Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot - Pdf 11

Concerted mutation of Phe residues belonging
to the b-dystroglycan ectodomain strongly inhibits the
interaction with a-dystroglycan in vitro
Manuela Bozzi
1,
*, Francesca Sciandra
2,
*, Lorenzo Ferri
2
, Paola Torreri
3
, Ernesto Pavoni
2
,
Tamara C. Petrucci
3
, Bruno Giardina
2
and Andrea Brancaccio
2
1 Istituto di Biochimica e Biochimica Clinica, Universita
`
Cattolica del Sacro Cuore, Rome, Italy
2 CNR, Istituto di Chimica del Riconoscimento Molecolare c ⁄ o Istituto di Biochimica e Biochimica Clinica, Universita
`
Cattolica del Sacro
Cuore, Rome, Italy
3 Dipartimento di Biologia Cellulare e Neuroscienze, Istituto Superiore di Sanita
`
, Rome, Italy
Dystroglycan (DG) is an adhesion molecule composed

between the extracellular matrix and the cytoskeleton in a wide variety of
tissues. Abnormal membrane targeting of dystroglycan subunits and⁄ or
their aberrant post-translational modification are often associated with
several pathologic conditions, ranging from neuromuscular disorders to
carcinomas. A putative functional hotspot of dystroglycan is represented
by its intersubunit surface, which is contributed by two amino acid stret-
ches: approximately 30 amino acids of b-dystroglycan (691–719), and
approximately 15 amino acids of a-dystroglycan (550–565). Exploiting
alanine scanning, we have produced a panel of site-directed mutants of
our two consolidated recombinant peptides b-dystroglycan (654–750),
corresponding to the ectodomain of b-dystroglycan, and a-dystroglycan
(485–630), spanning the C-terminal domain of a-dystroglycan. By solid-
phase binding assays and surface plasmon resonance, we have determined
the binding affinities of mutated peptides in comparison to those of wild-
type a-dystroglycan and b-dystroglycan, and shown the crucial role of two
b-dystroglycan phenylalanines, namely Phe692 and Phe718, for the a–b
interaction. Substitution of the a-dystroglycan residues Trp551, Phe554
and Asn555 by Ala does not affect the interaction between dystroglycan
subunits in vitro. As a preliminary analysis of the possible effects of the
aforementioned mutations in vivo, detection through immunofluorescence
and western blot of the two dystroglycan subunits was pursued in dystro-
glycan-transfected 293-Ebna cells.
Abbreviations
DG, dystroglycan; DGC, dystroglycan–glycoprotein complex; EGFP, enhanced green fluorescent protein; SPR, surface plasmon
resonance.
FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4929
a-DG and b-DG. a-DG is a highly glycosylated per-
ipheral membrane protein that interacts with several
extracellular matrix proteins such as laminin, perlecan
and agrin [2]. b-DG spans the membrane and binds

was recently obtained by a crystallographic analysis
carried out on a murine a-DG N-terminal fragment,
and revealed the presence of two autonomous modules
connected by a long and flexible linker. The N-terminal
module shows Ig-like folding, whereas the C-terminal
module appears to be very similar to the ribosomal
RNA-binding proteins [12]. The only structural hints
concerning the C-terminal domain of a-DG come from
a sequence alignment approach, which has shown some
similarities with cadherin domains [13].
Previous studies, carried out employing a series of
independent techniques such as IR, CD [14] and NMR
spectroscopy [15], have revealed the absence of any
classic secondary structural element in the recombinant
b-DG ectodomain, which shows high conformational
plasticity, typical of a natively unfolded protein.
The noncovalent interaction between the two DG
subunits occurs between the C-terminal region of
a-DG and the N-terminal ectodomain of b-DG, and is
apparently independent of glycosylation [16]. Solid-
phase binding assays, performed with recombinant
fragments corresponding to the C-terminal domain of
a-DG harboring progressive deletions, have shown
that the b-DG-binding epitope resides between amino
acids 550 and 585 [17], and further NMR analysis has
narrowed this location to amino acids 550–565 [18]. In
addition, extensive NMR structural characterization
of our
15
N ⁄

[
15
N]b-DG(654–750) with thioredoxin-a-DG(485–620)
[15]. Therefore, we decided to mutate it to an alanine,
together with two other phenylalanines, Phe692 and
Phe700, the only other aromatic residues located
within the a-DG-binding epitope that are highly con-
served in all the species so far analyzed. A more dras-
tic alteration of the protein primary structure
was produced by deleting six amino acids, located
within the a-DG-binding epitope, between positions
701 and 706. A previous NMR characterization of the
b-DG ectodomain [15] revealed that the amino acids
between positions 701 and 704 are so flexible as to be
undetectable under the experimental conditions used
Mutagenesis at the a–b dystroglycan interface M. Bozzi et al.
4930 FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS
for NMR analysis. We believed that it would be inter-
esting to verify whether such a flexible amino acid
stretch, located within the a-DG-binding epitope,
might play a role in the interaction between the a-DG
and b-DG subunits. Three additional mutations were
introduced outside the putative a-DG-binding epitope
to check whether perturbing the b-DG ectodomain
elsewhere might also influence its interaction with
a-DG. We produced two mutations upstream of the
a-DG-binding epitope, such as Trp659 fi Ala, because
Trp659 is the only aromatic residue in this portion of
the protein, and Glu667 fi Ala; only one mutation,
Val736 fi Ala, was generated within the C-terminal

b-DG(654–750)
D(701)706)
, were biotinylated and used as
soluble ligand at increasing concentrations (up to 20 lm).
The apparent affinity for a-DG(485–630), exhibited
by the mutants b-DG(654–750)
Glu667 fi Ala
and
b-DG(654–750)
Val736 fi Ala
and evaluated by solid-phase
binding assays, was very similar to that displayed by
b-DG(654–750) (Fig. 2A, Table 1), whereas all the other
single mutants, namely b-DG(654–750)
Trp659 fi Ala
,
b-DG(654–750)
Phe692 fi Ala
, b-DG(654–750)
Phe700 fi Ala
and b-DG(654–750)
Phe718 fi Ala
, showed reduced affinity
for a-DG(485–630) (Fig. 2B). Also, the deletion mutant
b-DG(654–750)
D(701)706)
was able to bind a-DG(485–
630) with the same affinity as the wild type, demonstra-
ting that the highly flexible stretch corresponding to
positions 701–706 is not involved in the interaction with

and using a-DG(485–630) as analyte (K
D
2.73 lm)
(Table 1, Supplementary Fig. S1), was fully compar-
able to the value obtained when a-DG(485–630) was
immobilized and b-DG(654–750) was used as analyte
(K
D
2.66 lm) (Table 1). The thermodynamic constant
K
D
was also measured for the interaction between the
wild-type recombinant fragment a-DG(485–630) and
the mutant b-DG(654–750)
Phe700 fi Ala
, and confirmed
its reduced affinity for a-DG(485–630) with respect to
the wild type (K
D
7.00 lm; Table 1).
The kinetic SPR profiles obtained for all the
single mutants b-DG(654–750)
Phe692 fi Ala
, b-DG(654–
Fig. 1. A panel of mutations hitting the reciprocal a-DG–b-DG bind-
ing epitopes was generated. In the C-terminal region of a-DG,
between amino acids 550 and 565, Trp551, Phe554 and Asn555
were mutated to alanine. In the a-DG-binding epitope comprising
residues 691–719 of the b-DG ectodomain, the mutations
Phe692 fi Ala, Phe700 fi Ala and Phe718 fi Ala were generated

amino acid stretch that is likely to be involved in the
A
B
C
Fig. 2. Solid-phase binding assays. a-DG(485–630) was immobilized
on plates, whereas b-DG(654–750) (black) and its mutants
b-DG(654–750)
Glu667 fi Ala
(blue), b-DG(654–750)
Val736 fi Ala
(red),
b-DG(654–750)
D(701)706)
(green) (A), b-DG(654–750)
Trp659 fi Ala
(magenta), b-DG(654–750)
Phe692 fi Ala
(green), b-DG(654–
750)
Phe700 fi Ala
(blue), b-DG(654–750)
Phe718 fi Ala
(yellow) (B),
b-DG(654–750)
Phe692 fi Ala ⁄ Phe718 fi Ala
(cyan), and b-DG(654–
750)
Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala
(red) (C), were used as biot-
inylated ligands. Every point is an average of three or more inde-

(lM)
a-DG
wt
⁄ b-DG
wt
2.8 ± 0.9 (9)
a-DG
wt
⁄ b-DG
Glu667 fi Ala
3.5 ± 0.9 (3)
a-DG
wt
⁄ b-DG
D(701–706)
2.9 ± 0.8 (3)
a-DG
wt
⁄ b-DG
Val736 fi Ala
2.9 ± 2 (4)
a-DG
wt
⁄ b-DG
Trp659 fi Ala
ND (10)
a-DG
wt
⁄ b-DG
Phe692 fi Ala

2.3 ± 0.9 (5)
a-DG
Asn555 fi Ala
⁄ b-DG
wt
1.5 ± 0.8 (6)
a-DG
Trp551 fi Ala ⁄ Phe554 fi Ala
⁄ b-DG
wt
2.4 ± 0.7 (3)
(B) SPR
Immobilized protein ⁄ analyte K
D
(lM)
a-DG
wt
⁄ b-DG
wt
2.66
b-DG
wt
⁄ a-DG
wt
2.73
a-DG
wt
⁄ b-DG
Phe700 fi Ala
7.00

ther confirm that residues Trp551, Phe554 and Asn555
are not involved in the interaction with b-DG, the
affinities of some b-DG mutants for the mutants
a-DG(485–630)
Trp551 fi Ala
, a-DG(485–630)
Phe554 fi Ala
and a-DG(485–630)
Asn555 fi Ala
were also estimated
by solid-phase binding assays. The affinities of
b-DG(654–750)
Trp659 fi Ala
, b-DG(654–750)
Phe692 fi Ala
,
b-DG(654–750)
Phe700 fi Ala
, b-DG(654–750)
Phe718 fi Ala
and b-DG(654–750)
Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala
for immobilized a-DG mutants were very similar to
the reduced affinity exhibited for wild-type a-DG(485–
630), indicating that the effect measured can be
ascribed to the mutations within the b-DG ectodomain
(data not shown). Interestingly, a western blot experi-
ment showed that Trp551, Phe554 and Asn555 are also
not likely to be key residues for the interaction with
the mAb sx ⁄ 3 ⁄ 50 ⁄ 25 directed against the b-DG-bind-

(h) and using biotinylated b-DG(654–750) as soluble
ligand, in the presence (empty symbols) and in the absence (full
symbols) of mAb sx ⁄ 3 ⁄ 50 ⁄ 25.
Fig. 3. SPR kinetic profiles of the interaction between immobilized
a-DG(485–630) and b-DG(654–750) (black) and its mutants,
b-DG(654–750)
Phe692 fi Ala
(green), b-DG(654–750)
Phe700 fi Ala
(blue),
b-DG(654–750)
Phe718 fi Ala
(yellow), b-DG(654–750)
Phe692–Ala ⁄ Phe718 fi Ala
(cyan), used as analytes at a fixed concentration of 10 lM.
M. Bozzi et al. Mutagenesis at the a–b dystroglycan interface
FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4933
Transfection of 293-Ebna cells with wild-type and
mutated DG constructs
In order to verify the correct membrane targeting
of mutated DG, DNA constructs spanning the entire
DG gene, including its signal peptide, and carrying
the mutations analysed in vitro, such as Trp551 fi
Ala, Phe554 fi Ala, Asn555 fi Ala, Glu667 fi Ala,
Phe692 fi Ala, Phe700 fi Ala, Phe718 fi Ala,
Phe692 fi Ala ⁄ Phe718 fi Ala and Val736 fi Ala,
were included in an appropriate mammalian expression
vector and then transfected into human 293-Ebna cells.
The cytomegalovirus promoter drives the efficient tran-
scription of the DG exogenous gene, which was

, respectively, to be used as a control
(Fig. 6).
EGFP increases the molecular mass of b-DG
by 25 kDa, allowing us to distinguish between the
B
Fig. 5. (Continued).
M. Bozzi et al. Mutagenesis at the a–b dystroglycan interface
FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4935
exogenous b-DG and the endogenous b-DG in western
blot experiments. Western blot analysis carried out on
total protein extracts from 293-Ebna cells transiently
transfected with wild-type and mutated (Phe554 fi Ala
or Phe692 fi Ala ⁄ Phe718 fi Ala) DG genes did not
show any aberrant processing or glycosylation patterns
of DG. Although lower expression of a-DG was
detected in all transfected cells (including those
transfected with empty pEGFP or wild-type pDG–
EGFP; Fig. 7A), the amount of a-DG in the cells
transfected with the double-mutated (Phe692 fi Ala ⁄
Phe718 fi Ala) DG construct was similar to that
measured in wild-type DG-transfected cells (Fig. 7).
Discussion
In vitro inhibition of the a-DG–b-DG interaction
via Phe to Ala mutations within the ectodomain
of b-DG
We investigated the interaction between a-DG and
b-DG recombinant peptides carrying a series of site-
directed mutations. We performed amino acid substitu-
tions using alanine, because this residue does not show
any propensity for a specific secondary structure, and

relatively extended region of approximately 30 amino
acids, between positions 691 and 719 [15]. In order to
obtain a deeper insight into the a–b interface, we have
introduced a series of mutations within the b-DG ecto-
domain located in three different protein regions:
AB
DC
Fig. 6. 293-Ebna cells transiently
transfected with the vector pEGFP, empty
(A) or containing DNA constructs
corresponding to wild-type DG (B) and its
mutants DG
Phe554 fi Ala
(C) and
DG
Phe692 fi Ala ⁄ Phe718 fi Ala
(D), where
enhanced green fluorescent protein
(EGFP) was fused at the C-terminus of
b-DG. All the images are magnified 10·.
EGFP alone was uniformly distributed
throughout the cytoplasm, whereas
DG–EGFP and its two mutants were mostly
localized around the cellular periphery. In
order to better visualize the DG complex
location at the cellular periphery, a 40·
magnified image was obtained referring to
wild-type DG–EGFP, which clearly
shows the membrane targeting of
the chimeric wild-type DG–EGFP

for a-DG(485–630); the double and triple mutants,
such as b-DG(654–750)
Phe692 fi Ala ⁄ Phe718 fi Ala
and
b-DG(654–750)
Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala
are
completely unable to bind a-DG(485–630).
The behavior of b-DG(654–750)
Glu667 fi Ala
and
b-DG(654–750)
Val736 fi Ala
is not surprising, as these
point mutations are located upstream and downstream
of the a-DG-binding epitope, respectively, in por-
tions of the protein that are not involved in the forma-
tion of the a–b interface [15]. However, this simple
argument cannot be applied to explain the reduced
affinity for a-DG(485–630) shown by the mutant
b-DG(654–750)
Trp659 fi Ala
, whose amino acid substitu-
tion is located upstream of the a-DG-binding epitope.
A possible interpretation of this result can be sugges-
ted on the basis of previous studies showing that the
recombinant fragment b-DG(654–750) is organized
into an N-terminal region, consisting of approximately
70 amino acids, which is characterized by restricted
conformational mobility, and a highly flexible C-ter-

wt
–a-DG(485–630)
interaction and the b-DG(654–750)
D(701)706)
–a-
DG(485–630) interaction, as measured by solid-phase
binding assays (Table 1). It should be noted that the
choice to delete these specific amino acids (701–706) is
based on the observation that the residues between
positions 701 and 704, although belonging to the
region of restricted mobility, are so flexible to be unde-
tectable under the experimental conditions used for
NMR experiments [15].
The stretch 701–706 may be part of a flexible linker
that could bring two separate regions of the a-DG-
binding epitope (carrying Phe692 and Phe718, respect-
ively) closer to each other when they bind a-DG.
Apparently, deleting the amino acid stretch 701–706
has no effect on the a–b interaction, so it is likely
that the knock-in does not significantly alter the
spatial distance between the two important phenyl-
alanines.
A
B
Fig. 7. Immunoblot of total protein extracts from 293-Ebna cells
nontransfected (lane 1) or transfected with the empty pEGFP
vector (lane 2), or containing DG–EGFP (lane 3) and its mutants
DG
Phe554 fi Ala
–EGFP (lane 4) and DG

Asn555 fi Ala
and a-DG(485–
630)
Trp551 fi Ala ⁄ Phe554 fi Ala
for b-DG(654–750), com-
pared to wild-type a-DG(485–630), was measured by
solid-phase binding assays (Supplementary Fig. S2). It
should be pointed out that our previous NMR experi-
ments showed that a-DG residues Trp551, Phe554 and
Asn555, among others, were significantly influenced by
the presence of b-DG(654–750) at the level of the pro-
tein backbone (i.e. at their NH and CHa), although at
that time no data were collected on their side chains,
which therefore could be substantially unaffected by
b-DG binding [18], as is now strongly suggested by the
results herein presented.
A possible implication of our results is that the
specificity of a-DG(485–630) binding to b-DG(654–
750) could depend mainly on its local conformation
and only to a lesser extent on the chemical nature
of the amino acid side chains involved in the bind-
ing. To further analyze this hypothesis, it will be
necessary to introduce, within residues 550–565 of
a-DG, amino acids that require stringent steric con-
straints, such as proline or isoleucine, which may
significantly perturb the local structural characteris-
tics of the b-DG-binding epitope. Interestingly, the
amino acid substitutions that we analyzed do not
impair binding to a monoclonal antibody, mAb
sx ⁄ 3 ⁄ 50 ⁄ 25, as suggested by the western blot in

293-Ebna cells with the full-length murine DG gene
harboring the mutations Trp551 fi Ala, Phe554 fi Ala,
Asn555 fi Ala, Glu667 fi
Ala, Phe692 fi Ala,
Phe700 fi Ala, Phe718 fi Ala, Val736 fi Ala and
Phe692 fi Ala ⁄ Phe718 fi Ala. Cell-staining experi-
ments showed that none of these mutations significantly
affects the subcellular trafficking and plasmalemmal tar-
geting of exogenous murine DG in transfected human
293-Ebna cells (Fig. 5). In fact, all the mutants were
overexpressed, and a strong fluorescent signal was detec-
ted at the plasmalemma, exploiting a monoclonal anti-
body directed against the cytoplasmic tail of b-DG.
Apparently, even the double mutation Phe692 fi Ala ⁄
Phe718 fi Ala, which greatly impairs binding between
the two DG subunits in vitro, has no evident effect on
the plasmalemmal targeting of b-DG (Fig. 5B). The cor-
rect membrane targeting of DG was also confirmed by
the immunodetection of the a-subunit in human cells
transfected with all the mutants (Fig. 5A). In order to
further analyze possible effects of the double mutation
Phe692 fi Ala ⁄ Phe718 fi Ala in vivo, we also cloned
the mutant DG
Phe692 fi Ala ⁄ Phe718 fi Ala
within the pEG-
FP vector, together with wild-type DG and the mutant
DG
Phe554 fi Ala
as controls (Fig. 6). Western blot analy-
sis of total protein extracts from 293-Ebna cells, transi-

myotubes infected with deleted mutants of the
DG gene [36]. It was proposed that the low-affinity
interaction between a-DG and b-DG serves to dissoci-
ate the two subunits, which can independently play
distinct roles by interacting with other proteins [36].
Further experiments will be carried out to identify
which additional extracellular or membrane proteins
may stabilize the membrane localization of a-DG.
Moreover, it will be interesting to determine whether
the mutations at the a-DG–b-DG interface may influ-
ence cellular functions such as proliferation, adhesion
and motility, by analyzing transfected cells for more
than 24 h after transfection. These latter issues might
be particularly relevant when considering the specific
role played by the DG complex at the cell–basement
membrane interface and ⁄ or in mediating cellular signa-
ling in pathologic conditions such as dystrophies or
even carcinogenesis [37].
Experimental procedures
DNA manipulation
The full-length cDNA encoding for murine DG [16] was
used as a template to generate by PCR two DNA
constructs, one corresponding to the N-terminal region
of b-DG, b-DG(654–750), and the other to the C-terminal
region of a-DG, a-DG(485–630) [17]. Appropriate primers
were used to amplify the DNA sequences of interest:
for b-DG(654–750), forward 5¢-CCCGGATCCTCTATCG
TGGTGGAATGGACCAACA-3¢ and reverse 5¢-CCCGA
ATTCTTAGTAAACATCGTCCTCACTGCTCTCTTC-3¢
(BamHI and EcoRI restriction sites in bold); for

Trp659 fi Ala
,
b-DG(654–750)
Glu667 fi Ala
, b-DG(654–750)
Phe692 fi Ala
, b-
DG(654–750)
Phe700 fi Ala
, b-DG(654–750)
Phe718 fi Ala
, b-
DG(654–750)
Val736 fi Ala
and b-DG(654–750)Phe692 fi
Ala ⁄ Phe718 fi Ala, were amplified by PCR using the
megaprimer technique, with the wild-type b-DG(654–750)
DNA construct as a template and appropriate primers.
For b-DG(654–750)
Trp659 fi Ala
, b-DG(654–750)
Glu667 fi Ala
,
b-DG(654–750)
Phe692 fi Ala
and b-DG(654–750)
Phe700 fi Ala
,
the b-DG(654–750) forward primer was used together with
different reverse primers for the first PCR (mutated nucleo-

, the b-DG(654–750)
forward primer and the reverse primer, 5¢-TCAGAGCCT
TAGCGTCAGGCTCCAG-3¢ (Phe700 fi Ala), were used
for the first PCR, and the b-DG(654–750)Phe692 fi
Ala ⁄ Phe718 fi Ala DNA construct was used as a template.
The megaprimer obtained was used as forward primer
together with the b-DG(654–750) reverse primer for the
second PCR, and the b -DG(654–750)
Phe692 fi Ala ⁄ Phe718 fi Ala
DNA construct was used as a template. For the pro-
duction of the b-DG(654–750)
D(701)706)
mutant, gene spli-
cing by overlap extension method was used, with 5¢-GCT
CTGGAGCCTGACTTTGTGACGGGCTCTGGC-3¢ and
M. Bozzi et al. Mutagenesis at the a–b dystroglycan interface
FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4939
5¢-AAAGTCAGGCTCCAGAGCATTGGAG-3¢ as forward
and reverse primers, respectively. The presence of muta-
tions was confirmed by automated sequencing of DNA
constructs.
Protein expression, purification and biotinylation
The DNA constructs obtained were purified and cloned
into a bacterial vector that was appropriate for expression
of the protein as a thioredoxin fusion product, also con-
taining an N-terminal 6His tag and a thrombin cleavage
site [38]. The recombinant fusion proteins were expressed in
Escherichia coli BL21(DE3) Codon Plus RIL strain and
purified using nickel affinity chromatography. The frag-
ments of interest were obtained upon thrombin cleavage.

Na
2
HPO
4
, 140 mm NaCl, pH 7.4) containing 0.05% (v ⁄ v)
Tween-20, 1.25 mm CaCl
2
and 1 mm MgCl
2
, wells were
incubated with decreasing concentrations of recombinant
biotinylated constructs, b-DG(654–750) and its mutants, in
NaCl ⁄ P
i
containing 0.05% (v ⁄ v) Tween-20, 3% (w ⁄ v) BSA,
1.25 mm CaCl
2
and 1 mm MgCl
2
for 3 h at room tempera-
ture. After washing, the biotinylated b-DG(654–750) bound
fraction was detected with alkaline phosphatase Vectastain
AB Complex (Vector Laboratories, Burlingame, CA, USA).
A solution was prepared dissolving five milligrams of
p-nitrophenyl phosphate in 10 mL of 10 mm diethanol-
amine and 0.5 m MgCl
2
. 100 lL of this solution was used
as a substrate for the reaction with alkaline phosphatase,
and absorbance values were recorded at 405 nm. For each

i
) A
0
) ⁄ (A
sat
) A
0
) and reported as fractional sat-
uration (%). For b-DG(654–750) mutants that displayed a
significant reduction of their binding affinity, data could
not be fitted according to this equation, and were normal-
ized by setting the maximal binding of the control wild-type
b-DG(654–750), extrapolated by the fitting, as 100%.
SPR experiments
The kinetic parameters, association rate constant (k
on
) and
dissociation rate constant (k
off
), were determined using the
BIAcoreX system (Uppsala, Sweden) for SPR detection.
a-DG or b-DG recombinant fragments were immobilized
by covalently coupling the proteins to CM-5 sensor chips
as previously described [29]. Experiments were performed in
HBS (10 mm Hepes, 0.15 m NaCl, 0.005% (v ⁄ v) surfactant
P20, pH 7.4) with a flow rate of 30 lLÆmin
)1
. The analyte
(b-DG or a-DG) was applied in the concentration ranges
of 2.5–40 lm and 1.2–20 lm, respectively. The response

ratio k
off
⁄ k
on
, was calculated using the biaevaluation soft-
ware. Residuals from the single-site binding model indicate
an excellent fit (v
2
< 2).
DNA manipulation for transfection of eukaryotic
cells
A DNA fragment corresponding to the whole murine DG
sequence, including its signal peptide, was amplified from
C2C12 muscle cells and cloned into the pcDNA3 expression
vector under the CMV strong promoter (Invitrogen, Carls-
bad, CA, USA) as previously described [19], yielding the
construct pcDNA3
DG
. The QuikChange site-directed
Mutagenesis at the a–b dystroglycan interface M. Bozzi et al.
4940 FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS
mutagenesis kit (Stratagene, La Jolla, CA, USA) was used
to create mutations in the DG gene; all constructs were
verified by automated sequencing. The primers used for
mutagenesis are reported in Table 2 with mutated codons
underlined.
The double mutant DG
Phe692 fi Ala ⁄ Phe718 fi Ala
was gen-
erated using the DNA construct corresponding to

i
containing 3%
(w ⁄ v) BSA. For intracellular staining, cells were permeabi-
lized with NaCl ⁄ P
i
containing 0.1% (w ⁄ v) saponin and 3%
(w ⁄ v) BSA (permeabilization buffer) for 30 min, and then
incubated overnight with a monoclonal antibody directed
against the b-DG cytoplasmic tail (Novocastra, Newcastle,
UK) diluted 1 : 100 in permeabilization buffer. Cells were
then incubated with 10 lgÆmL
)1
fluorescent secondary anti-
body labeled with isothiocyanate (FITC) (Vector Laborat-
ories) for 1 h at room temperature. Preparations were
mounted with Vectashield (Vector Laboratories) and
observed under a fluorescence microscope (Nikon, Tokyo,
Japan).
About 20 lg of the empty pEGFP vector, or containing
DNA constructs corresponding to wild-type DG or
its mutants DG
Phe554 fi Ala
and DG
Phe692 fi Ala ⁄ Phe718 fi Ala
,
was used to transfect 293-Ebna cells, by the calcium phos-
phate method. Briefly, DNA was mixed with 125 mm CaCl
2
and Bes-buffered saline, containing 50 mm Bes, 280 mm
NaCl, and 150 mm Na

Table 2. Primers used for mutagenesis. Mutated codons are underlined.
Primer Sequence (5¢- to 3¢)
Trp551 fi Ala forward GTTAGTAGGTGAGAAATCG
GCGGTTCAGTTTAACAGCAACA
Trp551 fi Ala reverse TGTTGCTGTTAAACTGAAC
CGCGCATTTCTCACCTACTAAC
Phe554 fi Ala forward GAGAAATCGTGGGTTCAG
GCCAACAGCAACAGCCAGCTC
Phe554 fi Ala reverse GAGCTGGCTGTT
GCTGTTGGCCTGAACCCACGATTTCTC
Asn555 fi Ala forward TCGTGGGTTCAG
TTTAACAGCAACAGCCAGCTC
Asn555 fi Ala reverse GAGCTGGCTGTTGCTGTT
AAACTGAACCCACGA
Glu667 fi Ala forward TCTGCCCCTG
GAGCCCTGCCCCA
Glu667 fi Ala reverse TGGGGCAGGG
CTCCAGGGGCAGA
Phe692 fi Ala forward CCTCGTCCTGCC
GCCTCCAATGCTCTGGA
Phe692 fi Ala reverse TCCAGAGCATTGGA
GGCGGCAGGACGAGG
Phe700 fi Ala forward GCTCTGGAGCCTGAC
GCCAAGGCTCTGAGTATTGC
Phe700 fi Ala reverse GCAATACTCAGAGCCTT
GGCGTCAGGCTCCAGAGC
Phe718 fi Ala forward TGTCGGCACCTCCAG
GCTATCCCTGTGGCACCA
Phe718 fi Ala reverse TGGTGCCACAGGGAT
AGCCTGGAGGTGCCGACA

3 Cartaud A, Coutant S, Petrucci TC & Cartaud J (1998)
Evidence for in situ and in vitro association between
b-dystroglycan and the subsynaptic 43K rapsyn protein.
Consequence for acetylcholine receptor clustering at the
synapse. J Biol Chem 273, 11321–11326.
4 Jung D, Yang B, Meyer J, Chamberlain JS & Campbell
KP (1995) Identification and characterization of the dys-
trophin anchoring site on b-dystroglycan. J Biol Chem
270, 27305–27310.
5 Yang B, Jung D, Motto D, Meyer J, Koretzky G &
Campbell KP (1995) SH3 domain-mediated interaction
of dystroglycan and Grb2. J Biol Chem 270, 11711–
11714.
6 Winder SJ (2001) The complexities of dystroglycan.
Trends Biochem Sci 26, 118–124.
7 Ervasti JM & Campbell KP (1993) A role for the dys-
trophin–glycoprotein complex as a transmembrane lin-
ker between laminin and actin. J Cell Biol 122, 809–823.
8 Durbeej M, Henry MD, Ferletta M, Campbell KP &
Ekblom P (1998) Distribution of dystroglycan in normal
adult mouse tissues. J Histochem Cytochem 46, 449–457.
9 Cohn RD & Campbell KP (2000) Molecular basis of
muscular dystrophies. Muscle Nerve 23, 1456–1471.
10 Durbeej M, Henry MD & Campbell KP (1998) Dystro-
glycan in development and disease. Curr Opin Cell Biol
10, 594–601.
11 Brancaccio A, Schulthess T, Gesemann M & Engel J
(1995) Electron microscopic evidence for a mucin-like
region in chick muscle a-dystroglycan. FEBS Lett 368,
139–142.

Brancaccio A (2001) A synthetic peptide corresponding
to the 550–585 region of a-dystroglycan binds b-dys-
troglycan as revealed by NMR spectroscopy. FEBS Lett
499, 210–214.
19 Pavoni E, Sciandra F, Barca S, Giardina B, Petrucci TC
& Brancaccio A (2005) Immunodetection of partially
glycosylated isoforms of a-dystroglycan by a new mono-
clonal antibody against its b-dystroglycan-binding epi-
tope. FEBS Lett 579, 493–499.
20 Zaccaria ML, Di Tommaso F, Brancaccio A, Paggi P &
Petrucci TC (2001) Dystroglycan distribution in adult
mouse brain: a light and electron microscopy study.
Neuroscience 104, 311–324.
21 Duclos F, Straub V, Moore SA, Venzke DP, Hrstka
RF, Crosbie RH, Durbeej M, Lebakken CS, Ettinger
AJ, van der Meulen J et al. (1998) Progressive muscular
dystrophy in alpha-sarcoglycan-deficient mice. J Cell
Biol 142, 1461–1471.
22 Zhu Z-Y & Blundell TL (1996) The use of amino acid
patterns of classified helices and strands in secondary
structure prediction. J Mol Biol 260, 261–276.
Mutagenesis at the a–b dystroglycan interface M. Bozzi et al.
4942 FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS
23 Morrison KL & Weiss GA (2001) Combinatorial ala-
nine-scanning. Curr Opin Chem Biol 5, 302–307.
24 Cunningham BC & Wells JA (1989) High-resolution
epitope mapping of hGH–receptor interactions by alan-
ine-scanning mutagenesis. Science 244, 1081–1085.
25 Bass SH, Mulkerrin MG & Wells JA (1991) A systema-
tic mutational analysis of hormone-binding determi-

Dalakas MC, Savelkoul PJ, Krasnewich DM, Gahl WA
& Huizing M (2005) Single nucleotide polymorphisms
in the dystroglycan gene do not correlate with disease
severity in hereditary inclusion body myopathy. Mol
Genet Metab 86, 244–249.
33 Esapa CT, Bentham GR, Schroder JE, Kroger S &
Blake DJ (2003) The effects of post-translational proces-
sing on dystroglycan synthesis and trafficking. FEBS
Lett 555, 209–216.
34 Jayasinha V, Nguyen HH, Xia B, Kammesheidt A,
Hoyte K & Martin PT (2003) Inhibition of dystroglycan
cleavage causes muscular dystrophy in transgenic mice.
Neuromuscul Disord 13, 365–375.
35 Kanakawa M, Saito F, Kunz S, Yoshida-Moriquchi T,
Barresi R, Kobayashi YM, Muschler J, Dumanski JP,
Michele DE, Oldstone MB et al. (2004) Molecular
recognition by LARGE is essential for expression of
functional dystroglycan. Cell 117, 953–964.
36 Tremblay MR & Carbonetto S, (2006) An extracellular
pathway for dystroglycan function in acetylcholine
receptor aggregation and laminin deposition in skeletal
myotubes. J Biol Chem 281, 13365–13373.
37 Losasso C, Di Tommaso F, Sgambato A, Ardito R,
Cittadini A, Giardina B, Petrucci TC & Brancaccio A
(2000) Anomalous dystroglycan in carcinoma cell lines.
FEBS Lett 484, 194–198.
38 Kammerer RA, Schulthess T, Landwehr R, Lustig A,
Fischer D & Engel J (1998) Tenascin-C hexabrachion
assembly is a sequential two-step process initiated by
coiled-coil a-helices. J Biol Chem 273, 10602–10608.

procedures).
This material is available as part of the online article
from
M. Bozzi et al. Mutagenesis at the a–b dystroglycan interface
FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4943


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status