Regulation of a1,3galactosyltransferase expression in pig
endothelial cells
Implications for xenotransplantation
Dominique Mercier
1,2
, Beatrice Charreau
3
, Anne Wierinckx
2
, Remco Keijser
1
, Lize Adriaensens
1
,
Renate van den Berg
1
and David H. Joziasse
1
1
Department of Molecular Cell Biology, Research Institute of Immunology and Inflammatory Diseases and
2
Department of Medical Pharmacology, Research Institute Neurosciences VU, VUmc, Amsterdam, the Netherlands;
3
Institut de Transplantation et de Recherche en Transplantation (ITERT), INSERM U437, Nantes, France
The disaccharide galactosea1,3galactose (the aGal epitope)
is the major xenoantigen responsible for the hyperacute
vascular rejection occurring in pig-to-primates organ trans-
plantation. The synthesis of the aGal epitope is catalyzed by
the enzyme a1,3-galactosyltransferase (a1,3GalT). To be
able to control porcine a1,3GalT gene e xpression specific-
ally, we have analyzed the ups tream portion of the a1,3GalT

pigs are con sidered as the most suitable donor animal
because pig organs are physiolo gically similar to human
organs and the potential risk of pathogen transmission is
low when compared w ith the use of o rgans from species
closely related to humans [1, 2]. But when transplanted into
humans or nonhuman primates, pig organs are rejected
hyperacutely by antibody-mediated complement activation
[3–5]. The hyperacute rejection i s i nitiated by the interaction
between natural preformed anti-pig Ig (xeno reactive natural
antibodies) and carbohydrate epitopes expressed by endo-
thelial cells of donor organs. T his results in the activation of
the classical complement pathway with concomitant endo-
thelial cell activation, which ultimately induces graft failure
[4]. A major portion (about 80%) of xenoreactive natural
antibodies is directed against a single determinant, the
terminal disaccharide structure galactosea1,3galactose (the
aGal epitope), present o n the surface of p ig vascular
endothelium [6–8]. These anti-Gala1,3Gal Ig, originally
identified by Galili et al. [9], are also found in apes and Old
World mo nkeys, bu t not in lower primates (e.g. New World
monkeys) or nonprimate mammals (including the pig). The
latter species express the aGal e pitope, whereas humans and
higher primates don’t [9–11].
Xenoantigens that contain the Gal a1,3Gal structure are
synthesized by UDP-Gal:Galb1,4GlcNAc a1,3galactosyl-
transferase (a1,3GalT). Genes and cDNAs encoding the
a1,3GalT e nzyme have been cloned from several species
(cow, mouse and pig) [12–16]. In humans, one pseudogene
(HGT-10) and one retro-processed pseudogene (HGT-2)
have been identified, both containing multiple frame-shift

transcription. Therefore we have a nalyzed a1,3GalT regu-
lation in pig endothelial cells. We have set out to isolate the
sequences upstream of the 5¢ untranslated exons. T hree of
the four putative promoter regions were isolated from a pig
genomic library, and functionally characterized using gene
reporter assays. When t ransiently transfected into pig aortic
endothelial cells, all three putative promoter regions were
able to drive luciferase transcription. Relative importance of
the different promoters was determined in resting and
tumor nec rosis fa ctor a (TNFa) stimulated e ndothelial cells
using real-time quantitative P CR (Q-PCR). Results indica-
ted that more than 90% of the a1,3GalT gene expression in
pig e ndothelial cells was associated with only one of the four
putative promoters (promoter B). The modest effect of
TNFa treatment on a1,3GalT transcription suggests that
the various promoters are only weakly s ensitive to inflam-
matory conditions.
MATERIALS AND METHODS
Cells and cell lines
COS7 cells were obtained from the Netherlands Cancer
Institute (Amsterdam, the Netherlands). The pig kidney
cells (PK15) were obtained from A. Roos (Department of
Nephrology, Leiden University Med ical C enter, the Neth-
erlands). Pig aortic endothelial cells (PEC-A [25]), and pig
primary aortic endothelial cells (pPAECs) were provided by
J. Holgersson (Karolinska Institute, Huddinge, S weden)
and B. Charreau (Institut de Transplantation et de Recher-
che en Transplantation, Nantes, France), respectively. All
cells were cultured in Dulbecco’s modified Eagle’s medium
supplemented w ith 10% of fetal bovine serum and 100 units

(generated as described above) and the second one, suitable
for t he cloning o f promoter B region, contained exon 1.
After plating (2.5–3 · 10
5
plaques, 5 · 10
4
plaques per
Table 1. Sequences of oligonucleotides used.
Primer name Sequence (5¢-3¢) Localization Target
p1 TCAAACAGAACAACTTCTGAAGCC Exon 2 Promoter A
p2 GCTCTGCTCTGCAGAAGGAGGC Exon 3 Promoter A
p3 GCCACTGTTCCCTCAGCCGAG Exon 1 Promoter B probe
p4 CTGATCGGCAGAAGCTGGGTG Exon 1 Promoter B probe
p5 CCAAGGGTGGTGGCTGTCCCTC Exon 3 Promoter A
p6 TGTCCCTGCTAGTTGTCATTTGG Intron 2 Promoter A
p7 ACGACCACTTTGTCAAGCTCATT GAPDH
p8 TGAGGTCCACCACCCTGTTG GAPDH
p9 TCCTGAAACGCCTTCGGAAGAG E-selectin
p10 CCATTGGGTTGAAGGCATTCG E-selectin
p11 ACAAGGCCCCTGGCTGCT Exon 3 a1,3GalT-5¢-A
p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1,3GalT-5¢-A
p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1,3GalT-5¢-B and -E
p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1,3GalT-5¢B and E
p15 ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1,3GalT-5¢-C
p16 AGGCAGGGCTGGGAGGAA Exon 3 a1,3GalT-5¢-C
p17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1,3GalT-coding region
p18 CTTTGTGGCCAACCATGAAGTA Exon 9 a1,3GalT-coding region
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1465
plate), the plaques were transferred t o H ybond N
+

rather than pGL3-Basic in view of the relatively low
transcriptional activity of the a1,3GalT promoter.
Clone A represents vector pGEM-T-easy containing the
whole PCR fragment (nucleotides 1249–1786) correspond-
ing to the putative promoter A region (see above). For
construct A.1 (promoter A , construct 1), the P CR fragment
(nucleotides 1249–1786) was excised from clone A with
EcoRI. Construct A.2 (nucleotides 1388–1786) was gener-
ated by PCR (primers p6 and p2, Table 1), in which clone A
DNA was the template. In a s imilar w ay, const ruct A.3
(nucleotides 1483–1786) was also made by PCR, using
primers p5 and p2 (Table 1). For construct A.4, the 5¢ part
(nucleotides 1249–1611) of the insert w as delet ed from the
clone A by Hi n cII digestion . For construct A .5, a Sty I-
internal fragment was deleted from the clone A (Dnt1484–
1590). Construct A.6 was made using a blunted
StyI-fragment of clone A (nucleotides 1484–1590).
Construct A .7 consisted of a HincII fragment ( nucleotides
1249–1611) of clone A.
For promoter B sequences, a BamHI fragment was used
that originated from the hybridization-positive phage clone
2.3.1, isolated from the genomic library. This 2.7-kb DNA
fragment was ligated with plasmid pBS. Part of the intronic
sequence (intron 1, nucleotides 1385–2695) was deleted by
SmaI digestion and re-closure, and the clone thus obtained
(pBS clone B) was used for further constructs. Construct B.1
contained a Bgl II/HindIII fragment of 1.2 kb ( nucleotides
175–1385). An antisense construct (B.2, nucleotides 1385–
175) was also made using a BglII/SmaI digestion. The two
other constructs (B.3 and B.4) contained SacIfragment

cells. After 3 h of incubation at 37 °C, the m ixture w as
replaced by 400 lL o f c omplete m edium. The b-galactosi-
dase plasmid pCH110 (Amersham), containing the SV40
early promoter, served as an internal control for transfection
efficiency. pGL3-Control ( i.e. pGL3-Enhancer plas mid
containing the early promoter of SV40, Promega) was used
as a positive control, and empty pGL3-Enhancer plasmid a s
the n egative c ontrol. All the constructs were tested in two or
three i ndependent experiments, each performed in triplicate.
Luciferase reporter and b-galactosidase assays for cell
extracts were performed 48 h after the start of the transfec-
tion. Luciferase activity was measured using the Luciferase
assay system (Promega) and 5 lL ( out of 60 lL) of cell
extract in a BioOrbit-1250 luminometer (BioOrbit).
b-Galactosidase activity was assayed using ortho-nitrophe-
nyl-b-
D
-galactopyranoside as t he substrate, and t he am ount
of reaction product was determined from the absorbance a t
420 nm.
TNFa activation of pig endothelial cells
and cDNA synthesis
pPAEC and PEC-A cells were cultured as described above
and were stimulated with 100 U ÆmL
)1
of recombinant
human TNFa (hTNFa; CLB, the Netherlands) added to
the medium for different periods o f time (1, 2, 4, 8 , 12, 24, 48
and 72 h). After activation, cells were washed in phosphate
buffered saline (NaCl/P

human TNFa) a s the template. GAPDH was used to
normalize the quantity of cDNA used for each a ssay, and
background due to primer dimerization was c hecked with
nontemplate controls (reaction without cDNA). The activ-
ation e fficiency of the endothelial c ells was tested by
quantification of E-selectin transcripts (GenBank accession
number L 39076) as a control. Ct values, corresponding to
the cycle number required for fluorescence intensity to
exceed an arbitrary threshold in t he exponential phase of the
amplification (0.3 arbitrary units), were determined for all
the samples and the gene to be analyzed. In addition, to
quantify the mRNA copy numbers standard curves were
generated. Plasmids containing exon 2-intron 2-exon 3
(pGEM-T-easy clo ne A), exon 1 (pBS clone B), exons 8
and 9 (PCR product obtained with primers p17 and p18,
Table 1 , subcloned in pGEM-T-easy) or pig E-selectin
cDNA, corresponding to transcripts 5¢-A and -C, 5¢-B
and -E, a1,3GalT coding sequence and E-selectin, respect-
ively, were selected. Various amounts of these different
plasmids (from 10
3
to 10
6
copies per reaction) were used in
Q-PCR assays, and data obtained for each concentration
(2
Ct
) were plotted against the amounts.
RESULTS
The organization of the pig a1,3GalT gene

BasedonRT-PCR,piga1,3GalT is expressed in l ung and
in all cell types investigated so far (kidney PK15 cells,
hepatocytes, endothelial cells). Transcripts 5¢-B and/or -E
have been detected in all samples, and 5¢-A in most of them
with the exception of hepatocytes . The 5¢-C and - F
transcripts are present in pPAECs. Transcript 5¢-D was
not detected in any of the samples studied here.
Cloning and sequence analysis of pig a1,3GalT
promoter regions
The available a1,3GalT cDNA sequences (this paper and
[20]) were used to generate DNA probes by PCR, with the
aim t o i solate relevant 5¢ flanking sequences of the g ene
from a genomic library. As start sites A and C had been
found to be closely spaced, a single probe was sufficient to
screen the library for their individual regulatory sequences.
To isolate the genomic region upstream of the 5¢-A
transcript, we performed PCR o n pig genomic DNA using
primers p1 and p2 that hybridize with exons 2 and 3,
respectively. A fragment of 538 bp was obtained ( clone A),
which contains e xon2-intron2-exon3 sequences that overlap
with the putative promoter A region (Fig. 2B, GenBank
accession number: AF415202). This fragment was used as a
probe to screen the pig genomic library. A single hybrid-
ization-positive clone (phage 2.1.3) containing an insert of
14 kb was isolated. Southern blot analysis of the phage
DNA confirme d t hat a major portion of the probe sequence
is included in a 1.6-kb BamHI fragment (Fig. 2A). This
DNA fragment contains 1.2 k b of sequence upstream of
start site C (Fig. 2B, GenBank accession number:
AF415202), as well as 430 bp of clone A. Sequences thus

sites that could be important for promoter activity in pig
cells, such a s GATA- and GC-boxes, AP-1, Inr and YY1
are present (Fig. 2B).
Analysis of the sequences upstream o f t he exon 2
transcriptional start site revealed the presence o f four
putative NF-jB binding sites (Fig. 2B) located at nucleo-
tides 86, 167, 371 and 552, respectively. A dditional potent ial
transcription factor binding sites such as Oct-1, AP-1,
GATA- a nd GC-boxes are distributed all along the
promoter C sequence, and a TATA-box is present 16 bp
downstream of the transcriptional start site of exon 2
(Fig. 2B).
In order to clone the putative promoter B region, the
genomic library was screened with a probe corresponding t o
exon 1. Phage clone 2.3.1 thus isolated contained an 11-kb
insert; BamHI digestion of the DN A produced a 2.7-kb
fragment that hybridized with the p robe (Fig. 3A, GenBank
accession number A F415201). This f ragment contains
1.18 kb of sequence upstream of exon 1, exon 1 itself, and
1.36 kb of intron 1. The GC c ontent of the whole fragment
is about 60%, and in the 1.6-kb region between nucleotides
724 a nd nucleotide 233 5 (Fig. 3B) it reaches 68%. Associ-
ated with the high GC content of this r egion, 12 putative
Sp1 binding sites are present. In addition, the promoter B
region contains numerous putative t ranscription factor
binding sites including GATA-boxes, Oct-1, e ts-1, AP-1,
NF-jB and C/EBP sites (Fig. 3B).
Unfortunately, out of the 6 · 10
5
plaques s creened with a

PEC-A pig endothelial cells (Fig. 4A, open bars). Deletion
of the 140 bp 5¢ portion of the fragment t o give A.2 did not
affect activity, but deletion of an additional 9 6 bp ( construct
A.3) re sulted in a fivefold lower luciferase a ctivity (Fig. 4A).
A segment of 1.2-kb containing putative promoter C
regulatory regions was also analyzed. The full 1.2-kb
sequence (construct C.1, containing nucleotides 1–1219)
was able to drive transcription in PEC-A cells (Fig. 4 B,
open bars). Deletion of a 164-bp (C.2) or 719-bp (C.4) 5¢
fragment resulted in a fourfold and t wofold reduction in
luciferase activity, respectively.
ForpromoterB,afragmentof1.2 kb (nucleotides 175–
1385 in Fig. 3B) containing most of the GC-rich region was
studied. When transiently transfected into PEC-A cells,
construct B.1 produced a luciferase a ctivity ninefold greater
than negative control ( Fig. 4C). Deletion of the 3 ¢ 286-bp
portion (construct B.3) did not change the activity, which
5'-C [20]
A
1 2 3 4
6

3 1.5

0.5
Size in kb


1001 1050 1100 1150 1200 1250 1300 1350 1400 1450
1500
GATA
Sp1
Sty I Hinc II BamH I
5'-A [20]
GATAAp-1 GATA
Inr
p2
Sp1
exon 3
1501 1550 1600 1650 1700 1750 1800
B
Fig. 2. Schematic representation of the a1,3GalT promoter A an d C
regions. (A) Southern blot analysis. DNA prepared from phage 2.1.3
isolated from the pig genomic library was digested with various
restriction enzymes, and hybridized with the clone A DNA fragment
(see Materials a nd m eth ods). Siz es o f t he d ifferent bands of t he DN A
marker are indicated on the left of the figure. Lane 1: PstI, lane 2:
HindIII, lane 3: EcoRI , lane 4: BamHI. (B) Schematic representation
of th e a1,3GalT promoter A and C regions. Positions of primers used
to gen erate the 5 38-bp fragment ( Table 1) a re positioned un der the
sequence and are indicated by horizontal arrows. Restriction enzyme
sites used to generate the different reporter gene con structs are indi-
cated by vertica l lines ab ove the sequen ce. Exonic sequences (exon 2
and 3) a re indicated b y gray boxes. The sta rt sites of transcript 5¢-A
and -C are in dicated [20]. Putative transcription factor b inding sites
detected using
TRANSFAC
are indicated above the seque nce a nd are

pGL3-Control
C.1
158
85
C.2
123
20
C.4
120
48
pGL3-Enhancer
5
5
Normalized Luciferase Activity (mV)
B
0 50 100 150 200
1000
6000
B.1
202
45
B.2
58
5.5
B.3
159
42
1
Bgl IISac I Sac I Sma
I

pGL3-Enhancer
5
pGL3-Control
5
48
1170
A.2
186
Normalized Luciferase Activity (mV)
A
Fig. 4. Transcriptional activity of a1,3GalT promoter constructs in
COS7 and PEC-A cells. Theleftpartofthefigureshowsthestructure
of constructs made for p romoter A (A), C (B) and B (C), and their
relative positions in th e a1,3 GalT gene. Exonic (gray boxes), and
intronic (solid lines) sequences and r estriction enzyme sites are indicated
as well as s equences derived from the plasmid pBS (vertical lines). For
each construct, the segment of genomic sequence tested in luciferase
assay is i ndic ated by horizontal gray b ars. The right part of eac h panel
shows the results of transfection experiments for each construct; values
(in mV) are the means of three or fo ur separate experim ents, per-
formed in triplicate, ± SEM. Luciferase activities are normalized on
b-galactosidase activity from a cotransfected vector (see Materials and
methods). Solid and open b ars correspond to COS7 a nd PEC-A
transfection, respectively. Constructs A.4 to A.7, C.3 and C.5 were
only tested in COS7.
A6


GATA
GATA
NF-
κB
501 550 600 650 700 750 800 850 900 950
1000
Koike et al
[21]
Sp1
Sp1
Sp1
Sp1
Sp1 Sp1
Sp1
AhR/Arnt
Sp1
Sac I
5'-E [20]
GATA
exon 1
10011050 1100 1150 1200 1250 1300 1350 1400 1450
1500
Sp1
5'-B
[20]
GATA
Sma
I
Sp1
GATA GATA GATASp1 Arnt

hybridized with a probe corresponding to exon 1 (see Mater ials and
methods). Sizes of the different bands of the DNA marker a re indi-
cated on the left of the figure. Lane 1: SacI, lane 2: PstI, lane 3:
HindIII, lane 4: EcoRI, lane 5: BamHI. (B) Schematic representation
of the promoter B region. Restriction enzym e sites used to generate the
different constructs are indicated by vertical lines above the sequence.
Exon 1 sequences are i ndicated by a gray box. The main transcrip-
tional start site used in t ranscripts produced f rom promoter B is
indicated [20]. Putative t ranscription factor binding sequences are
indicated above the sequence and are represented by ho riz ontal lin es.
The GC-rich region of pro moter B i s indicate d by a thi ck line.
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1469
same fragment inserted in pGL3-enhancer in antisense
orientation was 3.5-fold less active (Fig. 4 C). Values
obtained f or the 3¢ truncated fragments B.3 and B.4
followed the same pattern as those observed for PEC-A
cells (Fig. 4C), in that the ability to drive transcription is
orientation dependent, and that 3¢ deletion of 286 b p did
not significantly alter activity.
Relative levels of a1,3GalT transcripts in pig
endothelial cells
Levels o f a1,3GalT transcripts in pPAEC and in a PEC-A
were measured using Q -PCR in order t o establish t he relative
importance, within the context of the full gene, of the three
different promoters identified above. Taking advantage o f
the sequence differences between the 5¢ regions of the
promoter specific transcripts, and assuming that the differ-
ences observed in terms of transcript levels are proportional
to promoter activity, specific primers ( Table 1) were
designed to follow variations of a1,3GalT g ene expression

copiesÆlg
)1
after only 2 h of TNFa-treatment
(340-fold increase, Fig. 5A). A second peak was observed
after 24 h of induction (21 · 10
6
copiesÆlg
)1
,Fig.5A),
clearly indicating that the cells were properly activated in
this experiment. Total mRNA levels of a1,3GalT were also
checked during the time course of TNFa induction, as well
as the levels of 5¢-A, 5¢-B and 5 ¢-C transcripts. Total a mount
of a1,3GalT transcripts started to rise 2 h after the addition
of TNFa, to reach a plateau after 4 h of activation (55%
increase, to 1.8 · 10
6
copies per lg of total RNA, or  35
copies per cell). After 12 h the amount began to decrease to
reach 0.3 · 10
6
copiesÆlg
)1
( 6 copies p er cell) after 72 h of
stimulation. The 5 ¢-A and 5 ¢-B transcript le vels varied in
parallel with the total amount of a1,3GalT transcripts,
whereas quantities of 5¢-C transcripts are regulated
differently with two peaks of transcription, a first one
after 2 h ( increase of 82%) a nd a second one at
12 h (119% increase). At any activation time point studied,

amount of a1,3GalT transcripts was estimated using primers binding
to the cod ing sequence (exons 8 and 9). E ffective activation of th e cells
was verified b y amplifi cation of E-selectin mRNA. The nu mb er o f
transcripts in the experimental samples was calculated from a c alib-
ration curve obtained by v arying the number of copies of a plasmid
containing the fragment to be amplified, and normalized based on
GAPDH levels.
1470 D. Mercier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
to man. Modification of porcine glycosylation has been
considered as one strategy to facilitate xenotransplantation.
In this respect, it will be important to know the mechanism
of regulation of porcine terminal glycosylt ransferases.
Research focuses on a1,3GalT in p articular, as the latter
enzyme produces the Gala1,3Gal struct ure, the m ajor
porcine xenoantigen with a role both i n hyperacute r ejection
and in delayed vascular r ejection.
Here we have assembled the full structure of the 5¢
flanking regions of the porcine a1,3GalT g ene, completing
partial structures as reported by K atayama et al. [20] and
Koike et al. [21]. The gene consists of 10 exons, four of
whichcontain5¢ untranslated sequence and six coding
sequence. The exact structure of th e 5 ¢ flanking regions of
the a1,3GalT gene has been unclear. Koike et al. [21] have
suggested that exon 0 as detected by K atayama et al. [20]
and by t hemselves ( named e xon I i i n [ 21]) i n f act is b ased on
an artifact, and could be the result of an accidental link-up
of two unrelated sequences. Independently, we have isolated
from porcine endothelial cells a t ranscript, 5¢-F, that does
contain exon 0 in conjunction with additional, downstream
a1,3GalT exons 1 and 3–9. The occurrence o f t his transcript

regions. E ach o f t he promoters A, B , and C w as found to be
active in porcine endothelial cells. Sequence analysis of
promoter region A, the 479-bp region directly upstream of
exon-3, revealed the presence of several putative transcrip-
tion factor binding sites (Fig. 2B). The region contains five
GATA(like) sites. One of these, GATA nucleotides 1621–
1624, is in close proximity to an AP-1 motif . Cooperative
interactions between AP-1 and GATA were reported to
regulate transcription driven b y the human P-selectin
promoter [29, 30]. For porcine a1,3GalT, the AP-1/GATA
motif is located just upstream of the start site (at nucleotide
1633) of transcript 5¢-A. This start site is part of an
octanucleotide t hat i s h ighly s imilar t o t he consensus
transcriptional initiator sequence [31, 32]. The initiator
sequence, together with the AP-1/GATA motif, is probably
important for the production of transcript 5¢-A in porc ine
endothelial cells. However, additional upstream sequence is
essential for transcriptional activity. Construct A.2 that
contains the nucleotides 1388–1786 region was found to be
five times more active in PEC-A cells (luciferase assays,
Fig. 4A) than construct A.3 (nucleotides 1483–1786). This
suggests that a transcriptional activator binds to the region
nucleotides 1388–1483. The segment needs to be linked to
the transcriptional start site via StyI-fragment nucleotides
1483–1590, as deletion of the latter fragment results in zero
activity (Fig. 4A). Apart from a single G ATA-box, no
known transcription factor binding site is present in region
nucleotides 1388–1483 (Fig. 2 B). The GATA box shows
only imperfect homology with the consensus sequence.
Therefore, activation by t he nucleotides 1388–1483 segment

sequence o f  1.5 kb, as reported earlier by Koike et al.
[21]. Consequently, numerous Sp1 binding sites h ave been
predicted in t hat region (Fig. 3B) . The lack of TATA o r
CAAT-boxes together with the presence of many Sp1
binding sites, as observed f or promoter B, is a c haracteristic
of ÔhousekeepingÕ genes. For most of these genes, transcrip-
tional s tart is likely to b e imprecise, and indeed a set of
transcripts differing in their 5¢ ends is produced from
promoter B [20, 21]. S everal glycosyltransferase p romoters
present similar structure and characteristics [39–42]. For
example, the promoter of the long form of b1,4-gala ctosyl-
transferase contains 12 Sp1 binding sites, and is active in a
variety of cell types [42, 43]. Two putative NF-jB b inding
sites have been found in promoter B sequence (nucleotides
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1471
898–907 and nucleotides 2398–2407) suggesting that this
promoter may respond to endothelial c ell activation.
Interestingly, a1,3GalT transcripts generated from pro-
moter B contain a GC-rich 5¢ untranslated region, which is
predicted to form stable h airpin loops. This m ay interfere
with the efficiency of translation of the mRNA as has been
shown fo r b1,4-galactosyltransferase [44]. I n that way,
increased transcription from promoter B could be compen-
sated for by low t ranslation efficiency.
We have established w hich promoter is used preferen-
tially in porcine endothelial cells, and how a1,3GalT gene
transcription is affected by TNFa-activation of endothelial
cells. Results obtained for nonactivated p PAEC and P EC-A
cells were similar. In both cell types the 5 ¢-B transcript is the
most highly expressed i soform (Fig. 5 A,B), and corresponds

1. Bu
¨
hler, L., Friedman, T., Lacomini, J. & Cooper, D.K.C. (1999)
Xenotransplantation-state of the art-Update. Front. Biosci.
4, d416–d432.
2. Soin, B., Vial, C.M. & Friend, P.J. (2000) Xenotransplantation,
Br. J. Surg. 87, 138–148.
3. Saadi, S. & P latt, J.L. (1997) Immunology of xe notransplantation.
Life Sci. 62, 365–387.
4. Bach, F.H. (1998) Xenotransplantation: problems and prospects.
Annu. Rev. Med. 49, 301–310.
5. Daniels, L.J. & Platt, J.L. (1997) Hyperacute xenograft r ejection as
an immunologic b arrier to xenotransplantation. Kidney Int. 51,
S28–S35.
6. Sandrin, M.S. & McKenzie, I.F. (1994) Gal alpha(1,3)Gal, t he
major xenoantigen (s) recognised in pigs by human natural anti-
bodies. Immunol. Rev. 141, 169–190.
7. Samuelsson, B.E., Rydberg, L., Breimer, M.E., Backer, A.,
Gustavsson, M., Holgersson, J., Karlsson, E., Uyterwaal, A C.,
Cairns, T. & Welsh, K. (1994) Natural antibodies and human
xenotransplan tation. Immunol. Rev. 141, 151–168.
8. Cooper, D .K., Koren, E. & Oriol, R . (1994) Oligosaccharides and
discordant xenotransplantation. Immunol. Rev. 141, 31–58.
9. Galili, U., C lark, M .R., Shohet, S.B., Buehler, J . & Macher, B .A.
(1987) Evolutionary relationship between the natural anti-Gal
antibody and the Gala1 fi 3Gal epitope in primates. Proc. Natl
Acad. Sci. USA 84, 1369–1373.
10. Galili, U., Shohet, S.B., Kobrin, E., Stults, C.L. & Macher, B.A.
(1988) Man, apes, and Old World monkeys differ from other
mammals in the expression of alpha-galactosyl epitopes on

ingbygenetransfer.Proc. Natl Acad. Sci. USA 86, 8227–8231.
17. Larsen, R.D., Rivera-Marrero, C.A., Erns t, L.K.,
Cummings, R.D. & Lowe, J.B. (1990) Frameshift and nonsense
mutations in a human g enomic sequence ho mologous to a murine
UDP-Gal:beta-
D
-Gal(1,4)-
D
-GlcNAc a lpha(1,3)–galactosyltrans-
ferase cDNA. J. Biol. Chem. 265, 7055–7061.
18. Joziasse, D.H., Shaper, J .H., Jabs, E.W. & Sha per, N.L. (1991)
Characterization of an al pha 1–3-galactosyltransferase h omologue
on human chromosome 12 that is organized as a processed
pseudogene. J. Biol. Chem. 266, 6991–6998.
19. Shaper, N.L., Lin, S .P., Joziasse, D.H., Kim, D.Y. & Y ang-Feng,
T.L. (1992) A ssignment of two human alpha-1,3-galactosyl-
transferase gene sequences (GGTA1 and GGTA1P) to chromo-
somes 9q33-q34 and 12q14-q15. Genomics. 12, 613–615.
20. Katayama, A., Ogawa, H., Kadomatsu, K., Kurosawa, N.,
Kobayashi, T., Kaneda, N., Uchimura, K., Yokoyama, I.,
Muramatsu, T. & Takagi, H . (1998) Porcine alpha-1,3-galactosyl-
transferase: full length cDNA cloning, genomic organization, and
analysis of sp lici ng var iants. Glycoconj J. 15, 583–589.
21. Koike, C., Friday, R.P., Nakashima, I., Luppi, P., Fung, J.J., Rao,
A.S., Starzl, T.E. & Trucco, M. (2000) Isolation o f t he re gulatory
regions and genomic organization of the porcine alpha1,3-
galactosyltransferase gene. Transplantation. 70, 1275–1283.
22. d’Apice, A.J., Tange, M.J., Chen, G.C., Cowan, P.J., Shinkel,
T.A. & Pearse, M.J. (1996) Two genetic approaches to the
galactose alpha 1,3 galactose xenoantigen. Transplant Proc. 28 ,

regulation in the immune system: all roads lead to AP-1. J. Leu-
kocyte Biol. 63, 139–152.
31. Weis, L. & Reinberg, D. (1997) Accurate positioning of RN A
polymerase II on a n atu ral TATA-less promoter is independent of
TATA-binding-protein-associated factors and initiator-binding
proteins. Mol. Cell Biol. 17, 2973–2984.
32. Weis, L. & Reinberg, D. (1992) Transcription by RNA poly-
merase II: initiator-directed formation of transcription-competent
complexes. FASEB J. 6, 3300–3309.
33. Mantavoni, A., Bussolino, F. & Dejana, E. (1992) Cytokine reg-
ulation of endothelial cell function. FASEB J. 6, 2591–2599.
34. Mantavoni, A ., Bussolino, F. & Introna, M. (1997) Cytokine
regulation of endothelial cell f unction: fro m molecular level to the
bedside. Immunol. Today 18, 231–240.
35. Karantzoulis-Fegaras, F., Antoniou, H., Lai, S L.M., Kulkarni,
G., D’Abreo, C., Wong, G.K.T., Miller, T.L., Chan, Y., Atkins,
J., Wang, Y. & Marsden, P.A. (1999) Characterization of the
human endothelial n itric-oxyde synthase promoter. J. Biol. C hem.
274, 3076–3093.
36. Cowan, P .J., Tsang, D., Pedic, C .M., Abbott, L.R., Shinkel, T.A.,
d’Apice, A.J.F. & Pearse, M.J. (1998) The human ICAM-2 pro-
moter is end othelial cell-spec ific in vitro and in vivo and contains
critical Sp1 and GATA binding sites. J. Biol. Chem. 273 , 11737–
11744.
37. Iljin, K., Dube, A., Kontusaari, S., Korhonen, J., Lahtinen, I.,
Oettgen, P. & Alitalo, K. (1999) Role of Ets fac tors in t he activity
and endothelial cell specificity of the mouse T ie gene promoter.
FASEB J. 13, 377–386.
38. Neish, A.S., Khachigian, L.M., Park, A., Baichwal, V.R. &
Collins, T. (1995 ) Sp1 is a component of the cytokine-inducible

synthesis is achieved in part by translational control. Proc. Natl
Acad.Sci.USA95, 14805–14810.
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1473