Cooperation of two carotene desaturases in the
production of lycopene in Myxococcus xanthus
Antonio A. Iniesta
1,2
, Marı
´a
Cervantes
1
and Francisco J. Murillo
1
1 Departamento de Gene
´
tica y Microbiologı
´
a, Facultad de Biologı
´
a, Universidad de Murcia, Spain
2 Department of Developmental Biology, Beckman Center, Stanford University School of Medicine, CA, USA
Carotenoids constitute one of the most widely distri-
buted and structurally diverse classes of natural pig-
ments, with important functions in photosynthesis,
nutrition, and protection against photooxidative dam-
age. Carotenoids are ubiquitously found in bacteria,
fungi, algae, and plants. Even though the end-products
of carotenoid biosynthesis are extremely diverse, a gen-
eral common pathway leading to the formation of
lycopene (red carotene), and cyclic b-carotene (yellow)
is observed in many organisms. However, the nature
of the involved enzymes varies among different organ-
isms [1]. Precursors for the synthesis of carotenoids are
derived from the general isoprenoid biosynthetic path-

Espinardo, Murcia 30071, Spain
Fax: +34 957 355 039
Tel: +34 957 355 024
E-mail:
(Received 10 May 2007, revised 26 June
2007, accepted 28 June 2007)
doi:10.1111/j.1742-4658.2007.05960.x
In Myxococcus xanthus, all known carotenogenic genes are grouped
together in the gene cluster carB–carA, except for one, crtIb (previously
named carC). We show here that the first three genes of the carB operon,
crtE, crtIa, and crtB, encode a geranygeranyl synthase, a phytoene desatur-
ase, and a phytoene synthase, respectively. We demonstrate also that CrtIa
possesses cis-to-trans isomerase activity, and is able to dehydrogenate
phytoene, producing phytofluene and f-carotene. Unlike the majority of
CrtI-type phytoene desaturases, CrtIa is unable to perform the four dehy-
drogenation events involved in converting phytoene to lycopene. CrtIb, on
the other hand, is incapable of dehydrogenating phytoene and lacks cis-to-
trans isomerase activity. However, the presence of both CrtIa and CrtIb
allows the completion of the four desaturation steps that convert phytoene
to lycopene. Therefore, we report a unique mechanism where two distinct
CrtI-type desaturases cooperate to carry out the four desaturation steps
required for lycopene formation. In addition, we show that there is a
difference in substrate recognition between the two desaturases; CrtIa
dehydrogenates carotenes in the cis conformation, whereas CrtIb dehydro-
genates carotenes in the trans conformation.
Abbreviations
CTT, casitone ⁄ Tris; GGPP, geranylgeranyl diphosphate.
4306 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS
are carried out by other desaturases, Zds in plants and
algae, and CrtQ in cyanobacteria, which are related to

es, providing additional evidence for the wide plasticity
of carotenoid biosynthesis. Finally, we also show here
that CrtIa possesses cis-to-trans isomerase activity, and
recognizes substrates in the cis conformation, whereas
CrtIb has similar desaturase activity but recognizes
substrates in the trans conformation.
Results
Phytoene isomerization
In M. xanthus, a mutant with a transposon insertion
in the coding region of crtIb accumulates all-trans-phy-
toene (93%) and phytofluene (7%) [11]. Therefore,
CrtIb is required for phytoene dehydrogenation steps
producing lycopene, but is dispensable for the 15-cis-
phytoene to all-trans phytoene isomerization. This sug-
gests the existence of a second enzyme to carry out the
phytoene isomerization and, possibly, the first phyto-
ene dehydrogenation step leading to phytofluene. The
product encoded by crtIa showed high similarity to the
CrtI-type phytoene dehydrogenase from fungi and
noncyanobacterial bacteria [13], including the previ-
ously described CrtIb of M. xanthus [14]. An M. xan-
thus mutant with a transposon insertion in crtIa is
unable to produce carotenoids, indicating an early role
in carotenogenesis. The crtIa insertion could have a
polar effect on the expression of downstream genes
[12]. To clarify the possible function of crtIa in the
carotenoid synthesis pathway, we generated an
Fig. 1. Schematic of the initial carotenoid biosynthesis pathway in
M. xanthus. The addition of an isopentenyl diphosphate unit (IPP)
to farnesyl diphosphate generates a GGPP molecule. The conden-

Host Strain
Genotype (Mx)
Plasmids (Ec)
Carotenoid content (lgÆg
)1
of protein)
a
Phytoene Phytofluene f-carotene Neurosporene Lycopene
Final carotenoids,
esterified
carotenoids Ref.
Mx DK1050
b
Wild-type 1260 100 40 40 90 1470 [11]
Mx MR151 carR3 1260 170 30 100 240 3800 [11]
Mx MR841 carR3, DcrtIa 9500 ND ND ND ND ND This study
Mx MR728 carR3, DcrtIb 8000 250 5 ND ND ND This study
Ec FD6 pFD6 800 260 40 ND ND ND This study
Ec FD9 pFD9 ND ND ND ND 640 ND This study
Ec FD100 pACCRT-EBP ND ND 5 ND ND ND This study
Ec FD101 pACCRT-EBP pMAR183 ND 6 16 80 40 ND This study
Ec FD102 pACCRT-EBP pFD39 ND ND 3 3 2 ND This study
Ec MR2301 pACCRT-EBI ND ND ND 120 ND ND This study
Ec FD103 pACCRT-EBI pMAR183 ND ND ND 250 ND ND This study
Ec FD104 pACCRT-EBI pFD39 ND ND ND ND 130 ND This study
a
The average of three or more independent determinations is given.
b
In the presence of light.
Fig. 2. carB–carA gene cluster and crtIb. The carB operon is transcribed by the light-inducible promoter P

ficial constitutive promoter Part-1-2. Strain FD6 was
grown in LB medium to stationary phase, and carote-
noids were purified from the cell extract and analyzed.
The absorption spectra of the extract showed the pres-
ence of all-trans-phytoene, phytofluene and f-carotene,
at decreasing concentrations (Table 1). Thus, CrtE,
CrtB and CrtIa are sufficient to carry out the synthesis
of phytoene, its isomerization, and the first two phyto-
ene dehydrogenation steps up to f-carotene produc-
tion. Similar results were obtained when crtIa was
coexpressed in E. coli with the crtE and crtB genes
from Rhodobacter (data not shown). This confirms that
CrtE and CrtB have GGPP and phytoene synthase
functions, respectively, and that CrtIa, besides its
isomerase activity, is responsible for the double dehy-
drogenation of phytoene up to f-carotene. CrtIa, how-
ever, seems unable to drive the rest of the desaturation
events that produce neurosporene and lycopene.
As mentioned above, crtIb is somehow required for
the dehydrogenation steps converting phytoene to lyco-
pene. However, the expression of crtIb in the E. coli
strain producing cis-phytoene, using the crtE and crtB
genes from Rhodobacter, did not transform the initial
cis-phytoene at all (data not shown). In order to deter-
mine the specific function of CrtIb, we analyzed the
carotenoids accumulated by an M. xanthus crtIb dele-
tion mutant, which also carries the carR3 mutation
(MR728) [16]. MR728 was shown to accumulate all-
trans-phytoene, phytofluene, and f-carotene, in decreas-
ing concentrations (Table 1). This pattern of carotene

tion steps necessary for lycopene formation. Moreover,
the exclusive accumulation of lycopene suggests some
kind of cooperation between both CrtI-type dehydro-
genases for the efficient processing of the partially
dehydrogenated intermediate substrates.
Different isomeric substrates for each
dehydrogenase
The requirement in M. xanthus for two CrtI-type pro-
teins to carry out the four dehydrogenation steps
involved in converting phytoene to lycopene is atypical
in the biogenesis of carotenoids. The precise dehydro-
genase activity of CrtIa and CrtIb could be due to dif-
ferential substrate recognition, based on the substrate
desaturation state, on its isomer conformation, or
both. To discriminate between these possibilities, we
expressed crtIa or crtIb in E. coli containing plasmid
pACCRT-EBP. This plasmid harbors the crtE and
crtB genes from Erwinia uredovora and the gene crtP
from the cyanobacterium Synechococcus PCC7942.
Carotene analysis of extract from E. coli with
pACCRT-EBP (FD100) identified cis-f-carotene as a
major carotene, and trace amounts of all-trans-f-caro-
tene and cis-phytoene [5]. The expression of crtIa in
this strain resulted in the accumulation of the four de-
hydrogenated phytoene derivatives phytofluene, f-caro-
tene, neurosporene, and lycopene (FD101 in Table 1).
On the other hand, the same strain expressing crtIb
produced f-carotene, neurosporene and lycopene, all in
low amounts, with no phytofluene being detected
(FD102 in Table 1). These data seem to indicate that

terol, dolichol, ubiquinone, coenzyme Q, isoprenoid
quinines, sugar carrier lipids, and carotenoids, are syn-
thesized by polyprenyl synthases in eukaryotic and
prokaryotic organisms. Two distinct types of evolu-
tionarily conserved prenyltransferases, CrtE and CrtB,
catalyze the early reactions of carotenoid biosynthesis
from farnesyl diphosphate to phytoene [2]. As pre-
dicted from sequence alignments [13], we report here
that the crtE and crtB genes from the M. xanthus carB
operon encode enzymes with GGPP and phytoene syn-
thase activity, respectively. After phytoene synthesis,
this carotene undergoes several desaturation events
(Fig. 4). In M. xanthus, an enzyme similar in sequence
to the CrtI-type phytoene dehydrogenases, previously
called CarC [11,14] and referred to here as CrtIb, was
shown to be involved in carotenoid biosynthesis. The
crtIb gene is not linked to the carotenogenic carB
operon, which contains a gene predicted to encode a
second phytoene dehydrogenase [13], referred here as
CrtIa. Interestingly, CrtIa is unable to catalyze the
four desaturations necessary for lycopene production
in the absence of CrtIb, and instead it leads to the
accumulation of the intermediates phytofluene and
f-carotene in decreasing amounts. On the other hand,
CrtIb is itself incapable of introducing any double
bonds into phytoene. We have demonstrated that a
unique collaboration between CrtIa and CrtIb is used
to successfully introduce four double bonds into phy-
toene. To our knowledge, this is the first case reported
where two CrtI-type desaturases function together to

trans-lycopene from cis-phytoene and the enzymes involved in dif-
ferent organisms, including M. xanthus.
Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al.
4310 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS
is thought to retain traces of the ancestral properties of
cyanobacteria [4].
The formation of b-carotene is one of the most com-
mon steps in the synthesis of carotenoids. It requires the
cyclization of lycopene to ionone end-groups. Lycopene
in the cis conformation cannot be cyclized, due to its
steric arrangement, and therefore it must be synthesized
in the all-trans configuration, or be converted to that
form [1,21]. In organisms that use Pds ⁄ CrtP-type and
Zds ⁄ CrtQ-type desaturases, where the dehydrogenation
steps are performed on carotenes in the cis confor-
mation, the final isomerization from cis-lycopene to
all-trans-lycopene is performed by a CrtI-type enzyme
called CrtISO in algae and plants, and CrtH in cyano-
bacteria [21–24] (Fig. 4). cis-to-trans isomerization can
be also enhanced by light [5,25,26]. However, in all
organisms that use a CrtI-type desturase, the cis-to-
trans isomerization is associated with the desaturation
processes producing trans-phytoene [6,27,28] (Fig. 4).
In the case of Anabaena, the cis-to-trans isomerization
is carried out on f-carotene, instead of on phytoene, by
its CrtI-type f-carotene dehydrogenase [5]. It is not clear
why two different biosynthetic pathways for lycopene
exist in nature. The discovery of the biosynthetic
enzymes CrtP, CrtQ and CrtH in the green sulfur bacte-
rium Clorobium tepidum, an obligate photoautotroph,

bound to f-carotene. The idea of a linear assembly
chain for carotenoid synthesis was proposed years ago,
on the basis of work with the fungus Phycomyces
blakesleeanus [30,31].
Why M. xanthus uses two CrtI-type desaturases for
the dehydrogenation of phytoene to lycopene is cer-
tainly an unanswered question. One possibility is that
having two unlinked desaturase genes provides more
regulatory options. The crtIa gene is inserted in the
carB operon, which is driven by a light-activated pro-
moter [15]. The expression of crtIb is also activated by
light, but through a tight mechanism that operates
only when the cells have reached the stationary phase
or are starved of a carbon source [14]. This may have
advantages if carotenoids are synthesized only when
needed, in stationary phase but not before, leaving the
isoprenoid components for metabolic uses in the
growth phase. In the presence of light, the carotenoid
biosynthetic machinery would be present but blocked,
waiting for the last enzymatic element, CtrIb, which
reaches a very high level soon after the cell’s entrance
into the stationary phase [14]. This scenario would be
possible if, in the course of the evolution, CrtIa lost its
capacity to perform the two final desaturation steps of
the four catalyzed by a typical CrtI-type enzyme, and
these activities were taken over by a second desaturase,
CrtIb. An obvious idea is that the crtIb gene arose by
duplication of the original, single M. xanthus crtI gene.
However, the CrtIb protein is more closely related
(46% identity) to the f-carotene desaturase from

cloned into plasmid pDAH160 [39], which carries a kana-
mycin resistance gene and the incompatibility region of P1
for transferring the plasmid from E. coli to M. xanthus
by P1-specialized transduction. The resulting plasmid,
pMAR164, was transduced into M. xanthus MR151, where
it integrated by homologous recombination to generate a
kanamycin-resistant merodiploid. We grew this merodiploid
in CTT without kanamycin to allow a second recombina-
tion event that causes the loss of the kanamycin resistance
marker, generating kanamycin-sensitive colonies, either with
a wild-type crtIa or with the crtIa deletion. The presence of
this deletion was confirmed by Southern blot analysis using
as a template a 4.3 kb RcaI-digested fragment from
pMAR161, and M. xanthus genomic DNA digested with
NcoI. The strain with the crtIa deletion was named
MR841.
To make plasmid pFD3, a DNA fragment bearing crtE,
crtIa, and crtB, which also includes the ribosomal-binding
site upstream of crtE, was PCR-amplified using pMAR161
as template and the oligonucleotides ORF1-3 (5¢-GGT
TCTTCGGAGGAAAGACATATGGCACTCACGCTTCC
C-3¢) and ORF3-2 (5¢-CCGAAGCTCCGTCTAGATTCC
CTCGCCACGC-3¢) as primers. The fragment was digested
by NdeI and XbaI, and cloned into the expression vector
pUC19 [40]. An artificial constitutive-expression promoter,
Part-1-2, was inserted just before crtE in plasmid pFD3,
generating plasmid pFD6 and strain FD6. This promoter
was generated by hybridization of two complementary oli-
gonucleotides, Part-1 (5¢-AGCTTGACAGGCCGGAATAT
TTCCCTATAATGCGCTGCA-3¢) and Part-2 (5¢-GCG

template, and CRTI-3 (5¢-GTGGGATTCCGTTCATCGA
TATACCGGAGGGCC-3¢) and CRTI-2 as primers. After
digestion by ClaI and BamHI, this fragment was cloned
into vector pACYC184 [43], to create plasmid pFD24. An
artificial constitutive-expression promoter, Par-5-6, was
inserted just before crtIb in plasmid pFD24, generating
plasmid pFD26. The Part-5-6 promoter was generated
by hybridization of two complementary oligonucleotides,
Part-5 (5¢-CTAGATTGACAGGCCGGAATATTTCCCTA
TAATGCGCAT-3¢) and Part-6 (5¢-CGATGCGCATTAT
AGGGAAATATTCCGGCCTGTCAAT-3¢), which con-
tain, like the Part-1-2 promoter, the E. coli RNA polymer-
ase r
70
consensus binding site, and was cloned in vectors
digested with XbaI and BamHI. Plasmid pFD26 was
digested by XbaI and BamHI, and the Part-5-6-crtIb frag-
ment was cloned into vector pBJ114 [44], resulting in plas-
mid pFD39.
Carotenoid extraction and analysis
E. coli was grown in LB medium to stationary phase, and
1 mL of this culture was inoculated into 100 mL of LB
medium and incubated at 37 °C for 12 h. FD100, FD101
and FD102 E. coli strains were supplemented with isopro-
pyl thio-b-d-galactoside (0.5 mm) to increase expression of
crtP, and incubated at 28 °C for 48 h [5]. In the case of
M. xanthus, 100 mL of CTT was inoculated with 1 mL of
culture in stationary phase, and incubated at 33 °C until
this culture reached stationary phase. Additional experi-
mental procedures were identical for all cultures. A 1.5 mL

for their analysis. All manipulations of carotenoids were
carried out in the dark at 4 °C. The same carotenes were
always detected in various independent analyses of the
same strain, although some quantitative differences were
observed, particularly in the heterologous expression
experiments.
Acknowledgements
We thank Jose
´
A. Madrid for technical assistance, and
Dr Gerhard Sandmann and Dr Agustı
´
n Vioque for
providing plasmids and strains. This work was
supported by the Spanish Ministerio de Educacio
´
n
y Cultura (grant PB96-1096 and fellowship to
M. Cervantes), Ministerio de Ciencia y Tecnologı
´
a
(grant BMC2000-1006), and Fundacio
´
nSe
´
neca (fellow-
ship to M. Cervantes).
References
1 Sandmann G (2002) Molecular evolution of carotenoid
biosynthesis from bacteria to plants. Physiol Plant 116,

for carotenogenesis in Myxococcus xanthus. J Bacteriol
97, 1165–1168.
10 Moraleda-Munoz A, Perez J, Fontes M, Murillo FJ &
Munoz-Dorado J (2005) Copper induction of carotenoid
synthesis in the bacterium Myxococcus xanthus. Mol
Microbiol 56, 1159–1168.
11 Martinez-Laborda A, Balsalobre JM, Fontes M &
Murillo FJ (1990) Accumulation of carotenoids in struc-
tural and regulatory mutants of the bacterium Myxococ-
cus xanthus. Mol Gen Genet 223, 205–210.
12 Ruiz-Vazquez R, Fontes M & Murillo FJ (1993) Clustering
and co-ordinated activation of carotenoid genes in Myxo-
coccus xanthus by blue light. Mol Microbiol 10, 25–34.
13 Botella JA, Murillo FJ & Ruiz-Vazquez R (1995) A
cluster of structural and regulatory genes for light-
induced carotenogenesis in Myxococcus xanthus. Eur
J Biochem 233, 238–248.
14 Fontes M, Ruiz-Vazquez R & Murillo FJ (1993)
Growth phase dependence of the activation of a bacte-
rial gene for carotenoid synthesis by blue light. EMBO
J 12, 1265–1275.
15 Balsalobre JM, Ruiz-Vazquez RM & Murillo FJ (1987)
Light induction of gene expression in Myxococcus
xanthus. Proc Natl Acad Sci USA 84, 2359–2362.
16 Martinez-Argudo I, Ruiz-Vazquez RM & Murillo FJ
(1998) The structure of an ECF-sigma-dependent, light-
inducible promoter from the bacterium Myxococcus
xanthus. Mol Microbiol 30 , 883–893.
17 Armstrong GA (1997) Genetics of eubacterial caroten-
oid biosynthesis: a colorful tale. Annu Rev Microbiol 51,

isomerase provides insight into carotenoid biosynthesis,
prolamellar body formation, and photomorphogenesis.
Plant Cell 14, 321–332.
25 Breitenbach J & Sandmann G (2005) zeta-carotene cis
isomers as products and substrates in the plant poly-cis
carotenoid biosynthetic pathway to lycopene. Planta
220, 785–793.
26 Giuliano G, Giliberto L & Rosati C (2002) Carotenoid
isomerase: a tale of light and isomers. Trends Plant Sci
7, 427–429.
27 Breitenbach J, Braun G, Steiger S & Sandmann G
(2001) Chromatographic performance on a C30-bonded
stationary phase of monohydroxycarotenoids with
variable chain length or degree of desaturation and of
lycopene isomers synthesized by various carotene
desaturases. J Chromatogr A 936, 59–69.
28 Sandmann G (2001) Carotenoid biosynthesis and
biotechnological application. Arch Biochem Biophys 385,
4–12.
29 Heathcote P (2001) Type I photosynthetic reaction
centres. Biochim Biophys Acta 1507, 1–2.
30 Aragon CM, Murillo FJ, de la Guardia MD &
Cerda-Olmedo E (1976) An enzyme complex for the
dehydrogenation of phytoene in Phycomyces. Eur J
Biochem 63, 71–75.
31 De la Guardia MD, Aragon CM, Murillo FJ & Cerda-
Olmedo E (1971) A carotenogenic enzyme aggregate in
Phycomyces: evidence from quantitive complementation.
Proc Natl Acad Sci USA 68, 2012–2015.
32 Hanahan D (1983) Studies on transformation of

analysis of Escherichia coli promoter DNA sequences.
Nucleic Acids Res 11, 2237–2255.
42 Glaser G, Sarmientos P & Cashel M (1983) Functional
interrelationship between two tandem E. coli ribosomal
RNA promoters. Nature 302, 74–76.
43 Chang AC & Cohen SN (1978) Construction and
characterization of amplifiable multicopy DNA cloning
vehicles derived from the P15A cryptic miniplasmid.
J Bacteriol 134, 1141–1156.
44 Julien B, Kaiser AD & Garza A (2000) Spatial control
of cell differentiation in Myxococcus xanthus. Proc Natl
Acad Sci USA 97, 9098–9103.
45 Davies BH (1976) Carotenoids. In Chemistry and
Biochemistry of Plant Pigments, 2nd edn (Goodwin TW,
ed.), pp. 38–165. Academic Press, London.
46 Herber R, Maudinas B, Villoutreix J & Granger P
(1972) The formation of all-trans-phytoene in Mucor
hiemalis. Biochim Biophys Acta 280, 194–202.
Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al.
4314 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS