Isolation and characterization of an IgNAR variable domain specific
for the human mitochondrial translocase receptor Tom70
Stewart D. Nuttall
1,2
, Usha V. Krishnan
1,2
, Larissa Doughty
1
, Kylie Pearson
2,3
, Michael T. Ryan
2,3
,
Nicholas J. Hoogenraad
2,3
, Meghan Hattarki
1
, Jennifer A. Carmichael
1,2
, Robert A. Irving
1,2
and Peter J. Hudson
1,2
1
CSIRO Health Sciences and Nutrition, and
2
CRC for Diagnostics, Parkville, Victoria, Australia;
3
Department of Biochemistry,
La Trobe University, Bundoora, Victoria, Australia
The new antigen receptor (IgNAR) from sharks is a disul-

cating that these V
NAR
domains can be efficiently displayed
as bacteriophage libraries, and selected against target anti-
gens with an affinity and stability equivalent to that obtained
for other single domain antibodies. As an initial step in
producing ÔintrabodyÕ variants of 12F-11, the impact of
modifying or removing the conserved immunoglobulin
intradomain disulphide bond was assessed. High affinity
binding was only retained in the wild-type protein, which
combined with our inability to affinity mature 12F-11, sug-
geststhatthisparticularV
NAR
is critically dependent upon
precise CDR loop conformations for its binding affinity.
Keywords: new antigen receptor; variable domain; peptide
display; Tom70; mitochondrial import.
Conventional antibodies recognize antigens through the
combination of six complementarity determining region
(CDR) loops displayed three each upon variable heavy (V
H
)
and variable light (V
L
) chain immunoglobulin domains [1].
These CDR loops vary in size and composition allowing
formation of a large number of conformational antigen-
binding surfaces including planar and ridged topologies [2].
The orientation of the loops is maintained by a combination
of their internal architecture, the underlying immunoglo-

NAR
[9,10]. Structurally, the
entire intact IgNAR antibody molecule is a disulphide-
bonded dimer of two protein chains, each containing the
single variable and five constant domains. There is no
associated light chain and immunoelectron microscopy
confirms that the V
NAR
domains do not associate together
across a V
H
/V
L
-like interface and thereby provide bivalent
affinity to two separate antigen molecules [11]. There is a
striking evolutionary convergence at the molecular structure
level between the shark V
NAR
and camelid V
H
Hantigen-
binding domains. Similarities include, but are not limited
to (a) the presence of charged rather than hydrophobic
residues in the conventional V
L
interface of the immuno-
globulin framework, which imparts a hydrophilic character
to the solvent-exposed areas; (b) larger CDR3 loops
compared to those found in human and murine antibodies
(murine,

) or between the CDR1 and CDR3 loops
(Type2 V
NAR
) [5,11]. Camelid V
H
Hs typically possess
disulphide linkages either between the CDR1 and )3, or
CDR2 and )3 loops [13,14]. Despite these similarities, the
camel and shark variable domains are clearly different, both
by sequence alignment (only  20% identity) and the
unusual focus of shark V
NAR
variability into only the
CDR1 and )3 regions (Type2 V
NAR
), or the CDR2 and )3
regions (Type1 V
NAR
)[7].
While the shark IgNARs have yet to be formally
demonstrated as in vivo molecules responsible for immuno-
surveillance, there is strong evidence for their functional
role in antigen binding. First, an analysis of mutational
patterns of membrane-bound and secreted forms of nurse
sharkIgNARsindicatedthattheyaremutatedinthelatter
form, suggesting affinity maturation by somatic hyper-
mutation [15,16]. Second, in a previous study, we showed
that the individual wobbegong V
NAR
s could be expressed

protein targets. We have chosen as one target antigen the
cytosolic domain of the 70 kDa outer membrane trans-
locase (Tom70) from human mitochondria that is impli-
cated in mitochondrial import processes [18,19]. Studies in
Saccharomyces cerevisiae and the fungus, Neurospora crassa
have characterized Tom70 as a receptor peripheral to the
mitochondrial general insertion pore that preferentially
interacts with a subset of preproteins that typically contain
internal targeting signals and/or require the action of
cytosolic chaperones for their delivery to the mitochondrial
surface [20,21]. The human homologue of Tom70 has only
recently been identified [22], and attempts to generate high
specificity polyclonal or monoclonal antibodies have so far
been unsuccessful, perhaps due to extensive sequence
homology across species. Here, we report the isolation
and characterization of a V
NAR
that binds with high affinity
to human Tom70 as an important demonstration that
V
NAR
libraries can provide novel binding reagents against
refractory and immunosilent targets. Further, to demon-
strate the effect of removing the internal stabilizing disul-
phide bond in the manner of antibody V-domain
ÔintrabodiesÕ [23], residues Cys22 and Cys82 were modified
by alkylation, or replaced with alanine and valine, respect-
ively, and the resultant V
NAR
s evaluated for retention of

cillin and/or 2% (w/v) glucose. Solid media contained 2%
(w/v) Bacto-agar. Transformation of E. coli was by stand-
ard procedures [24] performed using electrocompetent cells.
Isolation of total RNA from Wobbegong sharks
Spotted Wobbegong sharks (Orectolobus maculatus)were
housed and maintained at the Underwater World Aquar-
ium, Mooloolaba, Queensland, Australia. For isolation of
peripheral blood lymphocytes, a blood sample (3 mL) was
taken from the caudal vein of a young male (6.82 kg).
Experiments were performed in accordance with CSIRO
(Health Sciences and Nutrition) animal ethics requirements.
Total RNA was extracted using the AquaPure RNA
Isolation Kit (BIO-RAD, Australia), stored at )80 °C,
and used in reverse transcription-polymerase chain reac-
tions using the Titan one tube RT-PCR system (Roche,
Germany) as described [10].
Library construction and panning
DNA library cassettes encoding the Wobbegong V
NAR
with
randomization of the CDR3 loop were constructed as
described [10], using CDR3 randomization oligonucleotide
primers to generate synthetic CDR3s of 15 residues (#6981);
16 residues (#7211); 17 residues (#6980) and 18 residues
(#7210) in length (Table 1). In addition, natural Wobbe-
gong V
NAR
sequences were amplified direct from cDNA
using only the variable domain terminal primers (Table 1)
[10,17]. Cassette fragments were cut with the restriction

/Blotto (2%, w/v)
for 30 min at room temperature with gentle agitation
followed by 90 min without agiation. After incubation,
immunotubes were washed [NaCl/P
i
/Tween20 (0.1%, v/v);
7, 8, 10 and 10 washes for panning rounds 1–4], followed by
an identical set of washes with NaCl/P
i
. Phagemid particles
were eluted using 0.1
M
HCl, pH 2.2/1 mgÆmL
)1
BSA,
neutralized by the addition of 2
M
Tris base [26], and either
immediately reinfected into E. coli TG1 or stored at 4 °C.
Nucleic acid isolation and cloning
Following final selection, phagemid particles were infected
into E. coli TG1 and propagated as plasmids, followed by
DNA extraction. The V
NAR
cassette was extracted as a
NotI/SfiI fragment and subcloned into the similarly restric-
ted cloning/expression vector pGC [27]. DNA clones were
sequenced on both strands using a BigDye terminator cycle
sequencing kit (Applied Biosystems) and a Perkin Elmer
Sequenator. The nucleotide sequence of clone 12F-11 is

0.1% glucose (w/v) and then grown at 37 °C and shaken at
200 r.p.m. until D
550
¼ 0.2–0.4. Cultures were then induced
with IPTG (1 m
M
final concentration), grown for a further
16 h at 28 °C and harvested by centrifugation (Beckman
JA-14/6K, 5500 g 10 min, 4 °C). Periplasmic fractions were
isolated by the method of Minsky [28] and either used as
crude fractions or recombinant protein purified by affinity
chromatography using an anti-(FLAG) Ig/Sepharose col-
umn (10 · 1 cm). The affinity column was equilibrated in
NaCl/P
i
, pH 7.4 and bound protein eluted with Immuno-
Pure
TM
gentle elution buffer (Pierce). Eluted proteins were
dialysed against two changes of NaCl/P
i
containing 0.02%
sodium azide, concentrated by ultrafiltration over a 3-kDa
cutoff membrane (YM3, Diaflo), and analysed by FPLC on
a precalibrated Superdex 200 column (Pharmacia) equili-
brated in NaCl/P
i
buffer pH 7.4. Recombinant proteins were
analysed, by SDS/PAGE through 15% Tris/glycine gels.
Enzyme linked immunosorbent assays

3¢ Amplification 8404 (‹)
CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC C-terminus ¼ …GTALTVK
3¢ Amplification 8405 (‹) CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC C-terminus ¼ …GTVLTVK
CDR3 Library
construction
6981 (‹) GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH
RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG
15 residue randomised loop
CDR3 Library
construction
7211 (‹)
TTTCACGGTTAATACGGTGCCAGCTCCTTTCTCMNNMNNMNNMNNRYHR
YHRYHRYHRYHMNNMNNMNNMNNMNNGNATGCTCCACACTTATACGT
GCC
16 residue randomised loop
CDR3 Library
construction
6980 (‹)
GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNMNNMNNRYHRY
HRYHRYHMNNMNNMNNMNNMNNMNNTGCTTGACACTTATACGTGCC
ACTG
17 residue randomised loop
CDR3 Library
construction
7210 (‹)
TTTCACGGTTAATACGGTGCCAGCTCCTTTCTCMNNMNNMNNMNNMNN
MNNRYHRYHRYHRYHRYHMNNMNNMNNMNNMNNGNATGCTTGA
CACTTATACGTGCC
18 residue randomised loop
Ó FEBS 2003 An IgNAR variable domain specific for human Tom70 (Eur. J. Biochem. 270) 3545

M
NaCl,
3.4 m
M
EDTA, 0.005% surfactant P20, pH 7.4) at 25 °C
and a constant flow rate of 5 lLÆmin
)1
with a series of
12F-11 concentrations (2.2–17.8 n
M
). Binding experiments
were performed immediately, as prolonged washing with
the HBS buffer resulted in a decrease in activity of the
immobilized Tom70. Regeneration of the Tom70 surface
was achieved by running the dissociation reaction to
completion before the next injection of analyte.
For binding experiments in the reverse orientation,
recombinant protein 12F-11 was immobilized by the
standard amine coupling method. 12F-11 protein at a
concentration of 20 lgÆmL
)1
in 10 m
M
sodium acetate
pH 6.0 was injected for 8 min (40 lL) over an activated
surface to couple 650 RU of protein onto the sensor surface.
The 12F-11 surface was regenerated with a 10-lL aliquot of
50 m
M
HCl with negligible loss of binding activity. Binding

and energy minimized using molecular dynamics restrained
to the template structure, except where gaps occurred in the
alignments and for CDRs 1 and 3. In these cases extensive
loop modelling was undertaken and the final model
selection based on the modeller objective score.
Construction of the 12F-11DCys mutant and 12F-11
reduction/alkylation
For reduction and alkylation of 12F-11, recombinant
protein (1.3–1.5 mg) was denatured/reduced using 6
M
guanidine HCl and 50 m
M
dithiothreitol (pH 8.0) for 1 h
at 45 °C under nitrogen. Cysteine residues were then
alkylated by the addition of 100 m
M
(final) iodo-acetamide
(pH 8.0)/1 h (room temperature) followed by quenching
with additional dithiothreitol. Samples were dialysed against
four changes of NaCl/P
i
, concentrated, and analysed by
FPLC, SDS/PAGE and ELISA, as above. The disulphide
minus variant of 12F-11 incorporating mutations Cys22Ala
and Cys82Val was constructed by overlapping PCR using
oligonucleotide primers N8517 (Forward: 5¢-ACAAGGG
TAGACCAAACACCAAGAACAGCAACAAAAGAG
ACGGGCGAATCACTGACCATCAACgccGTCCTGA
GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA
TGCGGTGCCAGCTCCCCAACTGTAATAAATACC

NAR
library
We previously designed and constructed a Wobbegong
IgNAR variable domain (V
NAR
) library with long synthetic
CDR3 loops of either 15 or 17 residues in length inserted into
a mixed scaffold repertoire of 26 naturally occurring V
NAR
domains. This small library ( 3 · 10
7
independent clones)
was displayed on the surface of fd bacteriophage and
successfully panned against protein antigens [10]. In order to
increase the diversity of possible antigen-binding fragments,
this library was expanded in three ways: (a) the extended
library comprised increased complexity with CDR3 lengths
ranging form 15–18 residues to reflect the predominant
natural diversity in Wobbegong and Nurse shark V
NAR
s
(Fig. 1A). Additionally, a different randomization pattern
was used, biased toward the incorporation of cysteine at
CDR3 loop residue positions 1 and 7–11, to enhance the
possibility of inter- and intra CDR disulphide cross-links.
These strategies are summarized in Fig. 1B and Table 1, and
details of the library construction are given in greater detail in
the Materials and methods. (b) The extended library was
based on CDR3 loops grafted into a large scaffold repertoire
of natural V

protein construct consisting of residues 111–608 of human
Tom70 was expressed in E. coli, purified as a soluble
extracellular 60 kDa protein, and immobilized on immuno-
tubes as a target protein [21].
The V
NAR
library was transformed into E. coli TG1 and
phagemid particles rescued and panned against the immo-
bilized Tom70 antigen. Four rounds of biopanning were
performed with an increase in the stringency of washing at
each step, and between selection rounds three and four a
significant ( 1000-fold) increase in the titre of eluted
bacteriophage was observed. Colony PCR on transfected
bacteriophage showed that 100% of colonies were positive
for V
NAR
sequences, and this combined with the increase in
the titre, indicated positive selection. Thus, V
NAR
cassettes
were rescued from phagemids, cloned into the periplasmic
expression vector pGC, and transformed into E. coli TG1.
Periplasmic fractions from recombinant clones were tested
for binding to Tom70 and negative control antigens by
ELISA (not shown). Several clones showed significant
binding above background, and all of these proved to be
identical sequences. One of these, designated clone 12F-11,
was chosen for further analysis.
The primary and deduced amino acid sequences of clone
12F-11 are presented in Fig. 2A, including in-frame dual

Recombinant protein 12F-11 is a monomeric,
correctly folded protein
Loss of a nonCDR residue is potentially destructive to
immunoglobulin domain structures. Thus, to determine
Fig. 1. Design of the V
NAR
library. (A) Cumulative frequency histo-
gram of IgNAR CDR3 loop lengths, from Wobbegong sharks (26
sequences) and Nurse sharks (35 sequences). (B) Schematic diagram
of synthetic CDR3s used in V
NAR
library construction, showing the
randomization patterns used for the varying length CDRs. X repre-
sents use of the nucleotide randomization strategy (NNK) that encodes
any residue or an amber stop codon. Surrounding framework regions
are also shown. (C) V
NAR
cassettes were ligated into phagemid vector
pFAB.5c at the SfiIandNotI restriction endonuclease sites. The
phagemid vector incorporates a lacZ promoter, and in-frame PelB
leader, Ala
3
linker, and DGene3 protein domains prior to a translation
termination codon.
Ó FEBS 2003 An IgNAR variable domain specific for human Tom70 (Eur. J. Biochem. 270) 3547
whether the absence of residue Thr39 had an adverse effect
upon protein 12F-11 expression, folding, and stability, we
undertook a thorough protein chemical analysis. Recom-
binant 12F-11 protein was expressed in E. coli and then
isolated from the bacterial periplasm by affinity chromato-

max
at 217–219 nm (Fig. 3B). This spectrum is
characteristic of a protein with a b-sheet structure with
unstructured loops contributed by the CDRs and FLAG
affinity tags, and is not a disordered structure [34]. Indeed,
the 12F-11 specturm is very similar to CD spectra obtained
for other V
NAR
proteins, for example V
NAR
12A-9 that has
different CDR loops and a slightly different b-sheet
framework, and which is shown for comparison (Fig. 3B)
[17]. Together, these results suggest that despite the absence
of Thr39, protein 12F-11 folds into compact, b-sheet
immunoglobulin in the E. coli periplasm. Indeed, in
preliminary structural studies, protein 12F-11 crystallises
in the monoclinic P2 space group (results not shown),
Fig. 2. Nucleotide and deduced amino acid sequences of the V
NAR
12F-
11 variable domain. (A) Nucleotide and deduced amino acid sequences
of clone 12F-11. The conserved termini dictated by the oligonucleotide
primer sequences used in library construction are underlined, and the
alanine linker and dual octapeptide FLAG tags are italicised. The
positions of the CDR1 and )3 regions are indicated in bold type.
(B) Alignment of protein 12F-11 with four other V
NAR
domain amino
acid sequences (GenBank AY069988; AF336094; AF336087;

NAR
12F-11 in 0.05
M
sodium phosphate buffer, pH 7.4
(unbroken line). For comparison, the spectrum for the naturally
occurring V
NAR
domain 12A-9 [17] is also shown (dotted line).
3548 S. D. Nuttall et al. (Eur. J. Biochem. 270) Ó FEBS 2003
providing further evidence for folding into an ordered
domain structure.
To explain more fully why protein 12F-11 folds into a
functional protein while missing a framework residue, we
modelled the variable domain structure and compared it to
a model of a conventional V
NAR
(Fig. 4). Our modelling
studies indicate that Thr39 is located at the end of the
C strand, and that the adjacent C-C¢ loop is therefore
amenable to structural changes imposed by the residue
deletion without disruption to the framework. Otherwise,
there is good agreement between the two V
NAR
models,
with the obvious exception of the CDR loop diversity.
Specificity and binding activity of recombinant
protein 12F-11
The specificity of protein 12F-11 for Tom70 was demon-
strated by ELISA (Fig. 5A). Recombinant protein reacted
specifically with Tom70 but not several other antigens tested

6
M
)1
Æs
)1
)andadis-
sociation rate constant (k
D
)of3.49±0.36
–
3Æs
)1
to yield a
K
D
of 2.2 ± 0.31
)9
M
)1
.
V
NAR
protein 12F-11 monomer was also immobilized via
amine coupling onto the sensor chip to measure the binding
interaction in the reverse orientation. The 12F-11 surface
was stable and could be regenerated with 50 m
M
HCl
Fig. 4. Models of V
NAR

Next, protein 12F-11 was used to test the utility of V
NAR
domains as possible ÔintrabodiesÕ for expression and use in
in vivo targeting applications. Specifically, we asked whether
binding affinity was retained in the absence of the conserved
immunoglobulin intradomain disulphide bond. In an initial
series of experiments, recombinant 12F-11 protein was
denatured and reduced using guanidine HCl and dithio-
threitol, followed by alkylation of the cysteine residues and
refolding. However, in a result seen for many V
H
/V
L
antibodies, the modified protein almost exclusively precipi-
tated in the soluble fraction. Only a small proportion
consistently remained in the soluble fraction, and this
protein showed a similar FPLC profile to the unmodified
protein (Fig. 7A). This soluble protein retained binding
affinity for Tom70 by ELISA (Fig. 1C), and we hypothesize
that this fraction represents protein that was not fully
alkylated and was thus able to refold, with probable
reoxidation of the disulphide bond. In contrast, the
insoluble fraction most likely represents irreversibly aggre-
gated alkylated material.
In order to more systematically test this hypothesis, we
elected to eliminate the possibility of disulphide bond
formation genetically by replacement of residues Cys22 and
Cys82 with alanine and valine, respectively, to give a
cysteine minus mutant (12F-11DCys). Use of alanine and
valine was initially determined in a set of competitive

b-sheets relative to each other. However, upon binding, the
interaction with antigen functions to lock the b-sheet and
CDR loop conformations, resulting in the original dissoci-
ation kinetics.
Affinity maturation of 12F-11
In order to affinity mature V
NAR
12F-11, a library of
mutant proteins was generated by error-prone PCR. The
resultant bacteriophage-displayed library ( 10
6
independ-
ent clones) was panned against Tom70 under conditions
designed to select for variants with enhanced off-rate
kinetics. After two rounds of selection a >4000-fold
increase in titre was observed indicating strong selection.
Of the resultant clones, a large proportion (64%) were 12F-
11 wild-type, while those with mutations almost exclusively
showed conservative framework variations well-removed
from the V
NAR
binding site. Only one variant, designated
15Z-2, showed changes mapping to either the CDR or
Fig. 6. Analysis of protein 12F-11 by BIAcore. (A) Binding of mono-
meric V
NAR
protein 12F-11 to immobilized Tom70 protein (990 RU)
was measured at a constant flow rate of 5 lLÆmin
)1
with an injection

ics, including no differences in dissociation rates. Moreover,
upon extended storage, protein 15Z-2 showed a slight
tendency to precipitation, suggesting that its coselection
with wild-type, and slightly higher ELISA responses, may be
attributable to an increased tendency toward aggregation.
Discussion
The aim of this study was to generate an in vitro library
of V
NAR
domains, containing both synthetic and natural
CDR3 loops, and then to isolate specific binding molecules
using as an initial target antigen the mitochondrial outer
membrane receptor Tom70. The resulting protein, 12F-11,
shows a high degree of affinity and specificity for Tom70,
andwithaK
D
of  2n
M
compares very well with affinities
reported for camelid V
H
H domains (that vary in the range
2–300 n
M
[36]) and for scFv and disulphide stabilized Fv
fragments [37]. The high affinity of 12F-11 is directly
attributable to a relatively rapid association rate
(k
a
 1.7 · 10

M
)1
Æs
)1
) [17].
Structurally, protein 12F-11 is a slightly unusual member
of the V
NAR
family. Firstly, the absence of a framework
residue which is commonly present (Thr39), could be
hypothesized to deform the underlying b-framework.
However, the data clearly demonstrates that this is not the
case, and molecular modelling maps this residue to a region
distant to the antigen-binding site, and on the periphery of
the immunoglobulin-like core scaffold and adjacent to the
C-C¢ loop (see Fig. 4). Further, there may well be even
greater latitude for mutations within this region, as in
unrelated experiments we have also discovered a naturally
occurring V
NAR
lacking five residues in this loop position
(S. Nuttall, unpublished data). Secondly, the mean size of
the V
NAR
CDR3 loop is 16 residues, yet protein 12F-11
achieves low nanomolar affinity binding with a CDR3 only
10 residues in length. While this apparently contradicts the
Fig. 7. Effect of removal of the 12F-11 disulphide bond. (A) Elution profiles of affinity purified 12F-11 protein (dotted line), and the soluble fraction
remaining after reduction and alkylation (unbroken line), on a calibrated Superose 12 gel-filtration column equilibrated in NaCl/P
i

binding surfaces, shark V
NAR
and camelid V
H
H libraries
will contain structural homologues similar to antibody V
H
and V
L
libraries, as well as providing discrete and distinctly
different structural repertoires.
In an attempt to further improve the 12F-11 binding
affinity, we generated a library of affinity-matured variants.
However, selection failed to isolate any mutants with
improved binding kinetics and instead there was strong
selection for the wild-type protein. This probably reflects a
precise interaction between the CDR1 and relatively short
CDR3 loop with only minor variations being tolerated.
Thus, within the relatively limited context of a library of a
million independent clones covering the entire V
NAR
cassette, it is unlikely that the rare beneficial mutations will
be present. In contrast, in experiments aimed at affinity
maturing other V
NAR
domains, we have isolated several
variants with approaching order-of-magnitude enhanced
affinities from similar sized error-prone PCR libraries.
However, in these cases the mutations targeted an extended
and flexible CDR3 loop, which provided greater latitude for

ation rate. In contrast, antigen binding presumably locks the
b-sheet and CDR loop conformation, resulting in the
original dissociation kinetics. This interpretation is consis-
tent with the current dogma that antigen binding is critically
dependant upon the precise interaction of CDR1, CDR3,
and underlying framework residues. Specifically, we noted
that the three CDR3 tyrosine residues in 12F-11 (Tyr
residues are over-represented in CDR loop structures [42]),
may combine with Tyr35 which lies just C-terminal to the
CDR1 loop, to form the predominant antigen binding site.
Additionally, the noncanonical disulphide bridge often
found in V
NAR
domains, that links the CDR1 and )3
loops together providing additional conformational stabi-
lity, is absent in this case. However, any more detailed
analysis of the 12F-11 paratope and assessment of the
varying contributions of CDR and framework regions
clearly requires definitive structural data; this analysis is
currently in progress.
The isolation of 12F-11 from the extended V
NAR
library
demonstrates that synthetic CDR3 libraries selected in vitro
can generate proteins with antigen-binding affinities at least
equal to those of natural systems (i.e. immunization of
animals followed by isolation of the variable gene reper-
toire). This is especially important where conventional (i.e.
murine) antibodies are difficult to generate. The human
Tom70 receptor is an important example of such refractory

advances likely to expand these applications include
improvements in initial panning and screening, followed
by the application of more sophisticated affinity maturation
techniques beyond error-prone PCR, for example DNA
shuffling or in vivo mutagenesis and selection [44,45]. We
predict that such strategies, especially those targeting the
CDR1 region, will result in an improvement in affinity,
particularly by decreasing the dissociation rate. Alternat-
ively, increased V
NAR
functional affinity (avidity) may also
be achieved by domain multimerization. Such strategies are
well established for scFv fragments (e.g., adjustment of
linker lengths resulting in various geometric conformations
of V
H
/V
L
interactions [46], or production of helix-stabilized
Fv fragments [47]) and for camelid V
H
Hs (production of a
bivalent camelid antibody with dual affinities by coupling
two V
H
H domains through a semirigid linker [48]). Mul-
timerization of V
NAR
domains, either through addition of
C-terminal dimerization domains, or by using single chain-

tion in sharks. Nature 374, 168–173.
6. Nuttall, S.D., Irving, R.A. & Hudson, P.J. (2000) Immuno-
globulin VH domains and beyond: design and selection of single-
domain binding and targeting reagents. Current Pharmaceut.
Biotechnol. 1, 253–263.
7. Diaz, M., Stanfield, R.L., Greenberg, A.S. & Flajnik, M.F. (2002)
Structural analysis, selection, and ontogeny of the shark new
antigen receptor (IgNAR): identification of a new locus pre-
ferentially expressed in early development. Immunogenetics 54,
501–512.
8. Muyldermans, S. (2001) Single domain camel antibodies: current
status. J. Biotechnol. 74, 277–302.
9. Flajnik, M.F. (1996) The immune system of ectothermic verte-
brates. Vet. Immunol. Immunopathol. 54, 145–150.
10. Nuttall, S.D., Krishnan, U.V., Hattarki, M., De Gori, R., Irving,
R.A. & Hudson, P.J. (2001) Isolation of the new antigen receptor
from Wobbegong sharks, and use as a scaffold for the display of
protein loop libraries. Mol. Immunol. 38, 313–326.
11. Roux, K.H., Greenberg, A.S., Greene, L., Strelets, L., Avila, D.,
McKinney, E.C. & Flajnik, M.F. (1998) Structural analysis of the
nurse shark (new) antigen receptor (NAR): molecular convergence
of NAR and unusual mammalian immunoglobulins. Proc. Natl
Acad. Sci. USA 95, 11804–11809.
12. Wu, T.T., Johnson, G. & Kabat. E.A. (1993) Length distribution
of CDRH3 in antibodies. Proteins 16, 1–7.
13. Vu, K.B., Ghahroudi, M.A., Wyns, L. & Muyldermans, S. (1997)
Comparison of llama VH sequences from conventional and heavy
chain antibodies. Mol. Immunol. 34, 1121–1131.
14. Muyldermans, S., Atarhouch, T., Saldanha, J., Barbosa, J.A. &
Hamers, R. (1994) Sequence and structure of VH domain from

M., Bernal, J. & Munoz, A. (1999) Identification of a mammalian
homologue of the fungal Tom70 mitochondrial precursor protein
import receptor as a thyroid hormone-regulated gene in specific
brain regions. J. Neurochem. 73, 2240–2249.
23. Huston, J.S. & George, A.J. (2001) Engineered antibodies take
center stage. Hum. Antibodies 10, 127–142.
Ó FEBS 2003 An IgNAR variable domain specific for human Tom70 (Eur. J. Biochem. 270) 3553
24. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seid-
man, J.G., Smith, J.A. & Struhl, K. (1989) Current Protocols in
Molecular Biology. John Wiley and Sons, New York.
25. Engberg, J., Andersen, P.S., Nielsen, L.F., Dziegiel, M., Johansen,
L.K. & Albrechtsen, B. (1996) Phage-display libraries of murine
and human antibody Fab fragments. Molec. Biotechnol. 6, 287–
310.
26. Galanis, M., Irving, R.A. & Hudson, P.J. (1997) Bacteriophage
library construction and selection of recombinant antibodies. In
Current Protocols in Immunology, pp. 17.1.1–17.1.45. John Wiley
and Sons, New York.
27. Coia, G., Ayres, A., Lilley, G.G., Hudson, P.J. & Irving, R.A.
(1997) Use of mutator cells as a means for increasing production
levels of a recombinant antibody directed against Hepatitis B.
Gene 201, 203–209.
28. Minsky, A., Summers, R.G. & Knowles, J.R. (1986) Secretion of
beta-lactamase into the periplasm of Escherichia coli: evidence for
a distinct release step associated with a conformational change.
Proc.NatlAcad.Sci.USA83, 4180–4184.
29. Gruen, L.C., Kortt, A.A. & Nice, E. (1993) Determination of
relative binding affinity of influenza virus N9 sialidases with the
Fab fragment of monoclonal antibody NC41 using biosensor
technology. Eur. J. Biochem. 217, 319–325.

Inhibition and versatility of binding topology. J. Biol. Chem. 277,
23645–23650.
39. Worn, A. & Pluckthun, A. (1998) An intrinsically stable antibody
scFv fragment can tolerate the loss of both disulfide bonds and
fold correctly. FEBS Lett. 427, 357–361.
40. Martineau, P. & Betton, J.M. (1999) In vitro folding and thermo-
dynamic stability of an antibody fragment selected in vivo for high
expression levels in Escherichia coli cytoplasm. J. Mol. Biol. 292,
921–929.
41. Tavladoraki, P., Girotti, A., Donini, M., Arias, F.J., Mancini, C.,
Morea, V., Chiaraluce, R., Consalvi, V. & Benvenuto, E. (1999) A
single-chain antibody fragment is functionally expressed in the
cytoplasm of both Escherichia coli and transgenic plants. Eur
J. Biochem. 262, 617–624.
42. Lo Conte, L., Chothia, C. & Janin, J. (1999) The atomic structure
of protein–protein recognition sites. J. Mol. Biol. 285, 2177–2198.
43. Wiedemann, N., Pfanner, N. & Ryan, M.T. (2001) The three
modules of ADP/ATP carrier cooperate in receptor recruitment
and translocation into mitochondria. EMBO J. 20, 951–960.
44. Crameri, A., Cwirla, S. & Stemmer, W.P. (1996) Construction and
evolution of antibody-phage libraries by DNA shuffling. Nat.
Med. 2, 100–102.
45. Coia, G., Hudson, P.J. & Irving, R.A. (2001) Protein affinity
maturation in vivo using E. coli mutator cells. J. Immunol.
Methods 251, 187–193.
46. Kortt, A.A., Dolezal, O., Power, B.E. & Hudson, P.J. (2001)
Dimeric and trimeric antibodies: high avidity scFvs for cancer
targeting. Biomol. Eng. 18, 95–108.
47. Arndt, K.M., Mu
¨