Gene expression in response to endoplasmic reticulum
stress in Arabidopsis thaliana
Shinya Kamauchi, Hiromi Nakatani, Chiharu Nakano and Reiko Urade
Graduate School of Agriculture, Kyoto University, Uji, Japan
A nascent polypeptide synthesized on the rough
endoplasmic reticulum (ER) is translocated and
folded with the assistance of molecular chaperones
and other folding factors such as glycosylation ⁄ modi-
fication enzymes and disulfide oxidoreductases within
the ER. However, the folding of nascent polypep-
tides occasionally does not occur, resulting in the
accumulation of unfolded or misfolded proteins in
the ER (ER stress). To solve this problem, eukaryotic
cells sense ER stress and induce a set of genes called
unfolded protein response (UPR) genes. In the bud-
ding yeast Saccharomyces cerevisiae, ER transmem-
brane protein kinase ⁄ riboendonuclease Ire 1p is
activated by ER stress [1,2], and nonconventionally
splices mRNA of basic leucine zipper transcription
factor Hac 1p [3–5]. Hac 1p is translated from the
spliced mRNA and induces the UPR genes, having a
UPR cis-acting regulatory element [6–8]. On DNA
microarray analysis, 381 genes have been identified
as UPR ones induced by both tunicamycin (TM)
and dithiothreitol [9]. These comprise 6% of the
total yeast genes encoding 173 unknown proteins
and 208 proteins related to folding, glycosyla-
tion ⁄ modification, translocation, protein degradation,
Keywords
endoplasmic reticulum; fluid microarray;
gene expression; tunicamycin; unfolded
ment was demonstrated. Phosphorylation of initiation factor-2a, which was
inhibited by P58
IPK
, was decreased in tunicamycin-treated plantlets. How-
ever, regulatory changes in translation caused by ER stress were not detec-
ted in Arabidopsis. Plant cells appeared to have a strategy for overcoming
ER stress through enhancement of protein folding activity, degradation of
unfolded proteins, and regulation of apoptosis, but not regulation of trans-
lation.
Abbreviations
AARE, amino acid response element; ATF6, activating transcription factor 6; AZC,
L-azetidine-2-carboxylic acid; BI-1, Bax inhibitor-1; eIF2a,
initiation factor-2a; Endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; ERSE, ER stress
response element; MS, Murashige and Skoog medium; PDI, protein disulfide isomerase; PKR, double stranded RNA-activated protein
kinase; P-UPRE, plant-specific UPR element; RAMP4, ribosomal-associated membrane protein 4; TM, tunicamycin; UPR, unfolded protein
response; UPRE, UPR cis-acting regulatory element; XBP-1, X-box binding factor.
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3461
vesicle trafficking ⁄ transport, vacuolar protein sorting,
cell wall biogenesis, and lipid ⁄ inositol metabolism.
In comparison with those of yeast, the UPR genes
of mammalian cells are induced through a much more
complicated mechanism, which has been shown to be
triggered by at least three transcription factors, X-box
binding factor (XBP-1), activating transcription fac-
tor 6 (ATF6), and ATF4 [10]. The mammalian paralog
of yeast Ire 1p is activated by ER stress and splices
the invalid mRNA into mature mRNA encoding 371-
amino acid XBP-1 [11,12]. XBP-1 translated from the
spliced mRNA is translocated to the nucleus [13],
where it binds to its target sequence in the regulatory
in Arabidopsis thaliana and Oryza sativa [25,26]. Their
N-terminal luminal domains have each been shown to
function as a sensor for ER stress in yeast. However,
neither target mRNAs of transcription factors for
plant Ire1p nor target genes induced by this system
have been identified. On the other hand, the mRNAs
of BiP, calreticulin, calnexin and PDI have been shown
to be induced on treatment with TM and dithiothreitol
in Arabidopsis, Zea mays, Phaseolus vulgalis, Glycine
max and Nicotiana tabacum on northern analysis [27–
31]. The 21 UPR genes up-regulated by the stress
induced by both TM and dithiothreitol have been
identified among 8297 genes of the 27 000 protein-
coding genes of Arabidopsis with an Affimetrix Gene-
Chips [32].
In this paper, we present a list of the UPR genes of
Arabidopsis identified among all the protein-coding
genes. In order to increase the accuracy of the list, the
genes selected on fluid microarray analysis were reana-
lyzed by functional DNA microarray analysis. In addi-
tion to the genes related to protein folding and
degradation, genes related to protein translation and
apoptosis are also included in the list.
Results
Fluid microarray analysis of gene expression
on TM-treatment
To identify UPR genes among all the genes expressed
in Arabidopsis, we adopted the fluid microarray
method, by which target genes can be cloned from
selected fluid microarray beads. The fluid microarray
were amplified by PCR and then sequenced. In the
up-regulated fractions, 215 genes (Table S1) were
found as clusters of clones, which were identified on
more than two beads, and 412 as singlet clones, which
were identified on single beads (Table S2). For the
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3462 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
down-regulated fraction, 10% of the total beads were
analyzed to reveal 17 genes as clusters of clones
(Table 1) and 34 as singlet clones (Table S2).
Analysis with functional DNA microarrays
In order to increase the accuracy of the list of UPR
genes, we reanalyzed the genes selected on fluid micro-
array analysis with functional DNA microarrays. The
functional DNA microarrays were prepared by spot-
ting PCR fragments from the 215 up-regulated cluster
genes (Table S1) and the 17 down-regulated cluster
genes (Table 1) cloned on fluid microarray analysis.
Singlet genes were omitted from the functional DNA
microarray analysis, because the list of singlet genes
was predicted to contain missorted non-UPR genes
at a high frequency. Functional DNA microarray
analyses were performed with mRNA preparations
from plantlets treated with or without TM, dithio-
threitol or l-azetidine-2-carboxylic acid (AZC). AZC
is a proline analog that is incorporated in nascent
polypeptides instead of proline and prevents the fold-
ing of the polypeptides [33]. Induction of BiP mRNA
by dithiothreitol- or AZC-treatment (3 h or 17 h,
respectively) was confirmed to be 3.4 or 22-times
and vesicle trafficking (two genes). The induction of
HRD1-like, SEL-1L ⁄ HRD3-like, DER1-like, and
P58
IPK
mRNA was confirmed by real-time RT-PCR
analysis (Fig. 3). In addition, we found that an anti-
apoptosis protein, Bax inhibitor-1 (BI-1) [35,36], was
also included in the list of up-regulated UPR genes.
Induction of this paralog by ER stress in organisms
other than plants has not been reported. The induc-
tion of BI-1 mRNA by ER stress in Arabidopsis was
confirmed by real-time RT-PCR analysis (Fig. 3).
Furthermore, the induction (1.5-fold variation) of
Homo sapiens BI-1 by TM-treatment for 24 h was
confirmed in Hep G2 cells, a cell line derived from a
human hepatoma, by real-time RT-PCR (data not
shown).
A
B
Fig. 1. Competitive hybridization on fluid microarrays. (A) Control hybridization: 4 · 10
4
beads were hybridized with a 1 : 1 mixture of differ-
entially labeled probes from noninduced plantlets. (B) Competitive hybridization: 4 · 10
5
beads were hybridized with a 1 : 1 mixture of cDNA
probes prepared from induced (Cy5) and noninduced plantlets (fluorescein) as described under Experimental procedures. After hybridization,
beads that went to gates U1, U2 and D were collected and subjected to gene analysis as described under Experimental procedures.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3463
To identify the down-regulated UPR genes, we
tory elements such as ERSEII and XBP1 binding
sequences, was found in the 5¢ upstream regions of the
BiP and calnexin genes [45]. Furthermore, complement-
ary sequences to the mammalian ERSE and XBP1
binding sequences have been found in the 5¢ upstream
regions of several genes that are induced by TM- or
dithiothreitol-treatment [32,45]. Therefore, we searched
for P-UPRE, the XBP1 binding sequence, ERSE,
AARE, or complementary sequences in the 5¢ upstream
regions (up to 1000 nucleotides) of the UPR genes. Sin-
gle or plural putative cis-acting regulatory elements
were found in the 5¢ upstream regions of 28 of the 36
up-regulated genes (Fig. 2C and Table 3). No cis-acting
regulatory element sequence was found in the 5¢
upstream regions of the two down-regulated genes.
Increase in putative SEL-1L due to ER stress
in Arabidopsis
In yeast and mammalian cells, the HRD1 ⁄ HRD3
(SEL-1L) ubiquitination system coupled to protein
degradation by 26S proteasomes is known to be
induced to remove unfolded proteins under ER stress
[9,46]. Plant paralogs of these genes have not been
identified yet. In this study, the transcriptional induc-
tion of genes homologous to mammalian HRD1 and
SEL-1L [47–49] was observed (Fig. 3). Then, HRD1-
and SEL-1L-like cDNAs were cloned with mRNA of
Fig. 2. Overview of the fluid microarray and functional microarray
analyses. (A) Gene selection by fluid microarray analysis. Gates,
U1, U2 and D were set as shown in Fig. 1B. Singlet, a gene identi-
fied on a single bead. Cluster, a gene identified on more than two
Escherichia coli and purified. Unfortunately, autoubiq-
uitination activity was not detected for the recombin-
ant HRD1-like protein. On the other hand, the
putative amino acid sequence of Arabidopsis SEL-1L
(At SEL-1L) contained an N-terminal signal sequence
(Met1–Glu20), two N-glycosylation consensus seq-
uences, and a membrane-spanning region (Phe623–
Arg643) near the C-terminus (data not shown). The
amino acid sequence of a soybean paralog of SEL-1L,
which was deduced from the nucleotide sequence of
cDNA cloned from young leaves by RT-PCR, was clo-
sely similar to Arabidopsis ones (data not shown).
Anti-(At SEL-1L) serum was prepared with the recom-
binant luminal domain (Phe21–Val622) of At SEL-1L,
which was expressed in E. coli and isolated. The anti-
serum only immunoreacted with a 74 kDa protein of
control plantlets on western blotting analysis (Fig. 4A).
With TM-treatment, the 74 kDa protein gradually
decreased and a 70 kDa band began to appear at 4 h
after the treatment. During the next 24 h, the 70 kDa
band significantly increased. The size of the 74 kDa
band decreased to 70 kDa on endoglycosidase H
(Endo H) digestion. On the other hand, the 70 kDa
band was insensitive to Endo H (Fig. 4B). From these
results, the 70 kDa protein was thought to be a non-
glycosylated form of At SEL-1L. On cell fractionation,
At SEL-1L was assumed to be a membrane protein, as
judging from the existence of a putative membrane
spanning region (Fig. 4C). The 70 kDa band of plant-
lets treated with TM for 24 or 48 h was denser than
beads)
Functional DNA microarray (fold
variation)
U1 U2 D TM DTT AZC Control (SD)
At5g24770 Vegetative storage protein Vsp2 0 0 182 0.20 0.78 0.38 0.99 (0.04)
At5g24780 Vegetative storage protein Vsp1 0 0 12 0.19 0.79 0.12 0.98 (0.05)
At2g39330 Putative mylosinase-binding protein 0 0 15 0.36 1.10 n.d. 1.10 (0.05)
At5g50960 Nucleotide-binding protein 1 0 4 0.97 1.20 5.64 0.93 (0.08)
At3g04120 Glyceraldehyde-3-phosphate dehydrogenase C subunit 0 0 2 0.68 0.99 0.98 1.01 (0.03)
At5g64120 Peroxidase 0 0 2 n.d. n.d. 0.05 1.01 (0.03)
At4g34490 Adenylyl cyclase-associated protein CAP2 0 0 2 0.94 0.94 0.02 1.09 (0.14)
At4g37410 Cytochrome P450 0 0 2 0.28 1.03 0.84 0.94 (0.04)
At5g04140 Ferredoxin-dependent glutamate synthase 0 0 5 0.83 0.97 n.d. 3.89 (6.12)
At4g22470 Extensin-like protein 0 0 5 0.27 0.91 0.02 1.03 (0.03)
At5g47930 Ribosomal protein S27 0 0 3 1.15 0.95 0.69 1.09 (0.06)
At1g01060 Similar to DNA binding protein CCA1 0 0 2 0.24 0.82 0.01 0.89 (0.08)
At2g07671 Unknown 0 0 31 0.21 0.93 6.56 1.30 (0.15)
At4g32610 Unknown 0 0 2 0.92 0.96 0.74 1.10 (0.09)
At2g07707 Unknown 0 0 12 0.28 0.90 2.16 1.04 (0.07)
At3g02200 Unknown 0 0 4 0.99 1.00 0.32 0.93 (0.06)
At5g51190 Unknown 0 0 8 1.12 0.99 2.95 18.08 (0)
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3465
Table 2. Genes up-regulated by ER stress. Tunicamycin (TM), dithiothreitol (DTT) and L -azetidine-2-carboxylic acid (AZC) values are means
for six experiments. Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six
experiments. SD, standard deviation.
AGI gene Description
Fluid microbead
array (number of
beads) Functional DNA microarray (fold variation)
At5g58710 AtCYP20-1 (cyclophilin ROC7) 0 3 1.43 1.34 2.13 1.01 (0.08)
GLYCOSYLATION ⁄ MODIFICATION
At2g02810 UDP-glucose ⁄ UDP-galactose
transporter
a,b
2 3 3.53 2.08 21.95 0.94 (0.04)
At2g41490 UDP-GlcNac:dolichol phosphate
N-acetyl-glucosamine-1-phosphate
transferase
a
0 2 1.55 1.53 6.67 1.01 (0.09)
TRANSLOCATION
At5g50460 SEC61 gamma subunit 2 22 1.94 1.66 5.54 1.07 (0.13)
At1g29310 Similar to SEC61 alpha subunit 0 4 1.5 1.61 11.89 0.97 (0.10)
At2g34250 Similar to SEC61 alpha subunit 0 2 1.27 1.38 2.11 0.96 (0.07)
At1g27330 Similar to SERP1 ⁄ RAMP4 203 120 2.42 1.82 13.48 0.98 (0.04)
At1g27350 Similar to SERP1 ⁄ RAMP4
a,b
0 13 2.05 1.72 10.61 1.08 (0.19)
At3g51980 Similar to ER chaperone SIL 1 2 34 2.39 3.00 52.88 0.98 (0.12)
PROTEIN DEGRADATION
At1g65040 Similar to HRD1 7 11 3.36 2.33 6.48 0.99 (0.07)
At4g21810 Similar to DER1
a,b
0 7 1.67 1.59 4.23 1.09 (0.07)
At1g18260 Similar to SEL-1L ⁄ HRD3 0 3 1.54 1.54 9.16 0.96 (0.11)
TRANSLATION
At5g03160 P58
IPK
2 14 2.06 1.76 10.76 0.94 (0.11)
later phase of ER stress [53]. Deletion of P58
IPK
has
been reported to result in an increase in phosphory-
lated eIF2a. Hence P58
IPK
is thought to function as a
feedback regulator for translational regulation in the
later phase of ER stress. The phosphorylated Ser51 of
eIF2a in plantlets was examined during ER stress by
western blot analysis (Fig. 5A). The level of phosphor-
ylated eIF2a (Ser51) in the plantlets treated with TM
was lower than that in untreated plantlets. The phos-
phorylated eIF2a increased again on removal of TM
from the medium after 6 h of treatment. However, the
protein synthesis in plantlets, which was assayed as the
incorporation of [
35
S]-labeled Met and Cys into nas-
cent proteins, was not affected by TM-treatment
(Fig. 5B).
Discussion
In this study, we tried to make a list of the UPR genes
in Arabidopsis. In total, 215 up-regulated and 17
down-regulated cluster genes were cloned from mRNA
of Arabidopsis plantlets treated with TM on fluid
microarray analysis. A functional DNA array was pre-
pared by using the cloned gene fragments, and then
used for analysis. Among the 215 up-regulated cluster
genes, only 63 showed statistically positive signals on
Arabidopsis probe sets [32,54]. Two down-regulated
genes, Vsp1 and Vsp2, which satisfied all the criteria,
are known to be for temporary nitrogen-storage pro-
teins [38], and are subject to regulation by sugars,
light, phosphates, nitrogen, wounding, auxins, jasmo-
nates and oxidative-stress [55]. The down-regulation of
Vsp1 and Vsp2 may result in an increase in the intra-
cellular amino acid pool, which may play an important
role in the recovery from ER stress. In mammalian
cells, ER stress affects cellular amino acid metabolism
via the PERK ⁄ ATF4-mediated signaling pathway,
which induces some amino acid synthesis- and trans-
port-related genes [23]. No putative UPR cis-acting
regulatory element was found in the 5¢ upstream
regions of Arabidopsis Vsp1 and Vsp2. Therefore, it is
not clear whether these genes are directly regulated by
the UPR system or down-regulated by a metabolic dis-
order caused by ER stress.
Thirteen genes, which encode six protein families
responsible for protein folding, are included in the
UPR gene list. Among them, BiP (three genes), calnex-
in (two genes), calreticulin (two genes), and AtHSP 90-
7 (one gene) have been shown to be induced by ER
stress on northern blotting [25,54]. Four genes enco-
ding PDI families are also included in the list. PDI
and its family members are characterized by the pres-
Fig. 3. Confirmation of transcriptional induction of six genes by
real-time RT-PCR analysis. The amounts of actin, BiP, HRD1, SEL-
1L, DER1, p58
IPK
At2g32920 Similar to PDI –
At1g04980 Similar to PDI ERSE-like CGTGTgacaatatcATTGG(128–110)
Xbp1 binding-like TGACGTGT(131–124)
At5g58710 AtCYP20-1 (cyclophilin ROC7) Xbp1 binding-like TGACGTGG(83–76)
ERSE-like CCAATtacaattgtACACG(134–116)
At2g02810 Similar to UDP-glucose ⁄ UDP-galactose transporter –
At2g41490 UDP-GlcNac:dolichol phosphate N-acetylglucosamine-
1-phosphate transferase ERSE-like CGTGGcaaatccttATTGG(128–110)
–
At5g50460 SEC61 gamma subunit Xbp1 binding-like TGACGTGT(171–164)
Xbp1 binding-like TGACGTGT(322–315)
At1g29310 Similar to SEC61 alpha subunit ERSE-like CGTGTatccgtattATTGG(439–420)
At2g34250 Similar to SEC61 alpha subunit –
At1g27330 Similar to SERP1 ⁄ RAMP4 ERSE-like CCAATcactgaccgCCACG(223–205)
At1g27350 Similar to SERP1 ⁄ RAMP4 ERSE-like CCAATtatagacggCCACG(269–251)
At3g51980 Similar to ER chaperone SIL 1 Xbp1 binding-like TGACGTGT(149–142)
ERSE-like CGTGTaataatataATTGG(146–128)
At1g65040 Similar to HRD1 ERSE-like CGTGTcgttatatcATTGG(338–320)
At4g21810 Similar to DER1 –
At1g18260 Similar to SEL-1L ⁄ HRD3 ERSE-like CGTGGccggttactATTGG(176–158)
At5g03160 P58
IPK
ERSE-like CGTGGgtcataacgATTGG(244–226)
ERSE-like CGTGTttaattatcATTGG(304–286)
At3g07680 Similar to Emp24p ERSE-like CCAATgatataacgCCACG(437–419)
Xbp1 binding-like TGACGTGG(477–470)
Xbp1 binding-like ACACGTCA(609–602)
At4g21730 Similar to NEM-sensitive fusion protein –
At5g47120 BI-1 ERSE-like CGTGGatgattcttATTGG(298–280)
At2g25110 Similar to stroma cell-derived factor –
565258), At2g32920 (NP 180851), At2g47470
(NP182269), At3g54960 (NP 191056), At3g16110 (NP
188232), and At5g60640 (NP 568926), were found.
Identification and characterization of these PDI family
proteins were not carried out. However, they were sup-
posed to play important roles in protein folding, as
four PDI-related genes among the above 13 genes were
confirmed to be induced by ER stress. A gene enco-
ding cyclophilin family protein ATCYP20-1 was identi-
fied as a UPR gene. Twenty-nine genes encoding
cyclophilin family members were found in the Arabi-
dopsis genome [62]. Among them, five gene products
are assumed to be targeted to the ER lumen with
N-terminal signal peptides. Among them, ATCYP20-1
has the amino acid sequence RFWH, which is an
essential sequence for peptidyl prolyl cis, trans iso-
merase activity. Hence, it is suggested that ATCYP20-1
may participate in the folding of proteins in the ER.
The genes of six translocation-related proteins were
found to be induced. In mammalian cells and yeast,
translocon subunit proteins are thought to be induced
to enhance retrotranslocation of unfolded proteins
from the ER to the cytosol [63]. The retrotranslocated
proteins are degraded by 26S proteasomes. Recently,
in tobacco, a GFP-fusion protein containing the P
region of calreticulin, which is a model of a misfolded
A
B
C
Fig. 4. Increase in At SEL-1L in the membranes of Arabidopsis
35
S]Cys for
20 min at 25 °C. Then, the proteins were extracted and subjected
to SDS ⁄ PAGE. Labeled proteins were determined by fluorography
as described under Experimental procedures.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3469
protein in the ER, was shown to be retrotranslocated
to the cytosol, ubiquitinated, and then degraded [64].
The induction of translocon subunits by ER stress in
Arabidopsis suggests that an ERAD system similar to
those of yeast or mammalian cells may remove mis-
folded proteins produced in the ER of plant cells. This
is supported by our finding that the genes encoding
putative plant DER1, HRD1 and SEL-1L ⁄ HRD3 were
also induced by ER stress. DER1 is a hydrophobic
protein that is localized to the ER. In yeast, deletion
of DER1 prevents degradation of unfolded proteins,
suggesting that the function of DER1 may be specific-
ally required for ERAD [65]. Yeast HRD1 is an ER-
membrane-anchored ubiquitin ligase, which is required
for the degradation and ubiquitination of several
ERAD substrates, and is associated with relevant
ubiquitin-conjugating enzymes [46]. At HRD1, which
has the same nucleotide sequence as that registered in
‘The Arabidopsis Information Resource’, was cloned
by RT-PCR with mRNA from Arabidopsis. Six trans-
membrane regions and a RING-H2 domain of Arabi-
dopsis HRD1 (At HRD1) showed high sequence
homology with those of yeast and human HRD1s.
ER stress, even though the phosphorylation of eIF2a
(Ser51) was partially inhibited by ER stress. The phos-
phorylation of eIF2a (Ser51) increases the translational
efficiency of yeast GCN4 mRNA and mammalian
ATF4 mRNA, which have four and two upstream
open reading frames in the 5¢ noncoding portion,
respectively [67,68]. Induction of Arabidopsis P58
IPK
followed by a decrease in the phosphorylation of
eIF2a (Ser51) may increase the translational efficiency
for unidentified gene(s).
It is unclear whether apoptosis may function as a
UPR in plants, although inhibition of ER-type IIA
Ca
2+
-pumps has been reported to induce ER stress
and apoptosis in soybean cells [69]. In this study, we
identified apoptosis-related gene BI-1 as a UPR gene.
BI-1 is an evolutionarily conserved integral membrane
protein localized in the ER [35,36]. In mammalian
cells, BI-1 affords protection from apoptosis induced
by ER stress by inhibiting BAX activation and translo-
cation to mitochondria, by preserving the mitochond-
rial membrane potential, and by suppressing caspase
activation [70]. BAX and Bcl2, and their relatives were
not found in plants. However, in rice and barley, BI-1
has been shown to suppress fungal elicitor-induced
apoptosis [71,72].
Experimental procedures
Plant materials and treatments
GTTGGGTTTATCTCTTTGGTT-3¢,5¢-TGATGGAAGA
AGCAGTGGATGA-3¢ and 5¢-CGTAGAAGAGTGGTA
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3470 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
CAAGCAGATG-3¢, were used for detection of the
mRNAs of actin, BiP, P58
IPK
, BI-1, At HRD1, At SEL-1L
or Arabidopsis DER1 (At DER1), respectively.
Reverse primers, 5¢-ATCGACGGGCCTGACTCAT-3¢,
5¢-CAACATTGAGCCCAGCAATAAC-3¢,5¢-CAGCTAT
TTAAGCCGTCTTTTCCA-3¢,5¢-GATAGATGCAGAGC
CACCAAAGA-3¢,5¢-CGGACATGAGAGAGCAAAGT
CA-3¢,5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢-
ACCCGACGGTGGTGACTACA-3¢, were used for detec-
tion of the mRNAs of actin, BiP, P58
IPK
, BI-1, At HRD1,
At SEL-1L and At DER1, respectively.
TaqMan probes (Applied Biosystems), 5¢-VIC-CAG
TACCTTCCAGCAGATGTGGATCGC-TAMRA-3¢,5¢-
FAM-CCAGCTTACTTACTTCAATGATGCTCAAAGG
C-TAMRA-3¢,5¢-FAM-CTATGCAAGGTCTCAGTCAG
GCTCGGC-TAMRA-3¢,5¢-FAM-ATGCTAATGTGGC
TCCAGTTTGCCTCT-TAMRA-3¢,5¢-FAM-TCCACTCT
CTTTTGAGCCATCCAATGC-TAMRA-3¢,5¢-FAM-AA
CGACTTGCTTTTGCTCTTCTCTCGC-TAMRA-3¢ and
5¢-FAM-ATTATAACCCGGTCGTATCTCACGGC-TAM
RA-3¢, were used for detection of the mRNAs of actin,
BiP, P58
microbeads was labeled by ligation with an adaptor carry-
ing 3¢-6-carboxyl-fluorescein and removed by treatment with
150 mm NaOH. The microbeads that carried antisense
strands were removed from the microbeads that carried
sense strands using the cell sorter.
Fluid microarray analysis
For analysis of differentially expressed mRNA in Arabidopsis
treated with or without TM, fluid microarray analysis was
performed. Probes for competitive hybridization on the fluid
microrrays were prepared from the same mRNA sources as
those used for the preparation of the cDNA tagged library.
In brief, mRNA was converted to cDNA using a flanking
oligo dT primer carrying a T7 promoter sequence for first
strand synthesis. The probes were synthesized from cDNA
derived from control or TM-treated plantlets by T7 RNA
polymerase reaction in the presence of fluorescein-UTP or
Cy5-UTP. A mixture of probes was then hybridized with a
mixture of 4 · 10
5
fluid microarray beads prepared from the
control or TM-treated plantlets at 50 °C overnight. Labeled
fluid microarray beads were washed in 1· NaCl ⁄ Cit (0.15 m
NaCl, 0.015 m sodium citrate, pH 7) ⁄ 0.1% (w ⁄ v) SDS and
0.1· NaCl ⁄ Cit ⁄ 0.1% (w ⁄ v) SDS at 65 °C for 15 min [75].
The distribution of microbeads in Fig. 1A allowed us to set
gates for collecting microbeads that were more heavily labe-
led with Cy5 or fluorscein (Fig. 1B). The polygons in Fig. 1B
represent the gates at which microbeads carrying up-regula-
ted or down-regulated clones (D) were collected. The up-
regulated clone fraction was further separated at two gates
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3471
55 °C for 5 min. The functional DNA microarray was rin-
sed once with 0.05 · NaCl ⁄ Cit. The fluorescence was
scanned with a GeneChipÒ Scanner 428 (Affymetrix, Inc.,
Santa Clara, CA). The same experiments were carried out
using three functional DNA microarrays. The data were
analysed using BioDiscovery imagene Ver. 4.2 (BioDiscov-
ery, El Segundo, CA). The mean Cy5 : Cy3 ratio values
were calculated as the Cy5 value divided by both the
correction value and the raw Cy3 value. Calculation of the
correction value was carried out as described below:
(a) Spots were selected according to the following criteria:
[signal mean] ) [background mean] more than 60 000, and
[signal mean] more than [background mean] + 2 · [back-
ground standard deviation (SD)]; (b) Log (Cy5 : Cy3) of the
spots selected in (a) was calculated; (c) Mean value I SD of
(b) was calculated; (d) Spots were selected according to the
following criteria: Log (Cy5 : Cy3) ranged within the mean
values I SD obtained in (c); (e) Mean Log (Cy5 : Cy3) of
the spots selected in (d) was calculated; (f) Mean Log
(Cy5 : Cy3) in (e) was converted to a natural value, which
corresponds to the correction value.
Control experiments (self ⁄ self hybridization) to obtain a
spot-specific background Cy5 : Cy3 ratio for judgment of
significant differences in the Cy5 : Cy3 ratio were carried
out. Target DNA fragments were synthesized using
Cy3-dUTP or Cy5-dUTP from the mRNA of control plant-
lets, and then hybridized competitively to a functional
DNA microarray under the same conditions as for the
comparative experiments. Mean control Cy5 : Cy3 ratios
ing to the sequence containing a XhoI restriction site in
At SEL-1L, 5¢-AAATCTTCATCCTCCTCGCCTCGAG-3¢.
The other set comprised a forward primer corresponding to
the sequence containing a XhoI restriction site in At SEL-
1L, 5¢-AAAGGTGCTCTAAGGAAATCTCGAG-3¢, and a
reversed primer as the DNA sequence encoding the C-ter-
minus of the luminal domain of At SEL-1L containing a
XhoI restriction site, GTGGTGCTCGAGCACCACATT
CTCTATCCAAGTCTC-3¢. The former or latter PCR frag-
ments produced were digested with NdeI and XhoI, or
XhoI, respectively, and then cloned into pET-30Xa ⁄ LIC
digested with NdeI and XhoI. Expression vector pET-30 ⁄
At SEL-1L allows the fusion of the histidine tag
LEHHHHHH to the C-terminus of a recombinant protein.
Expression and purification of the recombinant
luminal domain of At SEL-1L BL21(DE3) cells
were transformed with pET-30/At SEL-1L
The expression of the putative luminal domain of At
SEL-1L was induced by the addition of 0.4 mm isopropyl
thio-b-d-galactoside for 4 h. The recombinant protein was
produced as inclusion bodies in E. coli. The cells from 2 L
culture broth were collected by centrifugation, disrupted
by sonication in 40 mL of 20 mm Tris ⁄ HCl buffer,
pH 7.9, containing 5 mm imidazole, 0.5 m NaCl and 1 mm
CaCl
2
(binding buffer), and then centrifuged at 10 000 g
for 30 min at 4 °C. The pellet was suspended in the bind-
ing buffer containing 6 m urea and 5 m m 2-mercaptoetha-
nol (urea-binding buffer) by sonication, and dissolved by
100 000 g for 1 h at 4 °C. The pellet was dissolved in
16 lL 0.1 m phosphate buffer, pH 5.5, containing 0.2%
(w ⁄ v) SDS and 0.5% (v ⁄ v) 2-mercaptoethanol by boiling
for 5 min. The resulting solution was diluted with four
volumes of 0.1 m phosphate buffer and then digested with
15 mU Endo H (Sigma, Inc.) at 37 °C overnight. After
digestion, proteins were treated with the SDS ⁄ PAGE buf-
fer. For cell fraction analysis, the supernatant and pellet
fraction obtained on centrifugation at 100 000 g were trea-
ted with the SDS ⁄ PAGE buffer. Twenty-five micrograms
of protein was subjected to SDS ⁄ PAGE and then blotted
onto a poly(vinylidene difluoride) membrane. The At
SEL-1L protein was then immunostained with 1 : 1000-
diluted anti-At SEL-1L serum and horseradish peroxidase-
conjugated rabbit Ig antiserum (Promega, Madison, WI)
as secondary antibodies, using Western Lightning Chemi-
luminescence Reagent (PerkinElmer Life Sciences, Boston,
MA).
Pulse labeling of proteins
For pulse labeling of proteins, plant tissues cut from the
roots were treated with or without TM for the indicated
times, and then incubated in 1 mL of MS containing
50 lCi (1850 kBq) each of [
35
S]Met and [
35
S]Cys (NEN Life
Science Products, Inc., Boston, MA) for 20 min at 25 °C.
The labeled plant tissues were rinsed with MS, frozen with
liquid nitrogen, and then ground with an electrical homo-
References
1 Cox JS, Shamu CE & Walter P (1993) Transcriptional
induction of genes encoding endoplasmic reticulum resi-
dent-proteins requires a transmembrane protein kinase.
Cell 73, 1197–1206.
2 Mori K, Ma W, Gething M-J & Sambrook JF (1993) A
transmembrane protein with cdc2+ ⁄ CDC28-related kin-
ase activity is required for signaling from the ER to the
nucleus. Cell 74, 743–756.
3 Cox JS & Walter P (1996) A novel mechanism for regu-
lating the activity of a transcription factor that controls
the unfolded protein response. Cell 87, 391–404.
4 Mori K, Kawahara T, Yoshida H, Yanagi H & Yura T
(1996) Signalling from the endoplasmic reticulum to the
nucleus: transcription factor with a basic-leucine zipper
motif is required for the unfolded protein-response
pathway. Genes Cells 1, 803–817.
5 Nikawa J, Akiyoshi M, Hirata S & Fukuda T (1996)
Saccharomyces cerevisiae IRE2 ⁄ HAC1 is involved in
IRE1-mediated KAR2 expression. Nucleic Acids Res 24,
4222–4226.
6 Kohno K, Normington K, Sambrook J, Gething M-J &
Mori K (1993) The promoter region of the yeast KAR2
(BiP) gene contains a regulatory domain that responds
to the presence of unfolded proteins in the endoplasmic
reticulum. Mol Cell Biol 13, 877–890.
7 Mori K, Ogawa N, Kawahara T, Yanagi H & Yura T
(1998) Palindrome with a spacer of one nucleotide is
characteristic of the cis-acting unfolded protein response
element in Saccharomyces cerevisiae. J Biol Chem 273,
chaperone genes in the unfolded protein response. Mol
Cell Biol 23, 7448–7459.
15 Haze K, Yoshida H, Yanagi H, Yura T & Mori K
(1999) Mammalian transcription factor ATF6 is synthe-
sized as a transmembrane protein and activated by pro-
teolysis in response to endoplasmic reticulum stress.
Mol Biol Cell 10, 3787–3799.
16 Okada T, Haze K, Nadanaka S, Yoshida H, Seidah NG,
Hirano Y, Sato R, Negishi M & Mori K (2003) A serine
protease inhibitor prevents endoplasmic reticulum stress-
induced cleavage but not transport of the membrane-
bound transcription factor ATF6. J Biol Chem 278,
31024–31032.
17 Ye J, Rawson RB, Komuro R, Chen X, Dave
´
UP, Prywes
R, Brown MS & Goldstein JL (2000) ER stress induces
cleavage of membrane-bound ATF6 by the same pro-
teases that process SREBPs. Mol Cell 6, 1355–1364.
18 Haze K, Okada T, Yoshida H, Yanagi H, Yura T,
Negishi M & Mori K (2001) Identification of the G13
(cAMP-response-element-binding protein-related pro-
tein) gene product related to activating transcription
factor 6 as a transcriptional activator of the mammalian
unfolded protein response. Biochem J 355, 19–28.
19 Yoshida H, Okada T, Haze K, Yanagi H, Yura T,
Negishi M & Mori K (2000) ATF6 activated by proteo-
lysis binds in the presence of NF-Y (CBF) directly to
the cis-acting element responsible for the mammalian
unfolded protein response. Mol Cell Biol 20, 6755–6767.
located transmembrane protein kinases. Plant Physiol
127, 949–962.
26 Okushima Y, Koizumi N, Yamaguchi Y, Kimata Y,
Kohno K & Sano H (2002) Isolation and character-
ization of a putative transducer of endoplasmic reticu-
lum stress in Oryza sativa . Plant Cell Physiol 43, 532–
539.
27 D’Amico L, Valsasina B, Daminati MG, Fabbrini MS,
Nitti G, Bollini R, Ceriotti A & Vitale A (1992) Bean
homologs of the mammalian glucose-regulated proteins:
induction by tunicamycin and interaction with newly
synthesized seed storage proteins in the endoplasmic
reticulum. Plant J 2, 443–455.
28 Fontes EBP, Shank BB, Wrobel RL, Moose SPO,
Brian GR, Wurtzel ET & Boston RS (1991) Characteri-
zation of an immunoglobulin binding protein homolog
in the maize floury-2 endosperm mutant. Plant Cell 3,
483–496.
29 Koizumi N, Ujino T, Sano H & Chrispeels MJ (1999)
Overexpression of a gene that encodes the first enzyme
in the biosynthesis of asparagine-linked glycans makes
plants resistant to tunicamycin and obviates the tunica-
mycin-induced unfolded protein response. Plant Physiol
121, 353–361.
30 Oliver SC, Venis MA, Freedman RB & Napier RM
(1995) Regulation of synthesis and turnover of maize
auxin-binding protein, and observations on its passage
to the plasma membrane: comparisons to maize
immunoglobulin-binding protein cognate. Planta 197,
465–474.
37 Utsugi S, Sakamoto W, Murata M & Motoyoshi F
(1998) Arabidopsis thaliana vegetative storage protein
(VSP) genes: gene organization and tissue-specific
expression. Plant Mol Biol 38, 565–576.
38 Utsugi S, Sakamoto W, Ogura Y, Murata M &
Motoyoshi F (1996) Isolation and characterization of
cDNA clones corresponding to the genes expressed pre-
ferentially in floral organs of Arabidopsis thaliana. Plant
Mol Biol 32, 759–765.
39 Lee K, Tirasophon W, Shen X, Michalak M, Prywes R,
Okada T, Yoshida H, Mori K & Kaufman RJ (2002)
IRE1-mediated unconventional mRNA splicing and
S2P-mediated ATF6 cleavage merge to regulate XBP1
in signaling the unfolded protein response. Genes Dev
16, 452–466.
40 Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman
RJ & Prywes R (2000) Activation of ATF6 and an
ATF6 DNA binding site by the endoplasmic reticulum
stress response. J Biol Chem 275, 27013–27020.
41 Yoshida H, Haze K, Yanagi H, Yura T & Mori K
(1998) Identification of the cis-acting endoplasmic reti-
culum stress response element responsible for transcrip-
tional induction of mammalian glucose-regulated
proteins. Involvement of basic leucine zipper transcrip-
tion factors. J Biol Chem 273, 33741–33749.
42 Kokame K, Kato H & Miyata T (2001) Identification
of ERSE-II, a new cis-acting element responsible for the
ATF6-dependent mammalian unfolded protein response.
J Biol Chem 276, 9199–9205.
43 Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S &
Biochem Biophys Res Commun 303, 91–97.
50 Lee TG, Tang N, Thompson S, Miller J & Katze
MG (1994) The 58,000-dalton cellular inhibitor of the
interferon-induced double-stranded RNA-activated
protein kinase (PKR) is a member of the tetratrico-
peptide repeat family of proteins. Mol Cell Biol 14,
2331–2342.
51 Yan W, Frank CL, Korth MJ, Sopher BL, Novoa I,
Ron D & Katze MG (2002) Control of PERK eIF2a
kinase activity by the endoplasmic reticulum stress-
induced molecular chaperone P58
IPK
. Proc Natl Acad
Sci USA 99, 15920–15925.
52 Melville MW, Hansen WJ, Freeman BC, Welch WJ &
Katze MG (1997) The molecular chaperone hsp40 regu-
lates the activity of P58
IPK
, the cellular inhibitor of
PKR. Proc Natl Acad Sci USA 94, 97–102.
53 van Huizen R, Martindale JL, Gorospe M & Holbrook
NJ (2003) P58
IPK
, a novel endoplasmic reticulum stress-
inducible protein and potential negative regulator of
eIF2a signaling. J Biol Chem 278, 15558–15564.
54 Noh S-J, Kwon CS, Oh D-H, Moon JS & Chung W-I
(2003) Expression of an evolutionarily distinct novel
BiP gene during the unfolded protein response in Arabi-
dopsis thaliana. Gene 311, 81–91.
calreticulin with ERp57. J Biol Chem 273, 6009–6012.
62 Romano PG, Horton P & Gray JE (2004) The Arabi-
dopsis cyclophilin gene family. Plant Physiol 134, 1268–
1282.
63 Pilon M, Schekman R & Ro
¨
misch K (1997) Sec61p
mediates export of a misfolded secretory protein from
the endoplasmic reticulum to the cytosol for degrada-
tion. EMBO J 16, 4540–4548.
64 Brandizzi F, Hanton S, DaSilva LL, Boevink P, Evans
D, Oparka K, Denecke J & Hawes C (2003) ER quality
control can lead to retrograde transport from the ER
lumen to the cytosol and the nucleoplasm in plants.
Plant J 34, 269–281.
65 Knop M, Finger A, Braun T, Hellmuth K & Wolf DH
(1996) Der1, a novel protein specifically required for
endoplasmic reticulum degradation in yeast. EMBO J
15, 753–763.
66 Gardner RG, Swarbrick GM, Bays NW, Cronin SR,
Wilhovsky S, Seelig L, Kim C & Hampton RY (2000)
Endoplasmic reticulum degradation requires lumen to
cytosol signaling: Transmembrane control of Hrd1p by
Hrd3p. J Cell Biol 151, 69–82.
67 Hinnebusch AG (2000) Mechanism and regulation of
initiator methionyl-tRNA binding to ribosomes. In
Translational Control of Gene Expression (Sonenberg N
Hershey JWB & Mathews M, eds), pp. 185–244. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor,
NY.
DNA on microbeads: physical separation of differen-
tially expressed cDNAs. Proc Natl Acad Sci USA 97,
1665–1670.
75 Sambrook J & Russell D (2001) Molecular Cloning: a
Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
76 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
Supplementary material
The following supplementary material for this article is
available online:
Table S1. Up-regulated genes selected for functional
DNA microarray analysis.
Table S2. List of singlet genes identified on fluid
microarray analysis.
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3476 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS