 has been suggested a s one of the
molecular mechanisms of the suppression [Honma, S.,

izes to the 24 h period after light entrainment. In mammals,
the clock genes Clock, Bmal1, Per and Cry, and their protein
products, comprise a molecular feedback loop in which a
CLOCK/BMAL1 h eterodimer b inds to a CACGTG E-box
and activat es transcription o f Per and Cry [1,2]; protein
products of Per and Cry in turn suppress the transactivation
by CLOCK/BMAL1 [3,4]. This core feedback loop appar-
ently g enerates a 24 h period in the molecular oscillator.
Furthermore, another feedback loop has been reported to
control the rhythmic expression of Bmal1: expression o f
Rev-Erba is inducible by the CLOCK/BMAL1 heterodimer,
and its protein product suppresses the expression of Bmal1
[5,6]. These two feedback loops may b e interlocked to
stabilize the circadian core loop system.
DEC1 (bhlhb2) and DEC2 (bhlhb3) are basic helix-loop-
helix (bHLH) transcription factors which bind to CAC-
GTG E-boxes and suppress transcription from target genes
[7–12]. Expression of DEC1 and DEC2 showed circadian
rhythms in most organs, including the suprachiasmatic
nucleus (SCN) [7,13], and Dec1 expression in the SCN was
enhanced by a light pulse in a phase-dependent manner
similar t o Per1. M oreover, DEC1 and D EC2 suppressed
Per1 transactivation by CLOCK/BMAL1 through com-
petition for binding to E-boxes and/or protein–protein
interactions of DECs with BMAL1 [ 7]. Furthermore, w e
recently demonstrated the existence of a novel autofeedback
loop associated with Dec1 transcription, with CLOCK/
BMAL1 a s positive elements and DECs as negative
elements [11]. T hree CACGTG E-boxes in the Dec1
promoter were responsible for the rhythmic expression of

As Dec2 expression was f ound to increase in the mutant
mice, the disruption of DEC1 might be compensated by
DEC2. Further investigation is required to clarify the
functions of DEC1 and DEC2.
The suppressive activities of DEC1 and DEC2 against
CLOCK/BMAL1-activated promoters are strong com-
pared with the transcriptional suppression by DEC1
without CLOCK/BMAL1 activation ( T. Kawamoto,
unpublished data). I n t his s tudy, w e examined, by using
various DEC1 mutants, the relationship between the
DEC1–BMAL1 interactio n and transcriptional suppression
by DEC1. We also evaluated the E-box-binding activity of
these mutants. Our results showed that the region of DEC1
required for transcriptional suppression by DEC1 coincided
with that for interaction with BMAL1 and binding to the
E-boxes, indicating the importance of t his region in DEC1
for its suppressive activity against CLOCK/BMAL1-
induced transcription.
Materials and methods
Plasmid constructions
To obtain deleted fragments from the 3¢-terminus of human
Dec1 (hDec1)cDNA[18],a5¢-terminus pr imer (5 ¢-AAG
CTTCACCATGGAGCGGATCCCCAGCGCGCAACC
AC-3¢)anda3¢-terminus primer (one of 5 ¢-TCTA
GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA
TGG-3¢,5¢-TCTAGACTACCCACTCGAGTGAGCGA
AAGTCCGCTGG-3¢ or 5¢-TCTAGACTATTGACCTG
TTTCGACATTTCTCCCTGACAGCTC-3¢)wereused
for PCR amplification, with hDec1 cDNA as a template.
For the amplification of deleted fragments from the

basic region- and Orange domain-deleted DEC1 mutants,
three sets of primers (5¢-ATTGATCAGC AGCAGCA
GAAAATCATTGCC-3¢ and 5¢-CTTGCTGTCCTCG
CTCCGCTTTATTCCC-3 ¢ for DEC1DbHLH and
DEC1:4–232DbHLH; 5¢-GACCGGATTAACGAGTGC
ATCGCCCAG-3¢ and 5 ¢-CTTGCTGTCCTCGCTCCGC
Fig. 1. Suppress ive activity of DEC1 against the CLOCK/BMAL1-activated promoter. (A) Deletion a nalysis of DEC1. Expression vec tors (10 ng
per well) encoding various deletion mutants of DEC1 were cotransfected with the luciferase reporter construct pDEC1-E-ABC-TK (2 ng per well),
together with expression vectors for CLOCK and BMAL1 (each 50 ng p er well), into NIH3T3 cells. After incubation for 48 h, luciferase activities
were measured. The values represent relative luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 15). Structures of the DEC1 mutants
are schematically shown in the left-hand panel, with the basic helix-loop -helix ( bHLH) and Orange domains indicate d. The expression of DEC1
mutants was examined by Western blot analysis by using anti-DEC1 immunoglobulin (lower-right panel). Various DEC1 mutants are indicated by
arrowheads. (B) Dose-dependency of DEC1 suppressive activity. Increasing amoun ts (0.1, 1 and 10 ng) of FLAG-DEC1 expression vector were co-
transfected with pDEC1-E-ABC-TK, together with expression vectors for CL OCK and BMAL1. The total amount of transfected DNA was
adjustedtothesamevalue,ineachexperiment,bytheadditionofanemptyvector (pcDNA3.1/Zeo). Relative luciferase activities of pDEC1-E-
ABC-TK (mean ± SEM, n ¼ 6) are shown in the left-hand panel. Expression of FLAG-DEC1 was examined by Western blot analysis with anti-
FLAG immunoglobulin (right panel). (C) Expression levels of DEC1 and BMAL1 were compared by using FLAG-tagged proteins. Expression
vectors for FLAG -BMAL1 ( 50 ng per w ell) an d C LOCK (50 ng p er well) were cotransfected with a FLAG-DEC1 expression vector (lane 2) o r
with an empty vector (lane 1) (10 ng per well). Expression of FLAG-tagged protein was examined by Western blot analys is with anti-FLAG
immunoglobulin (left-hand panel). The transcriptional activities of FLAG-BMAL1 and FLAG-DEC1 were confirmed by using the luciferase assay
(right-hand panel). The values represent relative luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 10). (D) Effect of the histone
deacetylase (HDAC) inhibitor on DEC1 or DEC2 suppressive activity agaist the CLOCK/BMAL1-activated promoter. The reporter construct,
pDEC1-E-ABC-TK, was co-transfe cted with expression vectors for CLOCK and BMAL1 together with increasing amounts of a DEC1 or a DEC2
expression vector, as indicated. The supp ressive activity of DEC2 was much higher than that of DEC1. The HDAC inhibitor, trichostatin A (TSA)
(300 n
M
), was added 24 h after transfection, and incubation was continued for a further 24 h. The luciferase activity (mean ± SEM, n ¼ 5) of
pDEC1-E-ABC-TK, without the DEC1 or DEC2 expression vector, in t he pre sence or absence of T SA, was given a value of 100. P-values were
calculated by using the Student’s t-test (**P<0.01, *P<0.05).
4410 F. Sato et al. (Eur. J. Biochem. 271) Ó FEBS 2004

5¢-terminus primer (one of 5¢-GGATCCGTGCGGACCA
GAGAATGGACATTTCCTC-3¢,5¢-GGATCCTCACC
GTGCTAAGGATGGCTGTTCAGCAC-3¢ or 5¢-GGAT
CCCCTCCCGGCTATGCTCTGGAGCC-3¢)wereused
for amplification by PCR, wit h mBmal1 cDNA as a
template. The cDNAs thus obtained were subcloned into
the mammalian two-hybrid vector pBIND (Promega) for
expression of the GAL4 DNA-binding domain (DNA-BD)
fusion protein.
Luciferase reporter assay
Twenty-four hours before transfection, NIH3T3 cells were
seeded at 2 · 10
4
cells per 16 m m well. The luciferase
reporter plasmid pDEC1-E-ABC-TK, carrying three hDec1
CACGTG E-boxes connected to the thymidine kinase (TK)
promoter (2 ng per well), or pDEC1-3620 carrying the hDec1
promoter [19], was co-transfected with expression vectors for
mouse CLOCK and BMAL1 (each 50 ng per well), together
with an expression vector for human DEC1 or DEC2 (10 ng
or the indicated amount per well), by using Trans IT
polyamine (Mirus, Madison, WI , USA), as described
previously [11]. As an internal standard, 0.2 ng of phRL-
TK (Promega) was co-transfected. The total amount of
transfected DNA was a djusted to the same va lue, in each
experiment, by using an empty vector (pcDNA3.1/Zeo). The
cells were incubated for 48 h and then subjected to the
luciferase reporter assay by using the Dual-Luciferase
Reporter Assay System (Promega). Luciferase activities were
normalized relative to internal control a ctivities. The experi-

using PolyFect Transfection Reagent (Qiagen). Forty-eight
hours after transfection, the cells were harvested and
dissolved in 200 or 30 lL of S DS sample buffer. Equal
volumes of the samples (15 lL) were subjected to SDS/
PAGE and transferred onto a nylon membrane (Immobilon
P; Millipore). DEC1, FLAG-DEC1, FLAG-BMAL1 and
VP16-DEC1 were detected with anti-DEC1:251–268, anti-
FLAG (Sigma) and anti-VP16 (Santa Cruz) immuno-
globulins.
Electrophoretic mobility shift assay
Various DEC1 mutant proteins (including VP16-fused
protein) and luciferase protein, as a control product,
were synthesized by using the TNT Quick Coupled
Transcription/Translation S ystem (Promega). T he expres-
sion levels were confirmed by using Western blot analysis
with anti-D EC1 o r anti-VP16 immunoglobulin. T he
double-stranded oligonucleotides of Dec1 E-box C
(5¢-ctagGTCCAA
CACGTGAGACTCtcga-3¢; E-box is
underlined) were end-labelled by using [
32
P]dCTP[aP]
(Du Pont-New England Nuclear) and DNA poly-
merase I Klenow fragment (TAKARA). Synthesized
protein was incubated with approximately 40 000 c.p.m.
of
32
P-labelled E-box C probe for 15 m in at room
temperature in 10 lLof10m
M

beads in binding buffer (20 m
M
Tris/HCl, pH 8.0, 200 m
M
NaCl, 1 m
M
EDTA, 0.5% (v/v) Nonidet P-40 and
5mgÆmL
)1
of bovine serum albumin) for 2 h at 4 °C. The
beads were washed three times with binding buffer and the
bound proteins were analyzed by SDS/PAGE and a uto-
radiography.
Results
Deletion analysis of DEC1 on its suppressive activity
in the presence of CLOCK and BMAL1
Using deletion analyses, two regions in the protein
product of Dec1 have been identified as important
domains for i ts suppressive activity of transcription from
4412 F. Sato et al. (Eur. J. Biochem. 271) Ó FEBS 2004
some genes, including Dec2 and PPARc2,intheabsence
of other transcription facto rs, such as CLOCK and
BMAL1 [9,10,22,23]: an N-terminal region between amino
acids 1 and 141, and another region between amino acids
147 and 354, were reported to be essential f or the
suppression of the target g enes. To d etermine which
region in DEC1 is required for the suppression of
CLOCK/BMAL1-induced transcription, truncated forms
of DEC1 were expressed in NIH3T3 cells together with
CLOCK and BMAL1, and their transcriptional activities

FLAG-tagged proteins were expressed in NIH3T3 c ells
and subjected to Western blot analysis by using anti-
FLAG immunoglobulin. As shown in Fig. 1C, transfec-
tion o f 10 ng of FLAG-DEC1 expression vector and
50 ng of FLAG-BMAL1 expression vector resulted in
adequate levels of expression. The transcriptional activity
of FLAG-BMAL1, and the suppressive activity of FLAG-
DEC1, were s imilar to those of intact BMAL1 and
DEC1, respectively (Fig. 1A,C). These findings indicate
that the region between amino acids 28 and 139 of DEC1
(including the bHLH domain) is sufficient for the
suppressive activity of DEC1. The C-terminal region
(amino acids 140–412), including the Orange domain
[18], i s not required for suppression in the presence of
CLOCK/BMAL1.
Involvement of histone deacetylase (HDAC) in DEC1
or DEC2 suppression of CLOCK/BMAL1-induced gene
expression
DEC1 and GAL4 DNA-BD-fused DEC2 bo und to HDAC
and suppressed t ranscription from, r espectively, the Dec1
(Stra13) promoter and the GAL4 response promoter
[24,25]; however, suppression of c-myc expression by
DEC1 did not require HDAC [24]. To examine whether
CLOCK/BMAL1-induced gene expression is suppressed by
DEC1 or DEC2 via an HDAC-dependent pathway, we
added TSA (a specific inhibitor of HDAC) to the cell
cultures 24 h after transfection of reporter plasmids. The
addition of TSA r eversed the suppression b y DEC1 o r
DEC2, a s s hown i n Fig. 1D, indicating that an HDAC-
co-repressor complex(es) may be involved, at l east partly, in

The HXXXXXXXR sequence in the bas ic r egion h as
been rep orted to be conserved among group B bHLH
proteins [26,27]. We t herefore examined whether these
amino acid residues are required for DEC1 activity.
Substitution of Arg65 for Ala(DEC1-R65A) severely
reduced the suppressive activity of DEC1, whereas substi-
tution of His57 for Ala(DEC1-H57A) did not alter the
activity (Fig. 3A). As Western blot analysis showed that the
expression levels of the R65A mutant were lower than that
of full-length DEC1, we next g enerated expression
constructs for FLAG-fused R65A mutant and R65K
mutant DEC1. The expression levels of R65A and R65K
mutants were comparable to those of FLAG-fused DEC1,
but they did not have any significant suppressive activity
against C LOCK/BMAL1-induced transcription. From
these findings, we conclude that the basic region, p artic-
ularly the conserved A rg65, but not His57, is essential for
the suppressive activity of DEC1.
Determination of the binding domain of DEC1 to BMAL1
The interaction of DEC1 and BMAL1 was previously
demonstrated by a yeast two-hybrid assay [ 7], and this
interaction may be involved in the suppressive activity of
DEC1 against CLOCK/BMAL1-induced transcription.
To confirm that the binding of DEC1 and BMAL1
actually occurs in mammalian cells, w e performed a
mammalian t wo-hybrid assay by using various DEC1
mutant constructs. The N-terminal region of DEC1
(DEC1:4–232 or DEC1:4–139) interacted with BMAL1
(Fig. 4). However , deletion of the basic region or of the
bHLH domain completely abrogated the DEC1–BMAL1

sion of VP16-fused DEC1 mutants were confirmed by
Western blot analysis. Taken together with the results
shown in Figs 1–3, these findings indicate that the region
required for the suppressive activity of DEC1 is also
required for the interaction with BMAL1.
Binding of DEC1 mutants to a CACGTG E-box
To e xamine the binding ability o f DEC1 mutants to the
CACGTG E-box in the Dec1 promoter, an electrophoretic
mobility shift assay was performed. Shifte d bands were
observed by using full-length DEC1 (DEC1:1–412) (Fig. 5,
lanes 1 and 5 ) or O range domain-deleted DEC1 (DEC1-
DOrange) (lane 4), whereas no bands were detected by using
basic region-deleted D EC1 ( DEC1Dbasic and DEC1:4–
232Dbasic) (lanes 2 and 14) or bHLH domain-deleted
DEC1 (DEC1DbHLH and D EC1:4–232DbHLH) (lanes 3
and 15). His57-substituted DEC1 (DEC1-H57A) showed a
very low binding ab ility for the E-box (lane 7), and
substitution of Arg65 for Ala(DEC1-R65A and DEC1:4–
2332-R65A) abolished DEC1 binding to the E-box (lanes 6
and 16). On t he other hand, deletion of up to 273 residues
from the C-terminal region of DEC1 (VP16-DEC1:4–232
and VP16-DEC1:4–139) did not diminish the b inding
activity (lanes 9, 10 and 13), whereas deletion of 296
residues (VP16-DEC1:4–116) decreas ed the binding (lane
11), and deletion of 312 residues (VP16-DEC1:4–100)
abolished it (lane 12). Expression levels of DEC1 mutants
and VP16-tagged DEC1 mutants synthesized by in vitro
transcription/translation were confirmed by W estern blot
analysis (Fig. 5 ). These r esults indicate that the bHLH
region, including His57 and Arg65, is responsible for t he

emptypACTorpBINDvectorwasusedasa
control. The cells were inc ubated for 48 h and
subjectedtotheluciferase reporter assay.
Relative luciferase activities of pG5luc
(mean ± SEM, n ¼ 11) were normalized
relative to internal control activities.
**P<0.01 (Student’s t-test). Interactions
between the VP16 AD- DEC1 f usion prote in
and the GAL 4 DNA-BD-BMAL1 fusion
proteinresultedinanincreaseinexpression
of the luc iferase g ene. E xpression o f the
VP16-DEC1 fusion protein was examined by
Western blot analysis with an a nti-VP16
immunoglobulin.
Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur. J. Biochem. 271) 4415
whereas the N-terminal region, containing the bHLH
domain, is not essential for the interaction.
Dominant-negative DEC1 counteracts the suppression
of CLOCK/BMAL1-induced transcription in the presence
of full-length DEC1
As DEC1 lacking the basic region interfered with full-length
DEC1 for the transcriptional suppression in the absence of
CLOCK/BMAL1 [9], we examined whether DEC1Dbasic is
a dominant-negative competitor in t he presen ce of CLOCK
and BMAL1. Co-transfection with an expression plasmid
for DEC1Dbasic diminished the suppressive activity of
full-length DEC1 in a dose-dependent manner (Fig. 7A).
In addition, DEC1 carrying the substitution Arg65 for
Ala (DEC1-R65A) showed a similar ability (Fig. 7B).
However, neither DEC1Dbasic nor DEC1-R65A alone

to the CACGTG E-box in the Dec1 promoter.
Various DEC1 mutants and VP1 6-tagged
DEC1 mutants were synthesized by using an
in vitro transcription/translation system. The
32
P-labelled Dec1 E-box C probe was incuba-
ted with DEC1 mutants (lanes 1–7), V P16-
tagged DEC1 mutants (lanes 9–16) or luci-
ferase protein synthesized as a control product
(cont.) (lanes 8 and 17). Shifted bands of
radiolabelled E-box C a nd m utant DEC1
complexes are indicated by asterisks. Expres-
sion levels of DEC1 mutants and VP16-DEC1
mutants were con firmed by W estern b lot
analysis with anti-DEC1 and anti-VP16
immunoglobulin (lower p anels). Faint, non-
specific bands were also observed, even when
the probe was i ncubated with a control
protein.
Fig. 6. Identification of t he domain of B MAL1 that inte racts with
DEC1. Interactions of various truncated BMAL1 mutants with DEC1
in NIH3T3 cells were examined. pBIND, carrying various lengths of
Bmal1 cDNA, w as co-transfected with pACT carrying Dec1 cD NA
together with pG 5luc . Luciferase activities of pG5 luc (mean ± SEM,
n ¼ 11) were normalized by internal control activities. **P<0.01
(Student’s t-test).TheregionsofBMAL1expressedasaGAL4fusion
protein are schematically shown in the upper panel. The basic helix-
loop-helix (bHLH), PAS-A and PAS-B domains [32] are i ndicated.
Interactions between GAL4 DNA-BD-BMAL1 fusion protein and
VP16 AD-DEC1 fusion protein resulted in an increase in luciferase

35
S-labelled DEC1 was incu-
bated with glutathione S-transferase (GST) or GST-DEC2 on gluta-
thione-agarose beads for 2 h at 4 °C. The b eads were washed three
times, subjected to S DS/PAGE with 10% of input
35
S-labelled DEC1,
and visualized by autoradiography.
Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur. J. Biochem. 271) 4417
DEC1 with BMAL1 and the bin ding to the E-box.
Substitution of Arg65 for Ala abolished the interaction of
DEC1 with BMAL1 and the binding of DEC1 to the E-box.
However, substitution of His57 for Ala did not affect the
interaction of D EC1 w ith BMAL1, nor its suppressive
activity, although it strongly decreased the DEC1 binding
activity to the CACGTG E-box. DEC1 therefore appears to
suppress the CLOCK/BMAL1-induced transcription, at
least in part, by interacting with BMAL1.
The amino acid residue Arg65 in the basic region of
DEC1 is conserved a mong the g roup B bHLH proteins
(such as USF, c-Myc, MAX and MAD) that can bind
to the CACGTG E-box [26], along with some other
transcription factors [29,30]. This amino acid residue was
also important for the interaction between DEC1 and
BMAL1, as shown in this study, and, moreover, the Arg
residue might be crucial for t he activities of the o ther
group B bHLH proteins. In addition to BMAL1, DEC1
can bind to various transcription factors such as USF2
[29], MASH1 [23] and E47 [31], or t o co-repressors such
as H DAC1, mSin3A and NcoR [ 24]. USF2-DEC1

Gekakis, N., Steeves, T.D., Weitz, C.J., Takahashi, J.S. & Kay,
S.A. (1998) Closing the circadian loop: CLOCK-induced tran-
scription of its own inhibitors per and tim. Science 280, 1599–1603.
2. Gekakis, N., Staknis, D., Nguyen, H.B., Davis, F.C., Wilsbacher,
L.D., King, D.P., Takahashi, J.S. & Weitz, C.J. (1998) Role of the
CLOCK protein in the mammalian circadian mechanism. Science
280, 1564–1569.
3. Kume, K., Zylka, M.J., Sriram, S., Shearman, L.P., Weaver, D.R.,
Jin, X., Maywood, E.S., Hastings, M.H. & Reppert, S.M. (1999)
mCRY1 and mCRY2 are e ssential components of the negative
limb of the circadian clo ck fe edback loop. Cell 98, 193–205.
4. Yagita, K., Yamaguchi, S., Tamanini, F., van der Horst, G.T.,
Hoeijmakers, J.H., Yasui, A., Loros, J.J., Dunlap , J.C. &
Okamura, H. (2000) Dimerization and nuclear entry of mPER
proteins in mam malian cells. Genes Dev. 14, 1353–1363.
5. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J.,
Duboule, D. , Albrecht, U. & Schibler, U. ( 2002) The orphan
nuclear re ceptor R EV-ERBalp ha c ontro ls circad ian transcription
within the p ositive limb of the mammalian circadian oscillator.
Cell 110, 251–260.
6. Ueda, H.R., Chen, W ., Adachi, A., W akamatsu, H., Hayashi, S.,
Takasugi, T., Nagano, M., Nakahama, K., Suzuki, Y., Sugano,
S., Iino, M., Shigeyoshi, Y. & Hashimoto, S. (2002) A transcrip-
tion factor response element for gene expression during circadian
night. Nature 418, 534–539.
7. Honma, S., Kawamoto, T., Takagi, Y., Fujimoto, K., Sato, F.,
Noshiro, M., Kato, Y. & Honma, K. (2002) Dec1 and Dec2 are
regulators of the mammalian molecular clock. Nature 419, 841–
844.
8. Zawel,L.,Yu,J.,Torrance,C.J.,Markowitz,S.,Kinzler,K.W.,

Dec2 expression is disrupted in th e suprachiasmatic nuclei o f
Clock mutant mice. J. Biol. Rhythms 19, 126–134.
16. Shen, M., Yoshida, E., Yan, W., Kawamoto, T., Suardita, K.,
Koyano, Y., Fujimoto, K., Noshiro, M. & Kato, Y. (2002) Basic
helix-loop-helix protein DE C1 promot es chondrocyte d ifferentia-
tion at the early and terminal stages. J. Biol. Chem. 277, 50112–
50120.
17. Grechez-Cassiau, A., Panda, S., Lacoche, S., Teboul, M., Azmi,
S.,Laudet,V.,Hogenesch,J.B.,Taneja,R.&Delaunay,F.(2004)
The transcriptional repressor STRA13regulatesasubsetofper-
ipheral circadian outputs. J. Biol. Chem. 279, 1141–1150.
18. Shen, M., Kawamoto, T., Yan, W., Nakamasu, K., Tamagami,
M.,Koyano,Y.,Noshiro,M.&Kato,Y.(1997)Molecular
4418 F. Sato et al. (Eur. J. Biochem. 271) Ó FEBS 2004
characterization of the n ovel basic helix-loop -helix protein DEC1
expressedindifferentiatedhumanembryochondrocytes.Biochem.
Biophys. Res. Commun. 236, 294–298.
19. Miyazaki, K., Kawamoto, T., Tanimoto, K ., Nishiyama, M.,
Honda,H.&Kato,Y.(2002)Identificationoffunctionalhypoxia
response elements in the promoterregionoftheDEC1andDEC2
genes. J. Biol. Chem. 277, 47014–47021.
20. Fujimoto, K., Shen, M., Noshiro, M ., Matsubara, K., S hingu, S.,
Honda,K.,Yoshida,E.,Suardita,K.,Matsuda,Y.&Kato,Y.
(2001) Molecular cloning and characterization of DEC2, a new
member of basic helix-loop-helix proteins. Biochem. Biophys. Res.
Commun. 280, 164–171.
21. Guan, K.L. & Dixon, J.E. (1991) Eukaryotic proteins expressed in
Escherichia coli: an improved thrombin cleavage and purification
procedure of fusion proteins with g lutathione S-transferase. Anal.
Biochem. 192, 262–267.

Oncogene 20, 4750–4756.
30. Grandori, C., Cowley, S.M., James, L.P. & Eisenman, R.N. (2000)
The Myc/Max/Mad n etwork and the transcriptional control o f
cell behavior. Annu.Rev.CellDev.Biol.16, 653–699.
31. Dear, T.N., Hainzl, T., Follo, M., Nehls, M., Wilmore, H.,
Matena, K. & Boehm, T. (1997 ) I dentification of interaction
partners for the basic-helix-loop-helix protein E47. Oncogene 14,
891–898.
32. Yu, W., Ikeda, M., Abe, H., Honma, S., Ebisawa, T., Yamauchi,
T., Honma, K. & Nomura, M. (1999) Characterization of three
splice variants and genomic o rganization of the mouse BMAL1
gene. Biochem. Biophys. Res. Commun. 260, 760–767.
Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur. J. Biochem. 271) 4419


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status