Cloning and characterization of CBL-CIPK signalling
components from a legume (Pisum sativum)
Shilpi Mahajan, Sudhir K. Sopory and Narendra Tuteja
Plant Molecular Biology, International Centre for Genetic Engineering and Biotechnology, New Delhi, India
In plants, calcium plays an important role in regula-
ting gene expression and many other processes inclu-
ding abiotic stress signalling. However, the molecular
mechanisms underlying the role of calcium in cellular
functions are not well established. Many external
stimuli including light and various stress factors can
bring out changes in cellular Ca
2+
level, which can
affect plant growth and development [1,2]. The Ca
2+
serves as second messenger and its concentration is
delicately balanced by the presence of ‘Ca
2+
stores’
such as vacuoles, endoplasmic reticulum, mitochon-
dria and cell wall. Ca
2+
signals exhibit a high degree
of specificity and are decoded by Ca
2+
sensing
proteins known as Ca
2+
sensors, which are small
proteins interacting with their target proteins to relay
the signal. In plant cells many Ca

CBL cDNA); AY883569 (pea CBL genomic
clone); AY191840 (pea CIPK cDNA).
(Received 7 October 2005, revised 11
December 2005, accepted 19 December
2005)
doi:10.1111/j.1742-4658.2006.05111.x
The studies on calcium sensor calcineurin B-like protein (CBL) and CBL
interacting protein kinases (CIPK) are limited to Arabidopsis and rice and
their functional role is only beginning to emerge. Here, we present cloning
and characterization of a protein kinase (PsCIPK) from a legume, pea,
with novel properties. The PsCIPK gene is intronless and encodes a protein
that showed partial homology to the members of CIPK family. The recom-
binant PsCIPK protein was autophosphorylated at Thr residue(s). Immu-
noprecipitation and yeast two-hybrid analysis showed direct interaction of
PsCIPK with PsCBL, whose cDNA and genomic DNA were also cloned in
this study. PsCBL showed homology to AtCBL3 and contained calcium-
binding activity. We demonstrate for the first time that PsCBL is phos-
phorylated at its Thr residue(s) by PsCIPK. Immunofluorescence ⁄ confocal
microscopy showed that PsCBL is exclusively localized in the cytosol,
whereas PsCIPK is localized in the cytosol and the outer membrane. The
exposure of plants to NaCl, cold and wounding co-ordinately upregulated
the expression of PsCBL and PsCIPK genes. The transcript levels of both
genes were also coordinately stimulated in response to calcium and salicylic
acid. However, drought and abscisic acid had no effect on the expression
of these genes. These studies show the ubiquitous presence of CBL ⁄ CIPK
in higher plants and enhance our understanding of their role in abiotic and
biotic stress signalling.
Abbreviations
3-AT, 3-aminotrizole; ABA, abscisic acid; CaM, calmodulin; CBL, calcineurin B-like protein; CDPK, Ca
2+

might provide a novel mechanism to integrate and
specifically decode signals in plants [12,13]. Recent
studies in Arabidopsis indicated that several such
genes function in stress [12,14–21]. Except in Arabid-
opsis and rice the CBL–CIPK pathways have not
been well studied in higher plants.
In this report, we describe the cloning and charac-
terization of a novel CIPK and its interacting partner
CBL from Pisum sativum. PsCIPK showed auto-
phosphorylation and could phosphorylate pea CBL
and other substrates such as casein. The mRNA lev-
els of PsCIPK were coordinately upregulated along
with CBL, in response to various abiotic and biotic
stresses, and to calcium and salicylic acid, but not to
abscisic acid (ABA) or dehydration. PsCIPK showed
dual localization (in the cytosol and the plasma mem-
brane) while CBL was localized exclusively in the
cytosol.
Results
Isolation and sequence analysis of PsCIPK and
CBL cDNAs and genomic clones
For cDNA cloning, first partial fragments of 550 bp for
PsCIPK and 335 bp for PsCBL were amplified by PCR
using double-stranded cDNAs (prepared from mRNA
isolated from NaCl-stressed pea seedlings) as template
and the degenerate primers, designed from the conserved
areas of AtCIPK and AtCBL of Arabidopsis, respect-
ively (data not shown). The cDNA clones of CIPK
(pBS-PsCIPK) and CBL (pBS-PsCBL) were obtained
by screening the pea cDNA library with respective par-

(AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre-
sents the modified amino acids alanine (A) as compared to the oxygen containing-calcium binding residue aspartate (D). The conserved dis-
tances between EF hands are marked. Multiple alignments were performed using
CLUSTAL W. The program recognizes a consensus residue
and based on that residue other amino acids that fall in that consensus position are marked. The most identical amino acids at each protein
are dark shaded and similar ones are light shaded whereas nonsimilar ones are left unshaded. The amino acids marked by red, blue, green
and pink lines indicates the putative casein kinase II, protein kinase C, the cAMP- and cGMP-dependent protein kinase and putative tyrosine
kinase phosphorylation sites, respectively.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
908 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
A
B
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 909
The amino acid sequence alignment of PsCBL with
rice CBL (OsCBL) and Arabibopsis CBL (AtCBL3) is
shown in Fig. 1B. It lacks the myristoylation site in
the N-terminal sequence. PsCBL contains four EF
hand Ca
2+
-binding domains (Fig. 1B). The EF1 shows
variation from the canonical EF hand. The amino acid
D at position 1, of EF1 is replaced by amino acid A
(Fig. 1B). The EF1 and EF2 are 22 amino acids apart,
whereas EF2 and EF3, and EF3 and EF4 are 25 and
32 amino acids apart, respectively (Fig. 1B). The cal-
cineurin A binding domain is also present between
positions 155 and 172 (Fig. 1B). Phylogenetic analysis
indicated the identity of PsCBL with OsCBL (Acces-
sion no. AAR01663), AtCBL3 (AAM91280), AtCBL2

clone reveals that the PsCBL genomic clone spans
2.547 Kb (Accession no. AY883569) (from ATG to
TAA). Alignment of the genomic sequence with the
cDNA sequence identified eight exons (121, 82, 59, 108,
52, 80, 112, and 58 bp in size) and seven introns (331,
223, 682, 346, 80, 109, and 92 bp in size) (Fig. 2A).
Two introns of 401 and 81 bp were found localized in
the 5¢ UTR region (Fig. 2A). Most of the 3¢ and 5¢
splice junctions follow the typical canonical consensus
dinucleotide sequence GU-AG found in other plant in-
trons. Figure 2B shows the genomic organization of
AtCBL3 (Accession no. AT4G265702) containing seven
exons and six introns. The sizes of all the exons except
exon 5 were found to be mostly conserved between
PsCBL and AtCBL3 (Fig. 2A and B). The PsCBL gene
has an additional splice site at the fifth exon. Accord-
ingly; there was one intron fewer in AtCBL3 as com-
pared to PsCBL (Fig. 2A and B). The sizes of introns
are not conserved between the two species (Fig. 2A
and B).
Tissue distribution of PsCBL and CIPK and their
copy number in pea genome
The transcript levels of PsCIPK and PsCBL in
different tissues of pea were studied by northern
A
B
Fig. 2. Genomic organization of PsCBL. The schematic representation of the exon–intron organization of genomic PsCBL clone (A) and the
Arabidopsis homologue (AtCBL3) clone (B). Closed boxes represent exons, and lines between closed boxes represent introns. The dark
boxes represent the UTRs. The position of ATG and TAA are marked. The numbers below the lines and the above boxes indicate the sizes
(bp) of introns and exons, respectively.

enzymes such as SpeI and SacI, which had a single
specific restriction site in the gene gave two bands
after hybridization (lanes 2 and 5).
Expression and purification of PsCIPK and PsCBL
The pea cDNA encoding CIPK and CBL were cloned
into the expression vector pET28a and the recombin-
ant proteins were expressed in Escherichia coli.
SDS ⁄ PAGE analysis showed a highly expressed a
58 kDa additional polypeptide for PsCIPK (Fig. 4A,
lane 2) and a 26 kDa additional polypeptide for
PsCBL (Fig. 4G, lane 2) in isopropyl thio-b-d-gal-
actoside (IPTG) induced fractions, respectively, as
compared to uninduced (lane 1). The recombinant
PsCIPK and PsCBL were present in the soluble frac-
tions and therefore purified in the soluble form
through a single Ni
2+
–NTA–agarose column chroma-
tography step. PsCIPK and PsCBL proteins, purified
to near homogeneity, showed a 58-kDa (Fig. 4A, lane
3) and a 26-kDa band (Fig. 4G, lane 3), respectively.
In western blotting, the anti-PsCIPK and PsCBL
antibodies detected PsCIPK as a single band of
58 kDa (Fig. 4B, lane 2 and 3, respectively) and a
single band 26 kDa of PsCBL (Fig. 4H, lane 2 and 3)
in the IPTG-induced fraction and in the purified
fraction. There was no signal in the uninduced frac-
tion of PsCIPK (Fig. 4B, lane 1) or PsCBL (Fig. 4H,
lane 1). The purified PsCIPK and PsCBL proteins
were also recognized by anti-His antibody (data not

2+
(Fig. 4J,
lane 1), while negative controls (glutathione S-trans-
ferase and BSA) lack the binding (Fig. 4J, lanes 4
and 5). Similar results were obtained with dot blot
analysis (Fig. 4K). In Fig. 4K, spots 1 and 2 are
PsCBL protein (3 and 4 lg), lanes 3 and 4 are the
same negative controls and lane 5 is the positive
NU
1caS
1RocE
11lgB
1ed
N
111dn
i
H
A CIPK
1abX
12.0
0.5
1.0
1.6
2.0
3.0
4.0
5.0
7.0
1epS
B CBL

)1
) in the presence and absence of
Ca
2+
was markedly different (Fig. 4L). The spectrum
of PsCBL changed significantly when Ca
2+
was
either added or depleted by the addition of EGTA
(Fig. 4L). No significant change in the spectra of the
AB
CD
E
F
H
IJ
L
K
G
Fig. 4. Purification of PsCIPK and PsCBL proteins and their activities. (A) Induction and purification of overexpressed PsCIPK in E. coli is
shown on SDS ⁄ PAGE. Lane M, Molecular weight marker; lane 1, uninduced; lane 2, IPTG induced; lane 3, PsCIPK protein after Ni
2+
–NTA–
agarose column chromatography. The protein size markers are indicated at the left side of the gel. (B) Western blot analysis of the same
protein fractions of lanes 1–3 as shown in panel (A) using polyclonal anti-PsCIPK antiserum. (C, D) Autophosphorylation of PsCIPK and phos-
phorylation of PsCBL by PsCIPK. PsCIPK protein in the presence of Mn
2+
(lane 1), Mg
2+
(lane 2), PsCBL plus Mn

2+
binding. Only PsCBL (lane 2 and 3) and the positive control
(lane 1) showed Ca
2+
-binding capability. (K) Dot blot analysis of the same protein samples (as in panel I) followed by
45
Ca
2+
overlay assay to
confirm the
45
Ca
2+
binding data. Spots 1 and 2, PsCBL proteins (3 and 4 lg); lanes 3 and 4, negative controls; lane 5, positive control. (L)
CD spectra of PsCBL, calcium-bound PsCBL and the calcium-bound PsCBL treated with 1.25 m
M EGTA.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
912 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
protein was observed by the addition or depletion of
Mg
2+
(data not shown). These results suggest that
PsCBL changes its conformation in a Ca
2+
-depend-
ent manner.
PsCIPK phosphorylates PsCBL at Thr residue(s)
To determine whether PsCIPK is a functional protein
kinase, the autophosphorylation and substrate phos-
phorylation activities of the enzyme were checked by

in
the reaction buffer (data not shown). This data is sim-
ilar to that reported earlier for AtCIPK1, where no
effect was noted on substrate phosphorylation (MBP
and casein) in the presence or absence of any exogen-
ously supplied Ca
2+
in the reaction buffer [10].
For phosphoamino acid analysis, the radioactive
autophosphorylated 58-kDa band of PsCIPK and the
26-kDa band of PsCBL from the above gel were
excised, acid hydrolysed and subjected to paper chro-
matography. The results show that PsCIPK phos-
phorylates PsCBL at Thr residue(s) (Fig. 4E, lane 1)
and also becomes autophosphorylated at its Thr resi-
due(s) (Fig. 4E, lane 2). PsCBL did not show any
autophosphorylation, as without any kinase there was
no phosphorylation of CBL (data not shown).
To confirm the phosphorylation activity of
PsCIPK, an immunodepletion experiment was per-
formed as follows. Purified PsCIPK was reacted sepa-
rately with IgG purified from the sera of preimmune
rabbit and a rabbit immunized with PsCIPK. The
antigen–antibody complex was removed by protein A-
Sepharose. The supernatant was analysed for PsCIPK
activity to phosphorylate PsCBL. Results revealed
that immunodepletion of PsCIPK in the extract
decreased the phosphorylation of PsCBL significantly
(Fig. 4F, lane 3),whereas there was no reduction of
PsCIPK activity to phosphorylate PsCBL in the sam-

trol, an ABA responsive gene PDH45 (see Fig. 5 leg-
ends). was used. The transcript level of PDH45
strongly increased from 12 to 24 h under similar
experimental conditions (Fig. 5M).
Calcium upregulates PsCIPK and PsCBL in a
dose-dependent manner
As PsCIPK and PsCBL are strongly upregulated in
response to various abiotic and biotic stresses and as the
signalling pathway for these stresses are often mediated
by Ca
2+
, the effect of exogenous Ca
2+
was analysed on
the transcript levels of both the genes. As shown in
Fig. 5N the transcript level of PsCIPK was upregulated
in response to Ca
2+
, reaching a maximum at 10 mm
and declined at higher Ca
2+
concentrations (Fig. 5N).
The transcript level of PsCBL was strongly upregulated
by Ca
2+
. The level started increasing at 5 mm of exo-
genously supplied Ca
2+
and the maximum level was
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL

18 S
1.0
kb
18 S
1.0
kb
18 S
1.0
kb
PsCIPK
A
C
E
G
I
K
N
18 S
1.8
kb
18 S
1.8
kb
18 S
1.8
kb
18 S
1.8
kb
18 S

wounding (E and F), drought (G and H), SA (I and J), ABA (K and L) and calcium (N and O). Panel M is the control for ABA responsive gene,
PDH45 [35]. The RNAs (50 lg) samples were separated by electrophoresis, blotted and hybridized with the [a-
32
P]dCTP-labelled PsCIPK (1.2-Kb
fragment from 3¢ end containing the 3¢ UTR) (panels A, C, E, G, I, K and N), and [a-
32
P]dCTP-labelled PsCBL cDNA (0.97 Kb, full-length) probes
(panels B, D, F, H, J, L, and O). For each stress examined the upper panel shows the autoradiograph of transcript (1.8 Kb for PsCIPK and 1 Kb
for PsCBL), while the lower panel shows the hybridization of same blot with 18S rRNA gene (loading control). In each panel, lane 1 is the control
(C) without any treatment while other lanes are the RNAs samples collected after stress treatments at the indicated time points.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
914 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
In vitro interaction of PsCBL with PsCIPK protein
by far-western blotting
As the two genes (PsCBL and PsCIPK) showed a sim-
ilar and synchronized transcript profile, we speculated
that these may interact with each other. We studied
the interaction of PsCBL with PsCIPK by the far-
western method (see Experimental procedures). Briefly,
the two proteins and controls were separated by
SDS ⁄ PAGE, transferred to nylon membrane and then
renatured on the membrane. Next they were incubated
with the second protein PsCBL in the presence or
absence of CaCl
2
(1 mm), followed by western blotting
with anti-CBL IgG. The results of far-western blotting
showed that PsCBL binds to PsCIPK, which was
recognized by anti-CBL IgG (Fig. 6B, lanes 1 and 2).
This binding is calcium dependent as no signal was

47
26
80
58
47
26
80
kDa
kDa
Ponseu-S Immuno blot
Ponseu-S Immuno blot
0.5
1.0
1
2
3
4
5
6
1.6
1.0
2.0
3.0
2.0
kb kb
Fig. 6. Direct interaction of PsCBL and PsCIPK proteins, in vitro,as
well as via a yeast two-hybrid system. (A, B) PsCBL interacts with
PsCIPK in vitro. PsCIPK prephosphorylated (2 lg, lane 1), PsCIPK
(2 lg, lane 2), pea helicase (PDH47) [36] (6 lg, lane 3, negative
control), pea MCM7 (3 lg, lane 4, negative control) and PsCBL

FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 915
ment was performed by incubating the same proteins
on the membrane with the PsCIPK followed by West-
ern blotting with anti-CIPK antibodies (Fig. 6C and
D). The results show that PsCIPK can also bind to
PsCBL (Fig. 6D, lane 5). PsCIPK did not bind to the
negative controls (Fig. 6D). Figure 6C is a Ponceau-S
stained membrane.
Interaction of PsCBL with PsCIPK via yeast
two-hybrid system
The complete ORF of PsCBL (678 bp) was cloned into
the NcoI and EcoRI sites of yeast two-hybrid binding
domain vector (pGBKT7). The resulting construct
(pGBKT7-PsCBL or BD-CBL) was verified by sequen-
cing and digestion with NcoI and EcoRI to give a band
of 678 bp (Fig. 6E, lane 2). On the other hand the com-
plete ORF of PsCIPK (1.5 Kb) was cloned into the
EcoRI and XhoI sites of yeast two-hybrid activating
domain vector (pGADT7). The resulting construct
(pGADT7-PsCIPK or AD-CIPK) was verified by
sequencing and digestion with EcoRI and XhoI to give
a band of 1.5 Kb on gel electrophoresis (Fig. 6F, lane
2). The Saccharomyces cervisiae AH109 cells were co-
transformed with both the constructs (BD-PsCBL plus
AD-PsCIPK) as well as with several combinations of
plasmids which served as controls for this experiment.
Interactions between PsCBL and PsCIPK were deter-
mined by growth of the cotransformants on the selec-
tion media of synthetic dextrose (SD) lacking Leu, Trp,
and His (SD-Leu

medium (Fig. 6I). In a selection medium
lacking Leu, Trp and His (SD-Leu
–
Trp
–
His
–
+15mm
3-AT) only selected clones of cotransformants (BD-
PsCBL plus AD-PsCIPK) and the positive control, in
which the HIS3 gene was transactivated grew (Fig. 6J).
This confirmed the interaction of PsCBL and PsCIPK
proteins. The results from b-galactosidase filter assay
of colonies of cotransformants (BD-PsCBL plus AD-
PsCIPK) further confirmed the interaction between
PsCBL and PsCIPK (Fig. 6K, blue colonies). Domain
swapping was also performed in which PsCBL was
cloned in pGADT7 and PsCIPK was cloned in
pGBKT7 and similar interaction results were obtained
(data not shown). The results show that PsCIPK inter-
acts with PsCBL in a yeast two-hybrid system. A
PsCIPK mutant with a deletion in the autoinhibitory
(NAF) motif failed to interact with PsCBL thus con-
firming the authenticity of these proteins and emphasi-
zing the importance NAF in the interaction between
them (data not shown).
Localization by immunofluorescence labelling
and confocal microscopy
Localization of PsCIPK and PsCBL was analysed by
immunofluorescence labelling of tobacco BY2 cells fol-

not clear. Moreover, the existence, interaction, and
role of CBL ⁄ CIPK members in other plants has not
been well studied and characterized. Because these
genes are among the master switches controlling the
major genes in the signalling pathway, much more
effort should be invested in analysing the role of these
genes in higher plants. Here, we report the isolation
and characterization of a novel CIPK from a legume,
Pisum sativum (pea) and show that it interacts and
phosphorylates a CBL having homology to AtCBL3.
Both PsCIPK and PsCBL genes showed delayed tran-
scriptional upregulation in response to stresses. This
kinase showed dual localization in the cytosol and in
the plasma membrane.
Characterization of PsCIPK and its interacting
PsCBL
Sequence analysis of PsCIPK showed that it has low
similarity (67%) to AtCIPK12, which also has not
been well characterized. Regarding PsCBL, the amino
acid sequence alignments revealed that PsCBL is more
similar to rice CBL (92%) and AtCBL3 (90%). All 10
AtCBL genes are reported to contain introns and only
eight of 25 AtCIPK genes contain multiple intron
sequences [15]. Like AtCBL3, PsCBL also contains
two introns in the 5¢ UTR region [15]. The regulatory
function of such an unusual composition of introns
needs to be experimentally verified. In rice also all of
the 10 OsCBLs genes contain introns, while eight of 30
DEF
ABC

required for calcium binding. Using a
45
Ca
2+
overlay
assay and the CD spectra analysis, PsCBL was found
to be a functional calcium binding protein. The CD
spectrum data also shows that PsCBL changes its con-
formation in a Ca
2+
-dependent manner, and thereby
functions as a molecular switch through the EF hands,
as also reported for AtCBL2 [23].
PsCIPK directly interacts with PsCBL and shows
dual localization
Previous studies have shown that CBL interacts with
CIPKs and some specificity is maintained in this
interaction [13]. AtCBL1 has been shown to interact
in vivo with only six AtCIPK members (1, 7, 8, 17,
18 and 24) while AtCBL9 interacts with AtCIPK1,
8, 18, 20, 23 and 24 [15]. In another study AtCBL1
has been shown to interact with AtCIPK15 [18].
AtCBL 2 and 3 seem to interact with AtCIPK 4, 7,
12 and 13 [13]. In the present study we found that
PsCBL has significant homology (90%) to AtCBL3,
while PsCIPK has lower homology (67%) with
AtCIPK12 and 24. However, both PsCIPK and
PsCBL interacted with each other. This interaction
in vitro is calcium dependent.
Some structural features of CBLs are known to be

zed in the plasma membrane [22]. Whether PsCIPK
phosphorylates SOS1-like protein needs to be stud-
ied. PsCIPK may interact with a myristoylated mem-
ber of CBL, which recruits it to the plasma
membrane.
Phosphorylation of PsCBL by PsCIPK
Similar to all the CIPKs, the PsCIPK also contain an
activation loop and an autoinhibitory NAF motif,
which is known to regulate its kinase activity. We
found that PsCIPK becomes autophosphorylated at its
Thr residue. The in silico analysis of the CBL primary
sequence revealed that it has potential phosphorylation
sites. This prompted us to check if CBL could be
phosphorylated by its interacting kinase, PsCIPK. The
different substrates, which are phosphorylated by CIP-
Ks, are not well characterized. It was shown earlier
that SOS2 ⁄ CIPK24 phosphorylates and activates SOS1
[22]. In this study we show that CBL is a phosphopro-
tein and is used as a substrate for phosphorylation by
PsCIPK at Thr residue(s). The extent of phosphoryla-
tion was found to be similar in the presence of Mg
2+
and Mn
2+
. Earlier, Mn
2+
was shown to be the pre-
ferred ion for AtCIPK1, which, unlike PsCIPK, phos-
phorylates at both Ser and Thr residues [10]. This
shows that PsCIPK is different from AtCIPK1. This is

in response to various stresses. For example AtCBL1
gene expression was reported to be induced by cold,
salt, wounding, and drought, whereas AtCBL9 expres-
sion did not respond to these stimuli [8,15]. All of
these studies provide evidence that different AtCBL
members perform different functions under various
stress conditions.
Previously, it was shown that two of the AtCBLs,
AtCBL2 and 3, show constitutive expression in
response to abiotic stresses [8]. Although PsCBL is a
homologue of AtCBL3, we found that its expression
was upregulated strongly in response to cold, salinity
and wounding. The difference in the two studies
seems to be due to the fact that the authors investi-
gated the transcripts only at the earlier time points
(until 6 h in cold, and 2 h in wounding). As seen in
the present study, the upregulation of PsCBL tran-
script starts from 9 h in cold and 12 h in salt, reach
a maximum by 15 h and are then maintained till
24 h. This suggests that PsCBL may play a major
role in the maintenance of the stress response. Whe-
ther AtCBL3 also gets upregulated in the later time
points needs to be experimentally verified. The delay
in upregulation of transcript level in response to var-
ious stress conditions could be due to some of the
effects initiated following physiological changes in
growth and metabolism. Alternatively the basal tran-
script level and protein may be involved in signalling
in response to stress. However, for sustained
response an increase in the transcript and protein

expression of PsCBL and PsCIPK. In the case of
PsCBL and PsCIPK, even though maximum increase
in the transcript level was obtained at 50 and 10 mm
CaCl
2
, respectively, the stimulatory effects were seen at
a much lower concentration of 5 mm CaCl
2.
. Similar
treatments to exogenous CaCl
2
have been reported
[28]. As these treatments were applied whole plants
and not to isolated protoplasts ⁄ cells the actual uptake
of CaCl
2
by the plant may be much lower. This effect
seems to be specific for Ca
2+
, as the addition of Mg
2+
had no effect. Whether calcium exerts its effect directly
as a signal transduction molecule or if it alters cell wall
and membrane properties which in turn bring about
these effects needs to be further investigated. Earlier,
rice CIPK was shown to be upregulated in response to
multiple signals and also in response to calcium [29].
Thus, calcium seems to affect the regulation of the
CBL ⁄ CIPK pathway by binding to calcium sensor
CBL, and also upregulates the expression of genes

plex formation is one of the mechanisms for generating
response specificity in the plant cells. In the present
study the coordinated transcript data and the in vivo
and in vitro interaction data both provide corroborat-
ive evidence that these two genes function in a similar
pathway. These studies suggest that the CBL ⁄ CIPK
signalling pathway in pea functions in responses to
both abiotic and biotic stresses via an ABA-independ-
ent pathway and should make an important contribu-
tion to our understanding of the role of CBL ⁄ CIPK in
calcium and stress signalling in higher plants.
Experimental procedures
Plant growth and treatment
Pea (Pisum sativum) seeds were surface-sterilized in a solu-
tion of Clorox plus 0.05% Triton X-100 for 10 min, washed
with sterilized water three times and imbibed in sterilized
water for at least 4 h. These presoaked seeds were germina-
ted in the sterilized wet vermiculite (for cDNA library pre-
paration) or on wet germination paper (for treatment)
under a 14 ⁄ 10-h light ⁄ dark cycle at 25 °C for 7 days. For
treatment under different stress conditions, 7-day old pea
seedlings grown on wet germination paper were used. For
cold treatment, the seedlings were transferred to the 4 °C
cold chamber under white light. The control plants were
kept at 25 °C in growth chamber under constant light. For
salt treatment, the seedlings were further grown in 150 mm
NaCl solution by dipping the roots only for the requisite
time periods. Wounding was performed by puncturing
leaves with a hemostat as described by Kudla et al. [8].
Typically, at least 80% of the leaves in the treated set were

thesized from salt-stressed pea seedlings (150 mm
NaCl · 24 h) for use as a template for PCR cloning of
partial cDNAs of CBL and CIPK in the following step.
Isolation of PsCIPK and PsCBL cDNA clones and
their sequence analysis
Basically, both CIPK and CBL cDNAs were first partially
cloned by PCR and then followed by isolation of full-length
clones by library screening. For partial cloning of pea CIPK
(PsCIPK) or pea CBL (PsCBL), all the known sequences of
AtCIPK or AtCBL genes were first aligned and degenerate
primers were designed from the most conserved areas. For
PsCIPK, primer pair, Oligo-1 (forward) and Oligo-2 (reverse)
(Table 1) were used for PCR. For CBL, primer pair, Oligo-3
(forward) and Oligo-4 (reverse) (Table 1) were used for PCR.
In PCR reactions, using respective primer pairs and salt-
stressed double-stranded cDNAs as a template, partial frag-
ments of 550 bp for PsCIPK and 335 bp for PsCBL were
amplified. For cloning the full-length cDNAs of PsCIPK
and PsCBL, these partial fragments of CIPK (550 bp) and
CBL (335 bp) were radiolabelled and used as probes to
screen the pea cDNA library.
Sequencing of cDNAs was performed using the dideoxy
chain termination method by using sequenase version 2 kit
(US Biochemicals, Cleveland, OH). Most of the routine
sequence (DNA and amino acid) analysis was performed
using macvector (v7; Oxford Molecular Group). Homol-
ogy search was performed using fasta and multiple
sequence alignment was done using clustal w alignment
programs.
Isolation of PsCIPK and PsCBL genomic clones

time. About 50 lg of total RNA was resolved by electro-
phoresis in a 1% agarose gel containing 5.5% formalde-
hyde, and trans-blotted onto Hybond N
+
membrane with
10 · NaCl ⁄ Cit as a transfer buffer.
For Southern analysis genomic DNA (30 lg) was extrac-
ted from pea leaves by standard cetyltrimethylammonium
bromide (CTAB) (Sigma, St Louis, MO, USA) method and
digested with an excess of restriction enzymes, electrophore-
sed on a 0.75% agarose gel, and transferred to a nylon
membrane (Hybond N
+
).
The RNA and genomic DNA blots were hybridized with
[a-
32
P]dCTP-labelled (nick translated) 1.2-Kb fragment of
PsCIPK cDNA (from the 3¢ end containing the 3¢ UTR)
and 0.97-Kb PsCBL cDNA (full-length) probes at 58 °Cin
5 · NaCl ⁄ Cit, 5 · Denhardt’s, 0.1% SDS, 100 lgÆmL
)1
denatured salmon sperm DNA for 16–18 h. After hybrid-
ization the blots were washed twice for 15 min at low strin-
gency (2 · NaCl ⁄ Cit + 0.1% SDS at 50 °C) and twice for
10 min at high stringency (0.1 · NaCl ⁄ Cit + 0.1% SDS at
55 °C) followed by autoradiography. The transcript levels
were estimated by scanning the autoradiograph using a
laser densitometer (Diversity 1, PDL, Version 6.1, New
York).

55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)
65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse)
75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5¢UTR forward)
85¢-ACTCGTAGC-ACAGAGACAGAG-3¢ PsCBL (3¢UTR reverse)
95¢-ATGGCAGTAGTAGCAG-CTCC-3¢ PsCIPK (gene specific forward)
10 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ PsCIPK (gene specific reverse)
11 5¢-ATGTTGCAGTGCTTAGAGGGA-3¢ PsCBL (gene specific forward)
12 5¢-TTAAGTATCATCTACTTGTGAATG-3¢ PsCBL (gene specific reverse)
13 5¢-CCTCCG
GAATTCATGGCAGTAGTAGCAGCTCC-3¢ PsCIPK [(gene specific forward
contains EcoR1 site (underlined)]
14 5¢-CCGCCG
CTCGAGTCAGGTGTCTAAGTTCAGAGATTC-3¢ PsCIPK [gene specific reverse
contains XhoI site (underlined)]
15 5¢-GCCATGC
CATGGCAATGTTGCAGTGCTTAGAGGGA-3¢ PsCBL [gene specific forward
contains NcoI site (underlined)]
16 5¢-GCCG
CTCGAGTCAGTGGTGGTGGTGGTGGTGAGTATCATCTACTTG
-TGAATGG-3¢
PsCBL [gene specific reverse
contains XhoI site (underlined) and
His-tag sequence (typed in bold)]
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 921
agarose (Qiagen, GmbH, Hilden, Germany) column and
the truncated proteins cannot bind). The primers were:
Oligo-15 (forward) containing an Nco1 site and Oligo-16
(reverse) containing Xho1 site and His-tag sequence
(Table 1). This resulted in the construction of plasmid

rabbits and western blotting was performed using standard
protocols. The vertebrates (rabbits) in the experiments were
used as per approval of the animal ethics committee of the
Institute (ICGEB, New Delhi, India).
Protein kinase assay
Phosphorylation was measured as the incorporation of
radioactivity from c-
32
P-ATP into the PsCIPK (auto-
phosphorylation) or into the substrate proteins. The puri-
fied recombinant PsCIPK protein (0.5 lg) alone for
autophosphorylation or in the presence of the substrate
(PsCBL or casein) was incubated in the kinase buffer
[10 lCi-c
32
P-ATP, 20 mm Tris ⁄ HCl pH 8.0, either 5 mm
MgCl
2,
or MnCl
2,
1mm CaCl
2
, 0.1 mm EDTA, and 1 mm
dithiothreitol (DTT)] for 5 min at 30 °C. The reaction was
stopped by the addition of 4 · SDS sample buffer and ana-
lysed by SDS ⁄ PAGE (10%) and autoradiography. PsCIPK
was immunodepleted by addition of PsCIPK antibodies
(IgG) in a standard phosphorylation reaction containing
1mm CaCl
2

lowed by electro-transfer of the proteins onto PVDF mem-
brane. The proteins on the membrane were denatured and
then gradually renatured by incubating in 6 m guani-
dine ⁄ HCl (made up in HSM buffer: 25 mm Hepes ⁄ KOH
pH 7.7, 25 mm NaCl, 5 mm MgCl
2
) for 2 · 5 min at 4 °C.
This was followed by incubation for 6 · 10 min in a serial
dilution (1 : 1) of denaturation buffer in HSM buffer 2
(containing 1 mm DTT) at 4 °C. The membrane was
blocked in HSM buffer containing 1 mm DTT, 0.5% NP-
40 and 3% BSA for 1 h at 4 °C, followed by washing the
membrane twice in the same solution containing 1% BSA.
For dot blotting, the purified recombinant PsCBL protein
(2 and 4 lg) along with appropriate controls was spotted
onto the PVDF membrane (in dot blot analysis the proteins
were already in a native condition and thus proceeded with-
out denaturation and renaturation steps). After transferring
or spotting, the membrane was equilibrated in the buffer
containing 10 mm Imidazole ⁄ HCl (pH 6.8), 60 mm KCl,
and 5 mm MgCl
2
for 3 h at room temperature. The radio-
active
45
Ca
2+
(1.97 lCiÆlL
)1
, Amersham, Boston, MA,

on SDS ⁄ PAGE, transferred on nylon membrane, stained
with Ponceau-S. The proteins were renatured on the mem-
brane, incubated with second protein, and the interaction
was detected by western blotting using the antibodies
against the second protein [33].
Yeast two-hybrid assay
A Gal4-based two-hybrid system was used as described by
the manufacturer (Clonetech, Palo Alto, CA). The coding
region of PsCBL (678 bp) was amplified by PCR with
primers harbouring restriction sites, cloned in frame into
the Nco1 and EcoR1 sites of the DNA binding domain
vector (pGBKT7, Clonetech). For PCR amplification the
primers used were: Oligo-13 (forward) and Oligo-14
(reverse) (Table 1). This resulted in the construction of the
vector pGBKT7-PsCBL whose sequence was verified before
using for yeast transformation. The coding region of the
PsCIPK (1553 Kb) was amplified by PCR with primers
harbouring restriction sites, cloned in frame into the EcoR1
and Xho1 sites of the activation domain vector (pGADT7,
Clonetech). For PCR amplification the primers used were:
Oligo-15 and Oligo-16 (Table 1). This resulted in the con-
struction of the vector pGADT7-PsCIPK whose sequence
was verified before using for yeast transformation. Both the
above vectors were cotransformed into yeast strain AH109
harbouring two reporter genes (HIS3 and b-galactosidase)
by the lithium acetate method [34]. [Note: AH109 contains
integrated copies of ADE2, HIS3 and lacZ (MAL1) repor-
ter genes under the control of distinct GAL4 upstream acti-
vating sequences (UAS) and TATA boxes. These promoters
yield strong and very specific responses to GAL4]. Yeast

cells were then incubated with Alexa fluor 488-labelled goat
antirabbit secondary antibody (Molecular Probes, Eugene,
OR) in 1 : 3000 dilution for 3 h and then washed five times,
5 min each with 1 · NaCl ⁄ P
i
. The cells were counter-
stained with DAPI (0.2 lgÆmL
)1
) for 15 min just before
mounting the slide in Antifade solution (Fluroguard, Bio-
Rad, Hercules, CA, USA). Confocal laser scanning (Radi-
ance 2100, Bio-Rad) was performed under a Nikon micro-
scope (objective Plane Apo 60 ·X ⁄ 1.4 oil, Japan). The
excitation wavelength for Alexa fluorescence was 488 nm
(argon laser) and fluorescence detected through emission fil-
ter HQ515 ⁄ 30 (high-quality band pass), centred at 515 nm
with 30 nm bandwidth. DAPI fluorescence was excited by
blue diode (405 nm) and detected through emission filter
HQ442 ⁄ 45. Image processing was carried out with lazer-
sharp (Bio-Rad) and photoshop 5.5 (Adobe systems, San
Jose, CA) was used for final image assembly.
Acknowledgements
We sincerely thank Dr Renu Tuteja (ICGEB, New
Delhi) and Dr Anil Jaiswal (Baylor College of Medi-
cine, Houston, TX, USA) for critical reading, helpful
comments on the manuscript. We thank the Depart-
ment of Biotechnology, Government of India grant for
partial support and Council of Scientific and Industrial
Research, New Delhi for a fellowship to S.M. An
International Senior Research Fellowship from the

sis are differentially regulated by stress signals. Proc
Natl Acad Sci USA 96, 4718–4723.
9 Sanchez-Barrena MJ, Martinez-Ripoll M, Zhu JK &
Albert A (2005) The structure of the Arabidopsis thali-
ana SOS3: molecular mechanism of sensing calcium for
salt stress response. J Mol Biol 345, 1253–1264.
10 Shi J, Kim KN, Ritz O, Albrecht V, Gupta R, Harter
K, Luan S & Kudla J (1999) Novel protein kinases
associated with calcineurin B-like calcium sensors in
Arabidopsis. Plant Cell 11, 2393–2405.
11 Kim KN, Cheong YH, Gupta R & Luan S (2000) Inter-
action specificity of Arabidopsis calcineurine B-like cal-
cium sensor and their target kinases. Plant Physiol 124,
1844–1853.
12 Guo Y, Halfter U, Ishitani M & Zhu JK (2001) Mole-
cular characterization of functional domains in the pro-
tein kinase SOS2 that is required for plant salt
tolerance. Plant Physiol 13, 1383–1400.
13 Albrecht V, Ritz O, Linder S, Harter K & Kudla J
(2001) The NAF domain defines a novel protein–protein
interaction module conserved in Ca
2+
-regulated kinase.
EMBO J 20, 1051–1063.
14 Gong D, Guo Y, Schumaker K & Zhu JK (2004) The
SOS3 family of calcium sensors and SOS2 family of
protein kinases in Arabidopsis. Plant Physiol 134, 919–
926.
15 Kolukisaoglu U, Weinl S, Blazevic D, Batistic O &
Kudla J (2004) Calcium sensors and their interacting

H, Sato M & Shimizu T (2003) The crystal structure of
the novel calcium-binding protein at CBL2 from Arabi-
dopsis thaliana. J Biol Chem 278, 42240–42246.
23 Shi H, Kim YS, Guo Y, Stevenson B & Zhu JK (2003)
The Arabidopsis SOS5 locus encodes a cell surface adh-
sion protein and is required for normal cell expansion.
Plant Cell 15, 19–32.
24 Qiu Q-S, Guo Y, Dietrich M, Schumaker KS & Zhu
J-K (2002) Regulation of SOS1, a plasma membrane
Na
+
⁄ H
+
exchanger in Arabidopsis thaliana, by SOS2
and SOS3. Proc Natl Acad Sci USA 99, 8436–8441.
25 Shah J & Klessig DF (1999) In Biochemistry & Molecu-
lar Biology of Plant Hormones (Hooykaas PPJ, Hall
MA & Libbenga KR, eds), pp. 513–541. Elsevier,
Amstradam.
26 Dat JF, Lopez-Delgado H, Foyer CH & Scott IM
(1998) Parallel changes in H
2
O
2
and catalase during
thermotolerance induced by salicylic acid or heat accli-
mation in mustard seedlings. Plant Physiol 116, 1351–
1357.
27 Borsani O, Valpuesta V & Botella MA (2001) Evidence
for a role of salicylic acid in the oxidative damage gen-

histolytica and its binding proteins. Mol Biochem Parasi-
tol 84, 69–82.
33 Pham XH, Reddy MK, Ehtesham NZ, Matta B &
Tuteja N (2000) A DNA helicase from Pisum sativum is
homologous to translation initiation factor and stimu-
lates topoisomerase I activity. Plant J 24, 219–229.
34 Schiestl RH & Gietz RD (1989) High efficiency trans-
formation of intact yeast cells using single stranded
nucleic acids as a carrier. Curr Genet 16, 339–346.
35 Sanan-Mishra N, Phan XH, Sopory SK & Tuteja N
(2005) Pea DNA helicase 45 overexpression in tobacco
confers high salinity tolerance without affecting yield.
Proc Natl Acad Sci USA 102, 509–514.
36 Vashisht A, Pradhan A, Tuteja R & Tuteja N (2005)
Cold and salinity stress-induced pea bipolar pea DNA
helicase 47 is involved in protein synthesis and stimu-
lated by phosphorylation with protein kinase C. Plant J
44, 76–87.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 925