Bovine tryptases
cDNA cloning, tissue specific expression and characterization of the lung isoform
Alessandra Gambacurta
1
*, Laura Fiorucci
1
*, Paolo Basili
1
, Fulvio Erba
1
, Angela Amoresano
2
and Franca Ascoli
1
1
Department of Experimental Medicine and Biochemical Sciences, University of Rome ‘Tor Vergata’, Rome;
2
Department of Organic Chemistry and Biochemistry, University of Naples ‘Federico II’, Naples, Italy
A complementary DNA encoding a new bovine tryptase
isoform (here named BLT) was cloned and sequenced
from lung tissue. Analysis of sequence indicates the pres-
ence of a 26-amino acid prepro-sequence and a 245 amino
acid catalytic domain. It contains six different residues
when compared with the previously characterized tryptase
from bovine liver capsule (BLCT), with the most signifi-
cant difference residing at the primary specificity S1
pocket. In BLT, the canonical residues Asp-Ser are pres-
ent at positions 188–189, while in BLCT these positions
are occupied by residues Asn-Phe. This finding was con-
firmed by mass fingerprinting of the peptide mixture
obtained upon in-gel tryptic digestion of BLT. Analysis by
the underlying molecular mechanism, as well as the
proenzyme/polypeptide target(s) of these enzymes have
not been identified yet, in spite of their involvement in a
variety of biochemical reactions in vitro [14–18]. Recently it
was shown that human tryptase activates by proteolytic
cleavage the proteinase-activated receptor 2, inducing
widespread inflammation by an unknown mechanism and
possibly contributing to the proinflammatory effects of mast
cells in human diseases [19].
Almost all tryptases are made of glycosylated 245 residue
identical subunits, which share many characteristics with the
prototype enzyme trypsin (225 residues), in terms of
sequence (identity around 45%) and overall folding. How-
ever, two main features are peculiar to tryptases. One
feature is the tetrameric structure of most tryptases studied
so far, which is necessary for biological activity and is
maintained in vivo through association with heparin; in
many cases this glycosaminoglycan is required for stabi-
lization of the enzyme after its release from mast cells [20,21].
In the 3 A
˚
crystal structure of the tetrameric bII human
enzyme (molecular mass 120–140 kDa), the active site of
each monomer faces a central oval pore, whose dimension
limits the accessibility for macromolecular substrates/inhi-
bitors [22]. A second common feature of tryptases seems to
be their occurrence as a multigene family: in humans, at
least four homologous tryptase cDNAs (tryptases a and
bI–III) have been isolated [23–25] and a gene cluster was
Correspondence to Franca Ascoli, Department of Experimental
between BLCT and other tryptases analyzed so far occurs at
positions 188–189 of the primary specificity pocket S1, where
the basic side chain of the substrate P1 residue, Arg or Lys
(whose carbonyl group belongs to the scissile peptide bond of
the substrate), is accommodated. In BLCT, residues Asn188
and Phe189 replace the canonical residues Asp and Ser,
respectively, present in all other tryptases and in all trypsin-
like enzymes. However, these substitutions do not affect
significantly the substrate specificity of the bovine enzyme.
In this paper, we report cloning of a new cDNA from
bovine lung encoding a tryptase isoform (BLT) with the
usual doublet Asp-Ser in the S1 specificity pocket and
isolation of the corresponding protein. Sequence analysis by
mass spectrometry and partial characterization of BLT
revealed more similarities between this enzyme and b-type
tryptases from other species with respect to BLCT. Some
evidence on tissue-specific expression of the two isoforms in
different bovine tissues is also reported and in this light the
different sequence of the two tryptase gene promoter
regions are discussed.
Experimental procedures
Oligonucleotide primers and restriction enzymes
PCR primers were obtained from MWG Biotech (Italy),
Genset (France) or Pharmacia (Italy). Their numbering
refers to the first nucleotide (+1) of cDNA start codon.
Restriction enzymes were obtained from New England
Biolabs (USA).
Amplification reaction (PCR), cloning and sequence
analysis
Unless otherwise indicated, PCRs were conducted using
products and the primer pair N9 (nt 127–153, 5¢-AGC
CTGAGAGTCAGCCGTCGGTACTGG-3¢)andN10
(nt 790–816 antisense, 5¢-TCAGGGCCCCTGGGGGAC
GTACTGGTG-3¢). Entire tryptase cDNAs were obtained
under the same conditions, at the annealing temperature of
58 °C, using the primer pair Met (nt 1–20, 5¢-ATG
CTCCATCTGCTGGCGCT-3¢, designed on the basis of
the 5¢ RACE experiments reported below) and Coda
[5¢-CGCGCGCG(T)
16
)3¢] [29] and sequenced.
5¢ Rapid amplification of cDNA ends (RACE)
5¢ RACE was carried out to determine the 5¢ nucleotide
sequence of the tryptase full-length transcripts, using the
RACE System from Gibco (Paisley, USA). One hundred
nanograms of bovine lung and hepatic capsule mRNAs
were reverse transcribed using oligo-dT as primer. After
purification of the first strand cDNA, a dC tail was added to
the 3¢ end using dCTP and terminal transferase. PCRs
were conducted on 5 lLoftheÔtailing reactionÕ,usingthe
5¢ RACE abridged universal amplification primer
AUAP with a 3¢-G tail (5¢-GGCCACGCGTCGACTAG
TACGGGGGGGGGGGGGG-3¢)as5¢ primer and C1
(nt 537–563 antisense, 5¢-TACTTCCTGTCACAGACAC
TGTTCTCC-3¢)as3¢ primer. Nested PCRs were then
performed using the same 5¢ primer and C2 (nt 372–
396 antisense, 5¢-GTGCCAGGAGATATTCACAAGCT
TG-3¢)as3¢ primer. Amplification reactions were con-
ducted using 40 pmol of each primer, under the following
conditions: 2 min at 94 °C (1 cycle), 1 min at 94 °C, 1 min
separate reactions. Each digested sample was ligated with
the annealed adaptor oligonucleotides A1 (5¢-GTAATAC
GACTCACTATAGGGCACGCGTGGTCGAC-3¢)and
A2 (5¢-GTCGACCACGCGTGC-3¢, complementary to
15 nt of the A1 3¢ region).
Amplification reactions were then conducted for each
digested and ligated genomic DNA sample (10 lL), using
20 pmoles of each primer (see below) and 5 U of the
ÔElongase enzyme mixÕ (Gibco) in 60 m
M
Tris sulfate pH 9.1,
18 m
M
ammonium sulfate, 1 m
M
magnesium sulfate and
1.5 m
M
magnesium chloride, in a final reaction volume of
50 lL. The conditions used were: 1 min at 94 °C(1cycle),
1minat94°C, 1 min at 55 °C(5¢ region) or at 52 °C(3¢
region), 4 min at 68 °C (32 cycles) and 5 min at 68 °C(1
cycle). Two microliters of each PCR was then used as a
template in a nested PCR under the same conditions. The
following oligonucleotides were used as primers: AP1 (5¢-
GTAATACGACTCACTATAGGGC-3¢, identical to 22 nt
of the A1 5¢ region); AP2 (5¢-ACTATAGG GCACGCGTG
GT-3¢, identical to 12 internal nt of A1); C3 (nt 41–61
antisense, 5¢-CCTGGCCAGGGGCTGCG GAGA-3¢); C4
(nt 34–54 antisense, 5¢-AGGGGCTGCGGAGACCAGG
amplification. Sequences of primers Met, C1, N9 and
N10 are reported above. Other primers used are: C5,
5¢-CCGTCGTGGAGAACAGTGTC-3¢ (nt 530–549); C6,
5¢-TGTCCGCCCCGTTCTTAACGCTGTA-3¢ (nt 328–
352, antisense); C7, 5¢-ACGATGCCCGCGCGCTG-3¢
(nt 67–83, antisense); C8, 5¢-ACGGGCTGGGGCAA
CGTGG-3¢ (nt 460–478). The primer pair sequences
correspond to cDNA sequences at the intron/exon
junctions, deduced from the homologous sequences of
human and murine tryptase genes. PCRs were conducted
using 100 ng of genomic DNA as a template, 20 pmol of
each primer, and the following conditions for amplification:
3 min at 94 °C (1 cycle), 1 min at 94 °C; 1 min at the
annealing temperature; 30 s at 72 °C (30 cycles); 5 min at
72 °C (1 cycle). Annealing temperatures were: 58 °Cfor
amplification of introns II and III, 60 °C for intron IV and
62 °C for intron V. The PCR products were size-fraction-
ated by electrophoresis through a 1% (w/v) agarose gel,
eluted, cloned in the PCR II
TM
TOPO vectors and
sequenced.
Purification of bovine tryptases
BLCT and BLT were purified as previously described for
bovine liver capsule tryptase [11], except that, in the case of
the lung enzyme, the three step procedure (high-salt
extraction followed by hydrophobic chromatography on
octyl sepharose and then an heparin affinity column) was
carried out using pH 5.5 buffers. Tryptase enzymatic
activity was routinely assayed at 30 °C monitoring the
room temperature), and reloaded (20 lL) on the gel
filtration column as above.
Tryptase concentrations were determined by active site
titration with 4-methylumbelliferyl p-guanidinobenzoate
(MUGB) (Sigma Chemical Co., USA) for the lung enzyme
as reported in [30], and with radioactive diisopropylfluoro-
phosphate ([
3
H]DFP) (New England Nuclear, UK) for the
liver capsule enzyme, as already described [11]. Western
blotting was performed as already reported using an anti-
(178/191-tryptase-peptide) Ig [31].
Mass spectrometry analysis
Mass spectrometric analysis was performed on the Coo-
massie blue-stained BLT protein excised from a preparative
SDS electrophoresis on a 14% (w/v) polyacrylamide gel.
The excised band was washed first with acetonitrile and then
with 0.1
M
ammonium bicarbonate. Protein samples were
reduced by incubation in 10 m
M
dithiothreitol for 45 min at
Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 509
56 °C. The gel particles were then washed with ammonium
bicarbonate and acetonitrile. Enzymatic digestion was
carried out with trypsin (Sigma Chemical Co., USA) at a
final concentration of 15 ngÆmL
)1
in 50 m
containing the various substrates in a total reaction volume
of 2.0 mL maintained at 25 °C during measurements.
Hydrolysis of MCA substrates was monitored using an
excitation wavelength of 370 nm and an emission wave-
length of 460 nm in a Kontron spectrofluorimeter. k
cat
/K
m
values were determined under pseudo first-order conditions.
For all substrates [S
°
]was K
m
. Progress curves were fitted
using an exponential function to obtain k
obs
; k
obs
/[E] was
usedtoobtaink
cat
/K
m
, where [E] represents the enzyme
concentration.
To test for susceptibility of BLT to inhibition, the enzyme
(5 n
M
active sites) and various inhibitors were mixed in
2 mL of the assay buffer and maintained at 30 °Cfor
mature protein, in that it possesses Arg rather than Gln in
this position (see Fig. 2).
When the deduced amino acid sequence of BLT is
compared with that of BLCT and other tryptases (Fig. 2), it
is evident that the first 26 aa residues of both bovine
isoforms represent the prepro-sequence, the mature protein
starting with residues IVGG, the canonical N-terminal
sequence of tryptases. The serine protease catalytic triad
residues (His44, Asp91 and Ser194) and eight cysteine
residues building the predicted intrachain disulfide bonds
are well conserved, as are many other sequence regions.
Three putative N-linked glycosylation sites at positions 102
(NIS), 171 (NVS) and 203 (NGT) are present in BLT,
whereas only two glycosylation sites were found in BLCT
[29], gerbil tryptase [12] and sheep tryptases 1 and 2 [13]. The
sequence identity of BLT is about 98% with BLCT
(corresponding to six different residues), 70–74% with
tryptases from other species, except in the case of sheep
tryptases 1 and 2 [13], where the identity reaches 82–83%.
The major and more significant difference between BLT
and BLCT resides at positions 188–189 of the S1 specificity
pocket. In BLCT they are occupied by residues Asn-Phe
(from full-length cDNA sequencing, in agreement with
previously reported partial cDNA and protein sequencing
[29]), while in BLT the canonical residues Asp-Ser are
present, as in all tryptases from other species (see also below
for the biochemical analysis of the purified protein).
Tissue-distribution and expression pattern
of bovine tryptases
Another interesting difference between the two bovine
•
GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGTGAGCAGCACCTGTATTACCAGGACCAG
288
G P E V H G P S Y F R V Q L R E Q H L Y Y Q D Q (70)
CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTACTACAGCGTTAAGAACGGTGCGGACATCGCCCTG 360
L L P I S R I I P H P N Y Y S V K N G A D I A L (94)
•
CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCTGGTCACCCTGCCCCCTGAGTCGGAGACC
432
L E L D K L V N I S W H V Q L V T L P P E S E T (118)
*
TTTCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA
504
F P P G T Q C W V T G W G N V D N G R R L P P P (142)
TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576
F P L K Q V K V P V V E N S V C D R K Y H S G L (166)
TCCACAGGGGACAACGTATCCATAGTGCAGGAGGATAACTTGTGTGCTGGGGACAGCGGGAGGGACTCCTGC 648
S T G D N V S I V Q E D N L C A G D S G R D S C (190)
*
CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG
720
Q G D S G G P L V C K V N G T W L Q A G V V S W (214)
• *
GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC
792
G D G C A K P N R P G I Y T R V T S Y L D W I H (238)
CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864
Q Y V P Q G P ♦ (245)
tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936
cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008
prominent bands were obtained in the case of genomic
DNA digested with HincII. After cloning and sequencing, it
was possible to assign each 5¢ region to one of the two
tryptase (BLT and BLCT) genes, which were amplified with
the proper primer pairs and subjected to restriction analysis
with NspI (see Materials and methods). The two promoter
sequences and 5¢-UTRs are reported in Fig. 4, where the
regulatory sequences found using the
TRANSFAC
4.0
program are highlighted. The same figure shows that in
both sequences intron I is present in phase 0 just upstream
the initiation codon, as found in most tryptases. Location
and phase of introns II–V were evaluated as reported under
Material and methods and were found identical (data not
shown) to those of human tryptases [26]. Moreover, in
searching for location and phase of intron V, we sequenced
exon regions of BLT and BLCT genes corresponding to
amino acid residues 158–245. These regions include the five
residues (out of six) which are different in the two tryptases
and the results confirm once again the presence of Asn188-
Phe189 in BLCT, unlike BLT and tryptases from other
species which contain Asp-Ser in those positions.
Isolation and characterization of bovine lung tryptase
We routinely purified tryptase from bovine liver capsule
using an high salt extraction followed by a two-column
purification. The whole procedure was carried out at
pH 6.1. Based on active site titration with [
3
H]DFP, a
.
BLCT is stable and maintains its full activity for about
two to three weeks when kept at 4 °Cinhighsaltat
pH 6.1.
Inthecaseofbovinelung,wewereabletoisolatetryptase
only after lowering the buffer pH to 5.5. The lower pH
resulted in increased adsorption to the resins and increased
stability of tryptase activity. Fractions with tryptic activity,
eluted from the heparin column, were pooled, concentrated
and analyzed by SDS/PAGE. To further purify the still
heterogeneous sample, the concentrated pooled fraction
was loaded on a gel filtration column and the elution
profile at 280 nm showed several peaks. The fractions
containing tryptic activity were then pooled and reacted
with radiolabeled DFP. SDS/PAGE followed by fluoro-
graphy yielded bands only in the 35–40 kDa range (data not
shown). The same multiple bands were detected with the
anti-(178/191 tryptase-peptide) Ig, using BLCT as control
[31] (inset of Fig. 5). The multiple banding pattern is
probably due to variable glycosylation of two/three different
sites. Reloading of the BLT sample, preincubated with
heparin, on the gel filtration column yielded a symmetrical
peak displaying enzymatic activity and migrating with an
apparent molecular weight of 200 kDa (Fig. 5). This size
is in reasonable agreement with a tetramer bound to
heparin. A minor peak with no activity and an elution
volume equivalent to a molecular mass of 35 kDa was
present. To test for catalytic activity, BLT was titrated with
the burst titrant MUGB. Approximately 6 lgofactivelung
tryptase was obtained with this procedure (4 pmol active
match all peptide masses with the amino acid sequence as
deduced from the cDNA clone. More than 80% of BLT
sequence (see also underlined residues in Fig. 1) was covered
with an adequate mass accuracy (better than 0.1%,
Table 1). In particular, the products with ion signals at
m/-z 1490.7 and 1366.2 represent the peptides that
characterize BLT isoform with respect to BLCT isoform
(corresponding to peptides 167–180 and 188–201, with
theoretical M
r
s of 1490.5 and 1365.7, respectively).
BLT was highly reactive toward tripeptide coumarin-
containing substrates, especially those with basic amino acid
in P1 and P2 positions exhibiting k
cat
/K
m
values of about
10
6
M
)1
Æs
)1
. In Table 2 the catalytic efficiency vs. tripeptide
and single residue substrates is reported in comparison with
the activity of BLCT. k
cat
/K
m
Discussion
In previous studies, we reported isolation of tryptase (then
named BLCT) from bovine liver capsule and its characteri-
zation [11,29]. BLCT was the only tryptase found in that
Fig. 5. Gel filtration analysis of purified BLT. BLT, preincubated with
heparin (10 lgÆmL
)1
), was chromatographed on a Superose 12PC
column preequilibrated with 10 m
M
Mes, 0.4
M
NaCl,pH 5.5.Protein
was detected spectrophotometrically at 280 nm and 100 lLfractions
were collected. Tryptase activity in each fraction was measured as
described in the text and reported as percent of the most active
fraction. Elution positions of blue dextran (void volume), catalase
(220 kDa), ovalbumin (43 kDa) and ribonuclease (13.7 kDa) are
indicated by arrows. In the inset the immunodetection of purified
BLCT (a) and of BLT (b) is shown.
Fig. 6. MALDI mass spectrometry analysis of peptides obtained from
the in-gel tryptic digestion of BLT. The peptides correspond to (MH)
+
masses. Ion masses £ 1150 and ‡ 1600 Da are not shown. The marked
products represent the peptides that characterize the BLT isoform with
respect to BLCT isoform (peptides 167–180 and 188–201).
Table 1. MALDI MS analysis of the peptide mixture extracted from
BLT gel spot.
MH
+
. Values were determined un-
der pseudo first-order conditions and are the averages of four different
experiments. SDs were £ 8% of the averages.
Substrate
10
5
· k
cat
/K
m
(
M
)1
Æs
)1
)
BLT BLCT
Boc-Gly-Lys-Arg-MCA 30 2.3
Boc-Gly-Gly-Arg-MCA 20 0.7
Boc-Phe-Ser-Arg-MCA 17 1.0
Boc-Val-Pro-Arg-MCA 18 0.5
Z-Arg-MCA 0.13 0.002
Table 3. Effect of serine protease inhibitors on BLT activity. Assay
conditions were 0.1
M
Tris/HCl, pH 8.0 and 30 °C. Residual activity
was determined using Boc-Phe-Ser-Arg-MCA as substrate. BLT
concentration was 5 n
M
active sites. Values are the averages of three
similar regulatory mechanisms in these specific tissues.
The coexistence in the same organism of multiple tryptase
genes, as found here, is in linewith findings reported by others
for human [23–26], and mouse [27,28] tryptases. What is
peculiar here is the presence in the same organism of
isoforms, BLCT and BLT, whose primary structure predicts
a different functional efficiency, despite their 98% sequence
identity, as confirmed by the catalytic activity of the isolated
proteins (see also later). BLT differs from BLCT at only six of
the 245 residues forming the catalytic domain, two of them
(residues 188–189) being in sites thought to be critical
determinants of function. BLT is structurally more similar
than BLCT to most tryptases, in particular for the presence of
the canonical residues Asp188 and Ser189 in the S1 specificity
pocket, whereas residues Gly215 and Gly225, found in all
b-type tryptases, are present in both the bovine enzymes.
These results, indicating a possible tissue specific function
of the two isoforms, prompted us to analyze the organiza-
tion and the promoter sequences (Fig. 4) of the two tryptase
genes. The length of both genes, as evaluated from the size
of the PCR products, obtained from genomic DNA with
proper primers, is around 1800 bp, similar to that of human
bI tryptase gene [25]. The two genes share with human, dog
and mouse MCP-6 tryptase genes the same organization
with six exons separated by five introns, the same and
unique position of intron I (189 bp), immediately upstream
the initiation codon, and the location/phase of introns II–V.
It is interesting to note that five codons (out of six) encoding
different residues in BLT, with respect to BLCT, are all
located in exon V, which encodes residues 137–191 of the
suggest an hormone-regulated expression. Interestingly,
the BLT promoter contains a recognition sequence for a
negative transcription factor, COUP-TF (chick ovalbumin
upstream promoter-transcription factor), which has been
identified in many different species [37]. COUP-TFs
belong to the steroid/thyroid hormone receptor (TR)
superfamily and have been shown to down regulate the
hormonal induction of TR-dependent activation of speci-
fic genes, acting as inhibitors of transcriptional activity
[37]. Thus, the interplay of positive or negative transcrip-
tion factors may regulate, in a tissue-specific fashion, the
expression of BLT and BLCT proteins.
For the isolation of tryptase from lung we used a more
acidic pH than that used in the liver capsule tryptase
purification procedure, with the aim of increasing adsorp-
tion of the enzyme to the resin and its stability. The
heterogeneous sample needed to be purified by a further
chromatographic step. However, some contaminating
proteins were still present after this step, but the only serine
protease detected by fluorography after labeling with
radioactive DFP showed to be immunoreactive with specific
anti-tryptase Igs. Our results show that in a gel chromato-
graphy analysis of native BLT preincubated with heparin,
theenzymeelutedasan 200 kDa protein. This size is in
reasonable agreement with a tetramer bound to heparin [38]
considering that the BLT monomer has a size of 35 kDa
and that the elution position may be anticipated by the
presence of the anionic heparin glycosamminoglycan. BLT
subunit concentration was measured by burst tritation with
MUGB. The procedure, whose success depends on the
Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 515
particular, the latter was shown to cleave peptide substrates
that reproduce precursor sequences around putative clea-
vage loci [31]. However, no conclusions can be drawn at this
stage on the BLT preference for substrates with two
terminal basic residues, in spite of the similar trend found
in the catalytic efficiency of BLT and BLCT toward some
synthetic substrates. Moreover, for all substrates examined,
BLT exhibited k
cat
/K
m
values that were 10- to 60-fold
greater than those of BLCT. The difference in catalytic
properties between the two enzymes may be related to the
sequence of the region forming the primary specificity S1
pocket. An Asp residue is located at position 188 in BLT,
human, sheep and other tryptases and confers specificity for
binding basic P1 amino acid residues. In BLCT, the
presence of the Asn residue in that position results in a
decrease negative charge at the bottom of the pocket and a
consequent weaker interaction of substrates when compared
with BLT and the other tryptases. The usual substrate
specificity of BLCT was explained by assuming some
conformational change of the active sites [29] and/or
involving the role of additional interactions occurring
between the active sites and substrates. In this regard,
modeling studies showed that the carbonyl oxygen atom of
the properly oriented Phe190 may form a hydrogen bond
with the c-guanidino group of the P1 Arg residue in the
1. Smith, T.J., Houghl, M.W. & Johnson, D.A. (1984) Human lung
tryptase: purification and characterization. J. Biol. Chem. 259,
11046–11051.
2. Cromlish, J.A., Seidah, N.G., Marcinkiewicz, M., Hamelin, J.,
Johnson, D.A. & Chretien, M. (1987) Human pituitary tryptase:
molecular forms, NH
2
-terminal sequence, immunocytochemical
localization and specificity with prohormone and fluorogenic
substrates. J. Biol. Chem. 262, 1363–1373.
3. Harvima, I.T., Schechter, N.M., Harvima, R.J. & Fraki, J.E.
(1988) Human skin tryptase: purification, partial characterization
andcomparisonwithhumanlungtryptase.Biochim. Biophys.
Acta 957, 71–80.
4. Caughey, G.H., Viro, N.F., Ramachandran, J., Lazarus, S.C.,
Borson, D.B. & Nadel, J.A. (1987) Dog mastocytoma tryptase:
affinity purification, characterization and amino-termoinal
sequence. Arch. Biochem. Biophys. 258, 555–563.
5. Vanderslice, P., Craik, C.S., Nadel, J.A. & Caughey, G.H. (1989)
Molecular cloning of dog mast cell tryptases and a related pro-
tease:structuralevidenceofauniquemodeofserineprotease
activation. Biochemistry 28, 4148–4155.
6. Ide, H., Itoh, H., Tomita, M., Murakumo, Y., Kobayashi, T.,
Maruyama, H., Osada, Y. & Nawa, Y. (1995) Molecular cloning
and expression of rat mast cell tryptase. J. Biochem. (Tokyo) 118,
210–215.
7. Kido, H., Fukusen, N. & Katunuma, N. (1985) Chymotrypsin
and trypsin-type serine proteases in rat mast cells: properties and
functions. Arch. Biochem. Biophys. 239, 436–443.
8. Braganza, V.J. & Simmons, W.H. (1991) Tryptase from rat skin:
tryptase is a mitogen for cultured fibroblasts. J. Clin. Invest. 88,
493–499.
17. Stack, M.S. & Johnson, D.A. (1994) Human mast cell tryptase
activates single chain urinary-type plasminogen activator
(pro-urokinase). J. Biol. Chem. 269, 9416–9419.
18. Blair, R.J., Meng, H., Marchese, M.J., Ren, S., Schwartz, L.B.,
Tonnesen, M.G. & Gruber, B.L. (1997) Human mast cells
stimulate vascular tube formation: tryptase is a novel, potent
angiogenic factor. J. Clin. Invest. 99, 2691–2700.
19. Steinhoff, M., Vergnolle, N., Young, S.H., Tognetto, M.,
Amadesi, S., Ennes, H.S., Trevisani, M., Hollenberg, M.D.,
516 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Wallace, J.L., Caughey, G.H., Mitchell, S.E., Williams, L.M.,
Geppetti, P., Mayer, E.A. & Bunnett, N.W. (2000) Agonists of
proteinase-activated receptor 2 induce inflammation by a neuro-
genic mechanism. Nat. Med. 6, 151–158.
20. Schwartz, L.B. & Bradford, T.R. (1986) Regulation of tryptase
from human lung mast cells by heparin: stabilization of the active
tetramer. J. Biol. Chem. 251, 7372–7379.
21. Schechter, N.M., Eng, G.Y., Selwood, T. & McCaslin, D.R.
(1995) Structural changes associated with the spontaneous
inactivation of the serine proteinase human tryptase. Biochemistry
34, 10628–10638.
22. Pereira, P.J.B., Bergner, A., Macedo-Ribeiro, S., Huber, R.,
Matschiner, G., Fritz, H., Sommerhoff, C.P. & Bode, W. (1998)
Human beta-tryptase is a ring-like tetramer with active sites facing
acentralpore.Nature 392, 306–311.
23. Miller, J.S., Westin, E.H. & Schwartz, L.B. (1989) Cloning and
characterization of complementary DNA for human tryptase.
J. Clin. Invest. 84, 1188–1195.
of Bos taurus tryptase: a search for a possible propeptide
processing role. Comp. Biochem. Physiol. B Biochem. Mol. Biol.
120, 239–245.
32. Fiorucci, L., Erba, F., Coletta, M. & Ascoli, F. (1995) Evidence
for multiple interacting binding sites in bovine tryptase. FEBS
Lett. 363, 81–84.
33. Faber, P.W., van Rooij, H.C., van der Korput, H.A., Baarends,
W.M., Brinkmann, A.O., Grootegoed, J.A. & Trapman, J. (1991)
Characterization of the human androgen receptor transcription
unit. J. Biol. Chem. 266, 10743–10749.
34. Monaci, P., Nicosia, A. & Cortese, R. (1988) Two different liver-
specific factors stimulate in vitro transcription from the human
a1-antitrypsin promoter. EMBO J. 7, 2075–2087.
35. O’Neill, E.A., Fletcher, C., Burrow, C.R., Heintz, N., Roeder,
R.G. & Kelly, T.J. (1988) Transcription factor OTF-1 is func-
tionally identical to the DNA replication factor NF-III. Science
241, 1210–1213.
36. Bohmann, D., Bos, T.J., Admon, A., Nishimura, T., Vogt, P.K. &
Tjian, R. (1987) Human proto-oncogene c-jun encodes a DNA
binding protein with structural and functional properties of tran-
scription factor AP-1. Science 238, 1386–1392.
37. Tsai, S.Y. & Tsai, M.J. (1997) Chick ovalbumin upstream pro-
moter-transcription factors (COUP-TFs): coming of age. Endocr.
Rev. 18, 229–240.
38. Hallgren, J., Estrada, S., Karlson, U., Alving, K. & Pejler, G.
(2001) Heparin antagonists are potent inhibitors of mast cell
tryptase. Biochemistry 40, 7342–7349.
39. Erba,F.,Fiorucci,L.,Pascarella,S.,Menegatti,E.,Ascenzi,P.&
Ascoli, F. (2001) Selective inhibition of human mast cell tryptase
by gabexate mesylate, an antiproteinase drug. Biochem. Pharma-