Tissue expression and biochemical characterization
of human 2-amino 3-carboxymuconate 6-semialdehyde
decarboxylase, a key enzyme in tryptophan catabolism
Lisa Pucci*, Silvia Perozzi*, Flavio Cimadamore, Giuseppe Orsomando and Nadia Raffaelli
Istituto di Biotecnologie Biochimiche, Universita
`
Politecnica delle Marche, Ancona, Italy
In mammals, tryptophan exceeding basal requirement
for protein and serotonin synthesis, is oxidized via
indole-ring cleavage through the kynurenine pathway,
consisting of several enzymatic reactions leading to
2-amino 3-carboxymuconate 6-semialdehyde (ACMS)
(Fig. 1) [1,2]. ACMS can be decarboxylated to
2-aminomuconate 6-semialdehyde (AMS) by the
enzyme ACMS decarboxylase (ACMSD, EC 4.1.1.45),
or it can undergo spontaneous pyridine ring closure to
form quinolinate, an essential precursor for de novo
NAD synthesis. AMS can be routed to the citric
acid cycle via the glutarate pathway, or converted
nonenzymatically to picolinate. By catalyzing ACMS
decarboxylation, ACMSD thus diverts ACMS from
NAD synthesis, channeling tryptophan towards
complete oxidation or conversion to picolinate.
By determining picolinate and quinolinate forma-
tion, ACMSD directly participates in the cellular pro-
cesses regulated by these molecules. Quinolinate is a
neurotoxic tryptophan metabolite, whose action has
been ascribed to N-methyl-D-aspartate receptors
activation and to its ability to generate free radicals
Keywords
ACMSD; NAD biosynthesis; picolinate;
pH optimum ranging from 6.5 to 8.0, a K
m
of 6.5 lm, and a k
cat
of 1.0 s
)1
.
ACMSD I is inhibited by quinolinic acid, picolinic acid and kynurenic
acid, and it is activated slightly by Fe
2+
and Co
2+
. Site-directed mutagen-
esis experiments confirmed the catalytic role of residues, conserved in all
ACMSDs so far characterized, which in the bacterial enzyme participate
directly in the metallocofactor binding. Even so, the properties of the
human enzyme differ significantly from those reported for the bacterial
counterpart, suggesting that the metallocofactor is buried deep within the
protein and not as accessible as it is in bacterial ACMSD.
Abbreviations
ACMS, 2-amino 3-carboxymuconate 6-semialdehyde; ACMSD, ACMS decarboxylase; AMS, 2-aminomuconate 6-semialdehyde.
FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 827
[3,4]. This neurotoxicity might play an important role
in the pathogenesis of major neurodegenerative and
convulsive disorders. In particular, many of the
distinct neuropathological features of Huntington’s
disease are duplicated in experimental animals by
intrastriatal quinolinate injection [5,6]. In addition, a
significant elevation of quinolinate levels has been
observed in low-grade Huntington’s disease brains,
Mammalian ACMSD has been purified and charac-
terized from cat, hog and rat [22–24], where it is
present only in kidney, brain and liver. Several studies
have demonstrated that in rats, nutritional factors and
hormones affect both gene expression and enzymatic
activity. In particular, the enzyme is down-regulated
by dietary polyunsaturated fatty acids, phthalate esters
and peroxisome proliferators, like clofibrate, whereas it
is up-regulated in rats fed a high protein diet [25–28].
mRNA expression and enzymatic activity are elevated
in the liver of streptozotocin-induced diabetic rats, and
insulin injection suppresses such elevation [29]. These
studies clearly demonstrated that changes in ACMSD
activity are readily reflected by serum and tissue quino-
linate levels and in the rate of tryptophan-to-NAD
conversion. Rat liver ACMSD gene expression is regu-
lated by the two transcriptional factors: hepatocyte
nuclear factor 4a (HNF4a) and peroxisome prolifera-
tor-activated receptor a (PPRa); the former activates
ACMSD expression directly by site-specific binding
to the promoter, and the latter represses ACMSD
expression indirectly through suppression of HNF4a
expression [30].
The presence of ACMSD has been recently demon-
strated in bacteria species that fully catabolize trypto-
phan or 2-nitrobenzoic acid [31,32]. The biochemical
and structural characterization of Pseudomonas fluores-
cens ACMSD revealed that the enzyme is metal-
dependent and catalyzes a novel type of nonoxidative
decarboxylation [21,33–35].
ucts were obtained, the longer (887 bp) corresponding
to part of the ACMSD I cDNA, the shorter (837 bp)
representing ACMSD II open reading frame (not
shown). The two transcripts are produced by alternat-
ive splicing of exons 2 and 5 of the ACMSD gene
(Fig. 2A); the presence of exon 2 in ACMSD II causes
a shift in the open reading frame, resulting in the
occurrence of the first available start codon in exon 4.
This, together with the absence of exon 5, gives rise to
a ACMSD II protein, which differs from ACMSD I at
the N-terminus (Fig. 2B).
Expression of ACMSD variants in Escherichia coli
and Pichia pastoris
ACMSD I and II cDNAs were subcloned into pET15b
and pET32b E. coli expression vectors, providing the
recombinant proteins with a N-terminal His6-tag, and
a thioredoxin-tag, respectively. In both cases, proteins
were expressed as inclusion bodies (not shown). Any
effort to obtain soluble recombinant proteins, inclu-
ding lower growth temperatures (18 °C) and isopropyl
b-D-1-thiogalactopyranoside concentrations (down to
0.1 mm), as well as inclusion of various metal ions in
the growth medium during induction, were unsuccess-
ful. Expression in the methylotrophic yeast P. pastoris
was performed both via secretion and intracellularly,
as described in Experimental procedures. Both
isoforms were secreted by yeast cells transformed with
the pPIC9 recombinant plasmids (Fig. 3); however,
when ACMSD activity was assayed in the culture
media, the enzymatic activity was only detected in
CLUSTALW program. Fully conserved and similar residues are indicated by asterisks and colon, respectively.
Table 1. Oligonucleotide primer sequences. fw, forward; rev,
reverse.
Sequence
ACMSD cloning: primer
1fw CGCTCGAGATGAAAATTGACATCCATA
GTCAT
11rev AAAGCTGAGCTCCATTCAAATTGTTTT
CTCTCAAG
4fw TTCTCGAGATGGGAAAGTCTTCAGAGT
GGT
ACMSD real-time PCR: primer and probe
1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT
2fw ATCCCAGGAAACACCAGTAGA
10rev ATTGTTTTCTCTCAAGACCCAA
TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG
18Sfw CGCCGCTAGAGGTGAAATTC
18Srev TCTTGGCAAATGCTTTCGCT
TaqMan probe 18S TGGACCGGCGCAAGACGGAC
AB
Fig. 3. ACMSD I and ACMSD II extracellular expression. Tricine
SDS ⁄ PAGE of the culture filtrates of the best expressing clones
obtained by transformation of P. pastoris GS115 cells with pPIC9-
ACMSD I (A) and pPIC9-ACMSD II (B). Culture filtrates were ana-
lyzed after 104 h (lane a) and 128 h (lane b) methanol induction.
Arrows indicate the recombinant isoforms. Lane M, molecular
mass standards.
Human ACMSD L. Pucci et al.
830 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS
Quantitation of ACMSD variants in liver, kidney
geneity from P. pastoris cells transformed with the
pHIL-D2-ACMSD I plasmid, by the purification proce-
dure described in Experimental procedures and sum-
marized in Table 2. The final preparation was stable for
several weeks when stored at 4 °C, whereas the purified
protein was sensitive to freezing at both )20 °C and
)80 °C. SDS ⁄ PAGE of the pure protein revealed a
molecular mass of about 40 kDa, as expected for the
recombinant enzyme (Fig. 5). Gel filtration experiments
showed a native molecular mass of about 50 kDa, indi-
cating that the enzyme might exist as a monomer in
solution (not shown). ACMSD I had an optimum pH
ranging from 6.5 to 8.0 (Fig. 6). The activity was signifi-
cantly affected by the concentrations of the buffers used
at pH values below 6.5, being markedly lower in the
presence of 50 mm buffers, rather than 5 mm at the
same pH values (Fig. 6). As shown in Table 3, the pure
enzyme was fully active in the absence of metal ions,
being slightly activated by Co
2+
and Fe
2+
, whereas
Zn
2+
,Cd
2+
Cr
3+
and Fe
a
(mg)
Total activity
b
(units)
Specific activity
(unitsÆmg
)1
)
Yield
(%)
Purification
(-fold)
Crude extract 305 1.9 0.006 100 –
Streptomycin sulfate 102 2.0 0.019 100 3.26
Hydroxyhapatite 23.4 1.2 0.051 63 8.5
MonoQ 0.36 0.5 1.39 31 231
a
Starting from 400 mL yeast culture.
b
The enzymatic activity was assayed spectrophotometrically, as reported in the Experimental proce-
dures.
L. Pucci et al. Human ACMSD
FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 831
mide, nicotinic acid, nicotinamide mononucleotide,
nicotinate mononucleotide, tryptophan (present at
1mm concentration in the reaction mixture), and
l-kynurenine and 3-hydroxykynurenine (present at
0.1 mm concentration) were without effect. On the
other hand, a significant inhibition was exerted by
Relative activity
(%)
None – 100
Mg
2+
1.0 100
Mn
2+
1.0 100
Zn
2+
0.1 6
Ni
2+
1.0 100
Ca
2+
1.0 100
Fe
3+
0.1 15
Fe
2+
0.1 124
1.0 90
Co
2+
0.1 120
1.0 130
Cr
dues are critical for catalysis. The human enzyme is
active in the absence of added metal-ions in the reac-
tion mixture, suggesting that it might be able to take
up the metal from the expressing host during protein
synthesis. This property was previously demonstrated
for bacterial ACMSD, however, while the bacterial
enzyme can be obtained in the inactive, metal-free
form upon incubation with 5 mm EDTA for 12 h at
4 °C [21,33], human ACMSD retained full activity in
the same conditions. Incubations at EDTA concentra-
tions higher than 10 mm (i.e. 20 mm and 50 mm) only
resulted in 50% loss of the decarboxylase activity.
Moreover, unlike the P. fluorescens ACMSD apopro-
tein, which can be successfully reconstituted [21,33],
catalytic activity of the human enzyme was not
regained upon removal of EDTA and addition of
metal-ions.
Figure 9 shows the hydrophobicity profiles of
human and P. fluorescens ACMSD, performed accord-
ing to Kyte and Doolittle [37]. By comparing the mean
Fig. 8. Alignment between human (Hs) and
P. fluorescens (Psf) ACMSD. Residues
involved in metal binding in the bacterial
enzyme are highlighted in shaded boxes.
Residues subjected to mutational analysis in
the human enzyme are indicated by #.
A
B
Fig. 9. Hydrophobicity profiles of human (A)
and P. fluorescens (B) ACMSD. The profiles
enzyme model and the crystallographic templates are
all below 1 A
˚
. The residues that directly coordinate to
A
B
C
Fig. 10. Homology modeling of human ACMSD I. Prediction of the human enzyme structure (right) was made on the base of the crystal
structure analysis of P. fluorescens ACMSD (left), as described in Experimental procedures. (A) Ribbon diagram of the two structures. The
arginine residue probably involved in substrate binding is marked by an asterisk, and the residues ligated to the metal ion cofactor (orange
sphere) are shown in ball-and-stick representation (B) metal coordination centers. (C) Molecular surface models. Hydrophobic and polar resi-
dues are colored in blue and gray, respectively.
Human ACMSD L. Pucci et al.
834 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS
the metal cofactor in the bacterial protein are con-
served in the human model (Fig. 10B). The molecular
surface model of both proteins, shown in Fig. 10C,
confirm the higher hydrophobicity in human ACMSD
of the region surrounding the metal active site and the
Arg47 likely involved in substrate binding.
Discussion
In this study, the expression of the human ACMSD
transcript coding for the active enzyme has been exam-
ined in kidney, liver and brain. The tissue distribution
of the transcript closely resembles that of mouse
ACMSD mRNA [36]. The highest expression has been
observed in kidney, suggesting that the tryptophan-
NAD pathway might not be the preferred route of
tryptophan utilization in this organ. Indeed, in kidney
the kynurenine pathway is mostly used to convert
NAD supply.
Our work defines a reliable procedure for the expres-
sion and purification of the active recombinant
ACMSD in good yield. The purification method
differs from that reported for other mammalian
ACMSDs, due to the rapid inactivation of the human
enzyme both in the absence of salts and in the presence
of high ionic strength (i.e. NaCl or sulfate ammonium
concentrations higher than 0.3 and 0.4 m, respectively).
The subunit and native molecular weight values are
comparable with those reported for all ACMSDs so
far characterized, including the bacterial protein
[23,24,34], and are consistent with the lack of a quater-
nary structure. In contrast with the rat enzyme, which
is mostly active at pH 6.0 [24], human ACMSD
displays a broad pH optimum, ranging from
pH 6.5–8.0. Like all ACMSDs [22–24,34], the human
enzyme exhibits a very low micromolar-range K
m
for
ACMS. However, it shows a specific activity six times
lower than that reported for the rat enzyme and a k
cat
value that is about 6.5 times lower than that calculated
for the bacterial counterpart [24,34]. The enzymatic
activity is not significantly affected by the intermedi-
ates of the NAD biosynthetic pathways. Given that
the high concentrations required for inhibition by
quinolinic acid, picolinic acid and kynurenic acid are
far from the physiopathological levels of the trypto-
form, which differs from ACMSD I in the first 24
residues at the N-terminus and lacks the two mutated
histidines, is enzymatically inactive. In contrast to
L. Pucci et al. Human ACMSD
FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 835
what observed for the bacterial enzyme, however,
human recombinant ACMSD specific activity was not
increased by the presence of divalent metal ions in
the growth medium, during protein expression. In
addition, EDTA concentrations higher than those
used for the preparation of the bacterial apoprotein
were required to obtain a significant inactivation of
the human enzyme, and we were not able to recon-
stitute the activity by using the treatment that suc-
cessfully restored the bacterial protein [21,33].
Interestingly, the same difficulty in stripping off the
metallocofactor from the protein has been described
for murine adenosine deaminase, a member of the
amidohydrolase superfamily, which uses Zn
2+
as co-
factor and shares with ACMSD the same metal cen-
ter configuration [34,45]. The metal was inaccessible
to chelators, and was not exchanged with solvent to
any appreciable extent at neutral pH [45]. Authors
also reported a competitive inhibition by Zn
2+
with
respect to the substrate (K
i
transcript coding for a protein which differs from the
other variant in the N-terminal region and carries an
incomplete metal binding domain. In particular, in
this variant only two out of four residues which are
directly involved in the metal cofactor binding are
present. Consistent with this structural deficiency is
our finding that ACMSD II is catalytically inactive
when overexpressed as recombinant protein. Inspec-
tion of the residues which in ACMSD I mark the
boundary of the predicted substrate-binding pocket,
reveals that some of them are conserved in the inac-
tive isoform (i.e. Trp191 and Phe294). Even though
the precise role of these active site residues has not
been established, the possibility that ACMSD II
might still be able to bind the substrate cannot be
definitively ruled out. If this would be the case, the
metabolic relevance of the inactive isoform would be
related to its capability of binding and sequestering a
reactive intermediate like ACMS.
The results we have presented represent the first bio-
chemical report on human ACMSD. They may be
instrumental in promoting the structural analysis of
the protein, particularly with respect to developing
therapeutic leads for treating disorders associated with
increased levels of quinolinate and ⁄ or picolinate.
Experimental procedures
PCR amplification and cloning of ACMSD
isoforms
Human brain, liver and kidney total RNA (Clontech
Laboratories, Inc., Mountain View, CA, USA) was reverse
, 200 lm dNTPs, 1.25 Units
JumpStart Taq DNA polymerase (Sigma-Aldrich Corp., St
Louis, MO, USA) and 1 · of the provided buffer. All PCR
reactions were performed with one cycle of 94 °C for 60 s,
followed by 45 cycles of 15 s at 94 °C and 60 s at 60 °C.
Human ACMSD L. Pucci et al.
836 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS
The efficiency of the PCR method using different pri-
mer ⁄ probe sets was determined from the threshold cycle
values obtained with 10-fold serial dilutions of linearized
pGEM T easy vectors harboring the ACMSD variants.
Standard curves for 18S RNA were obtained using cDNAs
from each organ. All the calibration curves exhibited slopes
ranging from 3.34 to 3.48, indicating comparable amplifica-
tion efficiency. The copy number of each variant in the
unknown samples was determined from the calibration
curves and data were normalized to the copy number of
18S RNA.
Expression of ACMSD isoforms in E. coli
pGEM-ACMSD I and pGEM-ACMSD II were digested
with XhoI and Bpu1102I and cloned into pET-15b and
pET-32b expression vectors. The four constructs obtained
were used to transform E. coli BL21(DE3) cells for proteins
production. E. coli cells harboring the recombinant plas-
mids were grown at 37 °C in Luria–Bertani medium,
containing 100 lgÆmL
)1
ampicillin. After reaching an A
600
of 0.3, cultures were shifted at 25 °C and expression was
favored the alcohol oxidase structural gene displacement,
allowing generation of His
+
Mut
S
phenotype [47]. PCR-pos-
itive His
+
Mut
+
and His
+
Mut
S
clones were cultured in
buffered glycerol-complex medium, and for expression
induction, cultures were transferred in buffered methanol-
complex medium and grown with daily methanol pulses, as
described in [47]. At different induction times, aliquots of
the culture filtrate of His
+
Mut
+
cells were subjected to
SDS ⁄ PAGE analysis and ACMSD activity determination.
The time course of ACMSD expression in His
+
Mut
S
cells
600
of 3.0. The culture was
centrifuged at 5000 g for 10 min (Sorvall centrifuge RC5B
plus, Superlite GSA rotor) and the cell pellet was resus-
pended in one-fifth of the original culture volume of buf-
fered methanol complex medium. Cells were cultured for
5 days, at 30 °C, with daily addition of methanol to main-
tain a 0.5% concentration. Cells were harvested by centrifu-
gation as above, and resuspended in 10 mL of lysis buffer
containing 10 mm potassium phosphate, pH 7.0, 1 mm phe-
nylmethanesulfonyl fluoride, and 0.02 mgÆmL
)1
each of
leupeptin, antipain, chymostatin, and pepstatin. After dis-
ruption by three cycles of French Press (SLM-Aminco,
Urbana, IL, USA) at 1000 p.s.i., the suspension was centri-
fuged at 40 000 g for 20 min (Sorvall centrifuge RC5B plus,
Kontron-Hermle A8.24 rotor). The supernatant was made
10 mgÆmL
)1
by dilution with the lysis buffer, and strepto-
mycin sulfate was added dropwise at a final concentration
of 1%. After 20 min stirring, the sample was centrifuged at
8000 g for 10 min (Sorvall centrifuge RC5B plus, Kontron-
Hermle A8.24 rotor) and the supernatant was loaded onto
a hydroxyhapatite (Bio-Rad, Hercules, CA, USA) column
(2.5 cm · 4.9 cm
2
) equilibrated with 10 mm potassium
phosphate, pH 7.0, 50 mm NaCl. After washing with the
pre-assay mixture consisting of 25 lm hydroxyanthranilic
acid and 0.01 units of R. metallidurans 3-hydroxyanthrani-
lic acid dioxygenase, in 50 mm 4-morpholinepropanesulf-
onic acid, pH 6.0, was incubated at 25 °C, with
monitoring ACMS formation at 360 nm. After the reac-
tion was complete, an appropriate aliquot of ACMSD
was added and the activity was calculated by the
decrease in absorbance. Data were corrected for the
spontaneous decrease in absorbance due to the cycliza-
tion of ACMS to quinolinate. The effect of ACMS
concentration on the enzyme activity was investigated by
varying 3-hydroxyanthranilic acid concentration from 2
to 20 lm . Kinetic parameters were calculated from the
initial velocity data by using the Lineweaver-Burk plot.
One unit is defined as the amount of ACMSD consu-
ming 1 lmol ACMS per minute at 25 °C.
Three-dimensional structure prediction
Human ACMSD structure was modeled using the three-
dimensional coordinates of the P. fluorescens enzyme in
complex with Zn
2+
and Co
2+
(PDB codes 2HBV and
2HBX, respectively) using the SWISS-PDBviewer software
in conjunction with the SWISS-MODEL server (http://
www.expasy.org/spdbv/). The quality of the predicted struc-
ture was checked by computing its Ramachandran plot
using procheck program [48]: 86.6% of the residues were
in the most favored regions, 12.1% in the additional
316–318.
6 Burns LH, Pakzaban P, Deacon TW, Brownell AL,
Tatter SB, Jenkins BG & Isacson O (1995) Selective
putaminal excitotoxic lesions in non-human primates
model the movement disorder of Huntington’s disease.
Neuroscience 64, 1007–1017.
7 Guidetti P, Luthi-Carter RE, Augood SJ & Schwarcz R
(2004) Neostriatal and cortical quinolinate levels are
increased in early grade Huntington’s disease. Neurobiol
Dis 17, 455–461.
8 Guillemin GJ, Wang L & Brew BJ (2005) Quinolinic
acid selectively induces apoptosis of human astrocytes:
potential role in AIDS dementia complex. J Neuroinflam
2, 16.
9 Guillemin GJ, Brew BJ, Noonan CE, Takikawa O &
Culler KM (2005) Indoleamine 2,3 dioxygenase and
Human ACMSD L. Pucci et al.
838 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS
quinolinic acid immunoreactivity in Alzheimer’s disease
hippocampus. Neuropathol Appl Neurobiol 31, 395–404.
10 Bosco MC, Rapisarda A, Reffo G, Massazza S, Pasto-
rino S & Varesio L (2003) Macrophage activating prop-
erties of the tryptophan catabolyte picolinic acid. In
Developments in Triptophan and Serotonin Metabolism
(Allegri G, Costa CVL, Ragazzi E, Steinhart H &
Varesio L, eds), pp. 55–65. Kluwer Academic ⁄ Plenum
Publishers, Norwell, MA.
11 Leuthauser SW, Oberley LW & Oberley TD (1982)
Antitumor activity of picolinic acid in CBA ⁄ J mice.
J Natl Cancer Inst 68 , 123–129.
19 Clark CJ, Mackay GM, Smythe GA, Bustamante S,
Stone TW & Phillip RS (2005) Prolonged survival of a
murine model of cerebral malaria by kynurenine path-
way inhibition. Infect Immun 73, 5249–5251.
20 Beninger RJ, Colton AM, Ingles JL, Jhamandas K &
Boegman RJ (1994) Picolinic acid blocks the neurotoxic
but not the neuroexcitant properties of quinolinic acid
in the rat brain: evidence from turning behaviour and
tyrosine hydroxylase immunohistochemistry. Neuro-
science 61, 603612.
21 Li T, Iwaki H, Fu R, Hasegawa Y, Zhang H & Liu A
(2006) a-Amino-b-carboxymuconic-e-semialdehyde
decarboxylase (ACMSD) is a new member of the
amidohydrolase superfamily. Biochemistry 45, 6628–
6634.
22 Ichiyama A, Nakamura S, Kawai H, Honjo T, Nish-
izuka Y, Hayaishi O & Senoh S (1965) Studies on the
metabolism of the benzene ring of tryptophan in mam-
malian tissues. Enzymic formation of a-aminomuconic
acid from 3-hydroxyanthranilic acid. J Biol Chem 240,
740–749.
23 Egashira Y, Kouhashi H, Ohta T & Sanada H (1996)
Purification and properties of a
-amino-b-carboxy-
muconic-e-semialdehyde decarboxylase (ACMSD), key
enzyme of niacin synthesis from tryptophan, from hog
kidney. J Nutr Sci Vitaminol 42, 173–183.
24 Tanabe A, Egashira Y, Fukuoka SI, Shibata K &
Sanada H (2002) Purification and molecular cloning of
rat 2-amino-3-carboxymuconate-6-semialdehyde.
alpha. Mol Pharmacol 70, 1281–1290.
31 Colabroy KL & Begley TP (2005) Tryptophan catabo-
lism: identification and characterization of a new degra-
dative pathway. J Bacteriol 187, 7866–7869.
32 Muraki T, Taki M, Hasegawa Y, Iwaki H & Lau PCK
(2003) Prokaryotic homologs of the eukaryotic 3-hydro-
xyanthranilate 3,4-dioxygenase and 2-amino-3-carboxy-
muconate-6-semialdehyde decarboxylase in the
2-nitrobenzoate degradation pathway of Pseudomonas
L. Pucci et al. Human ACMSD
FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 839
fluorescens strain KU-7. Appl Environ Microbiol 69 ,
1564–1572.
33 Li T, Walker AL, Iwaki H, Hasegawa Y & Liu A
(2005) Kinetic and spectroscopic characterization of
ACMSD from Pseudomonas fluorescens reveals a penta-
coordinate mononuclear metallocofactor. J Am Chem
Soc 127, 12282–12290.
34 Martynowski D, Eyobo Y, Li T, Yang K, Liu A & Zhang
H (2006) Crystal structure of a-amino-b -carboxymucon-
ic-e-semialdehyde decarboxylase: insight into the active
site and catalytic mechanism of a novel decarboxylase
reaction (2006). Biochemistry 45, 10412–10421.
35 Liu A & Zhang H (2006) Transition metal-catalyzed
nonoxidative decarboxylation reactions. Biochemistry
45, 10407–10411.
36 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A,
Egashira Y, Sanada H & Shibata K (2002) Identifica-
tion and expression of a cDNA encoding human
a-amino-b-carboxymuconate-e-semialdehyde decarboxy-
science 26, 8484–8491.
45 Cooper BF, Sideraki V, Wilson DK, Dominguez DY,
Clark SW, Quiocho FA & Rudolph FB (1997) The
role of divalent cations in structure and function of
murine adenosine deaminase. Protein Sci 6, 1031–
1037.
46 Schagger H & Von Jagow G (1987) Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis for
the separation of proteins in the range from 1 to 100
kDa. Anal Biochem 166, 368–379.
47 Pichia Expression Kit
A Manual of Methods for Expres-
sion of Recombinant Proteins in Pichia Pastoris. Invitro-
gen Corporation, San Diego, CA.
48 Laskowski RA, MacArthur MW, Moss DS & Thornton
JM (1993) procheck: a program to check the stereoche-
mical quality of protein structures. J Appl Cryst 26,
283–291.
49 Humphrey W, Dalke A & Schulten K (1996) VMD:
visual molecular dynamics. J Molec Graphics 14 1, 19–25.
Human ACMSD L. Pucci et al.
840 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS