The role of the second binding loop of the cysteine protease inhibitor,
cystatin A (stefin A), in stabilizing complexes with target proteases
is exerted predominantly by Leu73
Alona Pavlova, Sergio Estrada* and Ingemar Bjo¨rk
Department of Veterinary Medical Chemistry, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden
The aim of this work was to elucidate the roles of individual
residues within the flexible second binding loop of human
cystatin A in the inhibition of cysteine proteases. Four
recombinant variants of the inhibitor, each with a single
mutation, L73G, P74G, Q76G or N77G, in the most
exposed part of this loop were generated by PCR-based site-
directed mutagenesis. The binding of these variants to
papain, cathepsin L, and cathepsin B was characterized by
equilibrium and kinetic methods. Mutation of Leu73
decreased the affinity for papain, cathepsin L and cathep-
sin B by  300-fold, >10-fold and  4000-fold, respect-
ively. Mutation of Pro74 decreased the affinity for
cathepsin B by  10-fold but minimally affected the affinity
for the other two enzymes. Mutation of Gln76 and Asn77
did not alter the affinity of cystatin A for any of the proteases
studied. The decreased affinities were caused exclusively by
increased dissociation rate constants. These results show that
the second binding loop of cystatin A plays a major role in
stabilizing the complexes with proteases by retarding their
dissociation. In contrast with cystatin B, only one amino-
acid residue of the loop, Leu73, is of principal importance for
this effect, Pro74 assisting to a minor extent only in the case
of cathepsin B binding. The contribution of the second
binding loop of cystatin A to protease binding varies with
the protease, being largest,  45% of the total binding
energy, for inhibition of cathepsin B.

degree of complementarity between the interacting surfa-
ces allows the complex to form without significant
conformational changes of either papain or the inhibitor
[12–18]. Both the similar three-dimensional structures of
cystatins of families 1 and 2 [12,13,19–21] and the
pronounced sequence homology and similar fold of
cysteine proteases of the papain family [4,11,22–24]
indicate that the general aspects of the interaction model
can be extended to complexes between cystatins and other
members of this protease family. However, certain distin-
guishing features of the structures of some cysteine
proteases, such as the occluding loop of cathepsin B
[25], cause the mode of inhibition to deviate somewhat for
these enzymes. Cystatins thus inhibit cathepsin B by a
two-step reaction involving displacement of the occluding
loop of the protease in the second step [26,27]. Moreover,
it is apparent that the role of an individual binding region
Correspondence to I. Bjo
¨
rk, Department of Veterinary Medical
Chemistry, Swedish University of Agricultural Sciences,
Uppsala Biomedical Centre, Box 575, SE-751 23 Uppsala, Sweden.
Fax: + 46 18 550762, Tel.: + 46 18 4714191,
E-mail:
Abbreviations: app, subscript denoting an apparent equilibrium or rate
constant determined in the presence of an enzyme substrate; E-64,
4-[(2S,3S)-3-carboxyoxiran-2-carbonyl-
L
-leucylamido]butylguani-
dine; His-tag, 10 successive histidine residues fused to an expressed

that in cystatin B; in particular, His75 of cystatin B is
substituted by Gly in cystatin A [1]. Moreover, the NMR
structure of cystatin A shows that the second loop of this
inhibitor is highly flexible, which might be expected to affect
the interactions with the protease [20]. It is thus unclear
whether the second binding loop of cystatin A fulfils the
same function as the second binding loops of cystatin B and
family 2 cystatins and also what residues of this loop in
cystatin A may participate in the interaction.
To elucidate the role of the second binding loop of human
cystatin A in the inhibition of cysteine proteases, we have
characterized the contribution of four individual amino-acid
residues within the most exposed region of this loop (from
Leu73 to Asn77) to protease binding (see Fig. 1A). Four
recombinant cystatin A variants with Gly replacing each of
these amino acids were prepared, and their interaction with
papain, cathepsin L, and cathepsin B was characterized by
equilibrium and kinetic methods. The results clearly show
that the second binding loop of cystatin A is important for
the stability of complexes with cysteine proteases. Its
quantitative role in protease binding varies with the target
enzyme, but is especially important for cathepsin B. Leu73,
which is highly conserved in family 1 cystatins, makes the
predominant contribution of all residues of the loop to the
free energy of formation of the enzyme–inhibitor complex.
Pro74 is of minimal importance for the interaction with
papain and cathepsin L but participates to some extent in
cathepsin B binding. However, the roles of Gln76 and
Asn77 in the protease inhibition are negligible.
MATERIALS AND METHODS

of the human C3S-cystatin B–S-(carboxymethyl)papain complex
(PDB entry 1STF) [13].
5650 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
the same mutation, were synthesized in two separate PCRs,
in each of which a mutagenic and a standard primer were
used and the cystatin A expression vector was the template.
In the next step, a larger DNA fragment containing the
entire mutant cystatin A-coding sequence was obtained by a
third PCR with the standard PCR primers and with a
mixture of the products of the previous two PCRs as
template. The resulting DNA fragment was cleaved with
NcoIandBamHI, and the purified cleavage product
containing the mutant cystatin A cDNA was cloned into
the original vector between the NcoIandBamHI restriction
sites, replacing the corresponding region coding for wild-
type cystatin A [38]. The vector was then transformed into
E. coli strain MC 1061, made competent with CaCl
2
[40],
and transformants were selected by growing the bacteria on
agar plates containing ampicillin. Plasmids from a number
of colonies of each mutant were purified, and those with
the correct mutant cystatin A cDNA were identified by
sequencing in an ABI PRISMÒ 310 Genetic Analyzer
(Applied Biosystems, Foster City, CA, USA).
Expression and purification of cystatin A mutants
Recombinant L73G, P74G, Q76G, and N77G cystatin A
variants were expressed in E. coli essentially as described
previously [18]. The recombinant proteins were purified
from periplasmic extracts by immobilized metal affinity

the enzyme was fully active in binding cystatins.
Cathepsin L (EC 3.4.22.15) from sheep liver was a gift from
R. W. Mason, Alfred I. du Pont Institute, Wilmington, DE,
USA. Human liver cathepsin B (EC 3.4.22.1) was obtained
from Calbiochem (San Diego, CA, USA).
Determination of protein concentration
Most protein concentrations were calculated from
A
280
measurements. Molar absorption coefficients of
55 900
M
)1
Æcm
)1
for papain and S-(methylthio)papain
[41], 8800
M
)1
Æcm
)1
for all forms of cystatin A [18], and
11 400
M
)1
Æcm
)1
for chicken cystatin [41] were used. The
concentration of active cathepsin L was determined by
titration with 4-[(2S,3S)-3-carboxyoxiran-2-carbonyl-

Standard All Forward
GCTCAGGCGACCATGGGCCATCATCATC
Reverse CTTGCATGCCCTGCAGGTCG
Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG
Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT
P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC
Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC
Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG
Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA C
N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC
Reverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTG
Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem. 269) 5651
[28,32]. Product formation was continuously monitored in a
conventional fluorimeter (F-4000; Hitachi, Tokyo, Japan)
as in previous work [28]. The substrates were carbobenz-
oxy-
L
-phenylalanyl-
L
-arginine 4-methylcoumaryl-7-amide
(Peptide Institute, Osaka, Japan) for cathepsin L and
carbobenzoxy-
L
-arginyl-
L
-arginine 4-methylcoumaryl-
7-amide (Peptide Institute) for cathepsin B at concentra-
tions of 5 and 10 l
M
, respectively. The fluorescence never

competition [32,45,46].
Association kinetics
Association rate constants, k
ass,
for the inhibition of papain
and cathepsins L and B by the cystatin A mutants were
determined by continuously monitoring the loss of enzyme
activity in the presence of a fluorogenic substrate in either a
conventional fluorimeter (see above) or a stopped-flow
fluorimeter (SX-17
MV
; Applied Biophysics, Leatherhead,
UK) [28,38]. The substrate for papain was 10 l
M
carbo-
benzoxy-
L
-phenylalanyl-
L
-arginine 4-methylcoumaryl-7-
amide (Peptide Institute), and the substrates for cathepsins
L and B and their concentrations were the same as those
used to determine K
i
(see above). The fluorescence was
always lower than that given by 5% substrate hydrolysis.
The concentrations of the inhibitors were at least 10-fold
higher than those of the enzymes and were varied in a 10–
20-fold range. The highest inhibitor concentrations in
reactions with papain and cathepsin L were 10–20 n

by a high excess of chicken cystatin (form 2), which binds
faster and more tightly to papain than cystatin A or the
cystatin A mutants do [14,18] (see also Results) and thereby
prevents reassociation of the cystatin A variants with the
enzyme. The concentration of the cystatin A mutant–
papain complexes was 2.5–5.0 l
M
, and the molar ratio of
the displacing chicken cystatin to the complexes varied
between 10-fold and 50-fold. The progress of the reaction
was monitored for 100–150 h by following the appearance
of the newly formed complex between papain and chicken
cystatin, analyzed by ion-exchange chromatography on
a MonoQ
TM
column (Amersham Biosciences, Uppsala,
Sweden). Form 2 of chicken cystatin was used because its
lower isoelectric point allows the complex with papain to be
well separated and thus easily quantified in this analysis.
k
diss
was calculated as described previously [14].
k
diss
for the complex between L73G-cystatin A and
cathepsin L was determined by trapping the enzyme
dissociated from the complex by a high concentration of
the substrate, carbobenzoxy-
L
-phenylalanyl-

conventional fluorimeter by continuously recording the
fluorescence increase due to cleavage of the substrate by the
liberated cathepsin L. The fluorescence never exceeded that
corresponding to 5% substrate hydrolysis. k
diss
was deter-
mined by nonlinear least-squares regression analysis of the
progress curves [15].
Fluorescence emission spectroscopy
Fluorescence emission spectra of free papain and wild-type
or L73G-cystatin A, as well as of complexes of papain with
either of the two cystatin A variants, were recorded in an
SLM 4800S spectrofluorimeter (SLM-Aminco, Urbana, IL,
USA) with an excitation wavelength of 280 nm, as
described previously [16,41]. Papain and cystatin concen-
trations were 1.0 and 1.2 l
M
, respectively, giving > 99%
saturation of enzyme with inhibitor in analyses of the
complexes. All spectra were corrected for inner-filter effects
and for the wavelength dependence of the instrumental
response [41] and were normalized to a fluorescence
intensity of 1.0 for free papain at the wavelength of the
emission maximum. Difference spectra between the com-
plexes and the free proteins were calculated as in [41].
Protein modeling
The structure of human cystatin A in complex with active
papain was modeled on to the X-ray structure of the
complex between human C3S-cystatin B and S-(carboxy-
methyl)papain (PDB entry 1STF) [13] with the program

masses were measured by MALDI MS in a Kratos Kompact
MALDI 4 instrument (Kratos, Manchester, UK) as in
[18]. SDS/PAGE under reducing and nonreducing condi-
tions was performed with the Tricine buffer system [49].
Experimental conditions
All equilibrium and kinetic experiments were performed at
25.0 ± 0.2 °C. The proteases were first activated by 1 m
M
dithiothreitol in the reaction buffer for 10 min at 25 °C. The
inhibition of papain was studied in 50 m
M
Tris/HCl,
pH 7.4, containing 100 m
M
NaCl, 0.1 m
M
EDTA and,
except in the displacement experiments, 1 m
M
dithiothreitol
and 0.01% (w/v) BrijÒ 35. The interaction with cathepsin L
wasanalyzedin100 m
M
sodium acetate, pH 5.5, containing
100 m
M
NaCl, 1 m
M
EDTA, 1 m
M

an erroneously synthesized primer. As this additional
mutation is silent, one of the isolated vectors was neverthe-
less used for expression of Q76G-cystatin A. The mutants
were expressed with a removable His-tag and with a signal
peptide directing the proteins to the periplasmic space of
E. coli, facilitating purification.
All purified mutants were > 99.5% homogeneous on
SDS/PAGE. N-Terminal sequencing of the first five
residues confirmed that the His-tag was cleaved off properly
by enterokinase for all mutants. The molecular masses,
determined by MS, corresponded within 4.5 Da to those
calculated from the expected amino-acid sequences, con-
firming the correct length of the mutants, as well as the
presence of the desired mutations. All mutants bound active
papain and S-(methylthio)papain with stoichiometries
between 0.95 and 1.0, i.e. they were essentially fully active
in inhibition of cysteine proteases.
Binding affinity
All four cystatin A mutants bound so tightly to papain that
the affinity of the binding could not be determined by
equilibrium methods, because of the instability of the
enzyme at the low concentrations and the long reaction
times that would have been necessary. Therefore, K
d
for the
interaction with papain was calculated as k
diss
/k
ass
from

were therefore possible. However, a reliable K
i
for the
inhibition of cathepsin L by L73G-cystatin A was obtained
by equilibrium measurements and was > 10-fold higher
than that for wild-type cystatin A. The measured K
i
for this
mutant agreed well with K
d
calculated from k
ass
and k
diss
(see below and Table 2).
K
i
for the inhibition of cathepsin B by all cystatin A
forms was sufficiently high to be well determined by
equilibrium analyses. The L73G mutation caused a sub-
stantial,  4000-fold, increase in K
i
which was confirmed by
calculations of K
d
from k
ass
and k
diss
(Table 2). A smaller,

between the cystatin A mutants and papain were measured
by displacement of the mutants from the complexes with an
excess of a tighter-binding inhibitor, chicken cystatin, in
experiments monitored by ion-exchange chromatography.
Only the L73G mutation altered k
diss
to any appreciable
extent, increasing it by  170-fold over that for wild-type
cystatin A. k
diss
for all other mutants was essentially
unaffected, with at most a twofold increase being observed
for P74G-cystatin A.
k
diss
of the complex between L73G-cystatin A and
cathepsin L was measured by displacement experiments, in
which the enzyme dissociating from the complex was cap-
tured by an excess of a tight-binding fluorogenic substrate.
The values of k
diss
obtained by two modifications of this
procedure agreed well with each other and with that
calculated from K
i
and k
ass
(Table 2). The L73G mutation
resulted in a greater than sevenfold increase in k
diss

k
diss
(s
)1
)
Papain Wild-type 1.8 · 10
)13 a
3.1 · 10
6a
5.5 · 10
)7a
[1] [1] [1]
L73G 5.8 · 10
)11 b
(1.58 ± 0.02) · 10
6
(9) (9.1 ± 0.9) · 10
)5
(3)
[320] [0.5] [170]
P74G 2.8 · 10
)13 b
(3.64 ± 0.06) · 10
6
(9) (10.2 ± 0.7) · 10
)7
(3)
[1.6] [1.2] [1.9]
Q76G 1.8 · 10
)13 b

)10 b
3.2 · 10
)4c
P74G £ 2.4 · 10
)11
(7) (4.6 ± 0.2) · 10
6
(10)
[0.9]
£ 1.1 · 10
)4c
Q76G £ 1.1 · 10
)11
(8) (6.3 ± 0.2) · 10
6
(9)
[1.2]
£ 6.9 · 10
)5c
N77G £ 1.1 · 10
)11
(8) (6.3 ± 0.2) · 10
6
(14)
[1.2]
£ 6.9 · 10
)5c
Cathepsin B Wild-type 9.1 · 10
)10 a
3.9 · 10

(9) (2.26 ± 0.08) · 10
4
(11) 5.4 · 10
)5c
[2.6] [0.6] [1.5]
a
From previous work [18,35].
b
Calculated from k
ass
and k
diss
.
c
Calculated from K
i
and k
ass
.
5654 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
determination of k
diss
by the method used for papain, in
which the displacement was monitored by chromatography.
Therefore, only upper limits of k
diss
for the binding of these
mutants to cathepsin L could be estimated, as for wild-type
cystatin A in previous work [35] (Table 2).
Values of k

proteins had minima at different wavelengths,  360 and
 368 nm, respectively (Fig. 2). Moreover, the spectrum for
the L73G mutant had an appreciably lower amplitude than
that for wild-type cystatin A, reflecting a smaller fluores-
cence change on interaction of the mutant than of the wild-
type inhibitor with papain. These fluorescence changes must
reflect different changes in the environment of one or more
Trp side chains in papain on formation of the two enzyme–
inhibitor complexes, as cystatin A does not contain Trp [1].
DISCUSSION
The X-ray structure of the complex between human C3S-
cystatin B and S-(carboxymethyl)papain reveals a number
of predominantly hydrophobic but also solvent-mediated
interactions between the second binding loop of the
inhibitor and papain [13]. In particular, Leu73 and His75
in this loop are seen to make four and seven intermolecular
contacts with the enzyme, respectively, that are < 4 A
˚
in
length. In agreement with this structural evidence, site-
directed mutagenesis has shown that the two residues
contribute substantial free energy to the interaction of
cystatin B with cysteine proteases [37]. The sequence of the
second binding loop of the related family 1 cystatin,
cystatin A, differs appreciably from that of cystatin B.
Most notably, cystatin A lacks the essential His75 and
instead has a Gly in this position [1]. This substitution would
be expected to lead to loss of a number of interactions with
the enzyme and therefore to considerably decrease the
contribution of the second binding loop of cystatin A to the

)1
to the unitary free energy change [50,51]
accompanying the formation of the complex of cystatin A
with papain and cathepsin B, respectively. These changes
correspond to  18 and  34%, respectively, of the total
unitary free energy of binding of cystatin A to the two
enzymes [18]. The contribution of Leu73 of cystatin A to
binding of papain, which has an open active-site cleft, is
comparable to that of Leu73 in the second binding loop of
cystatin B and to that of the essential Trp106 residue in this
loop of the family 2 cystatin, cystatin C [37,52]. However,
the contribution of Leu73 of cystatin A to binding of
cathepsin B, in which the occluding loop partially blocks the
active site, is substantially higher than that of the corres-
ponding residue of cystatin C [52].
The results further show that one additional residue in
the second binding loop of cystatin A, Pro74, aids in
stabilizing the complex of the inhibitor with cathepsin B by
decreasing the dissociation rate constant. However, this
Fig. 2. Fluorescence emission difference spectra between complexes of
human wild-type cystatin A or the L73G cystatin A variant with papain
andthefreeproteins.Solid line, Wild-type cystatin A; dotted line,
L73G-cystatin A. Fluorescence emission spectra were measured as
describedinMaterialsandmethodswithpapainandcystatincon-
centrations of 1.0 and 1.2 l
M
, respectively. The difference spectra were
calculated from separately measured and corrected emission spectra
that were normalized to a fluorescence intensity of 1.0 for 1 l
M

Cystatin B in the complex with papain can therefore be
used as an appropriate template for modeling of the
corresponding complex between cystatin A and this prote-
ase with reasonable accuracy [48,54]. The model generated
for the complex indicates that only two residues within the
second binding loop of cystatin A, Leu73 and Pro74, are
involved in interactions with papain (Fig. 1B). Leu73 makes
six hydrophobic interactions of 3.4–4.0 A
˚
with Trp177 of
papain in the model, in agreement with the demonstration
that Leu73 is essential for strong inhibition of cysteine
proteases by cystatin A. The involvement of Trp177 of
papain in the interaction with Leu73 is supported by the
changes caused by the L73G mutation of the fluorescence
difference spectrum characterizing the cystatin A–papain
interaction. These changes indicate that one or more
tryptophans of papain, probably primarily Trp177 on the
surface of the active-site cleft, are exposed to a less
hydrophobic environment in the complex with L73G-
cystatin A [55]. In the model, the side chain of Pro74 of
cystatin A also makes two hydrophobic contacts of  4A
˚
with Gln142 and Leu143 of papain (Fig. 1B). This obser-
vation is in apparent contrast with the demonstration that
Pro74 is unimportant for papain binding and participates
only in the inhibition of cathepsin B. This discrepancy with
the experimental data thus indicates that the model is
somewhat uncertain with regard to the putative interactions
involving Pro74. However, in agreement with the experi-

supported by the Swedish Medical Research Council (Project No. 4212).
REFERENCES
1. Barrett, A.J., Rawlings, N.D., Davies, M.E., Machleidt, W.,
Salvesen, G. & Turk, V. (1986) Cysteine proteinase inhibitors of
the cystatin superfamily. In Proteinase Inhibitors (Barrett, A.J. &
Salvesen, G., eds), pp. 515–569. Elsevier, Amsterdam.
2. Turk, V. & Bode, W. (1991) The cystatins: protein inhibitors of
cysteine proteinases. FEBS Lett. 285, 213–219.
3. Abrahamson, M. (1994) Cystatins. Methods Enzymol. 244,685–
700.
4. Turk,B.,Turk,V.&Turk,D.(1997)Structuralandfunctional
aspects of papain-like cysteine proteinases and their protein
inhibitors. Biol. Chem. 378, 141–150.
5. Henskens, Y.M.C., Veerman, E.C.I. & Nieuw Amerongen, A.V.
(1996) Cystatins in health and disease. Biol. Chem. Hoppe-Seyler
377, 71–86.
6. Blankenvoorde, M.F., Van’t Hof, W., Walgreen-Weterings, E.,
van Steenbergen, T.J., Brand, H.S., Veerman, E.C. & Nieuw
Amerongen, A.V. (1998) Cystatin and cystatin-derived peptides
have antibacterial activity against the pathogen Porphyromonas
gingivalis. Biol. Chem. 379, 1371–1375.
7. Collins, A.R. & Grubb, A. (1998) Cystatin D, a natural salivary
cysteine protease inhibitor, inhibits coronavirus replication at its
physiologic concentration. Oral Microbiol. Immunol. 13, 59–61.
8. Kos, J. & Lah, T.T. (1998) Cysteine proteinases and their
endogenous inhibitors: target proteins for prognosis, diagnosis
and therapy in cancer. Oncol. Rep. 5, 1349–1361.
9. Das, L., Datta, N., Bandyopadhyay, S. & Das, P.K. (2001) Suc-
cessful therapy of lethal murine visceral leishmaniasis with cystatin
involves up-regulation of nitric oxide and a favorable T cell

rvi, K. (1990) Interaction between chicken
cystatin and the cysteine proteinases actinidin, chymopapain A,
and ficin. Biochemistry 29, 1770–1776.
16. Lindahl, P., Abrahamson, M. & Bjo
¨
rk, I. (1992) Interaction of
recombinant human cystatin C with the cysteine proteinases
papain and actinidin. Biochem. J. 281, 49–55.
17. Turk, B., Colic, A., Stoka, V. & Turk, V. (1994) Kinetics of
inhibition of bovine cathepsin S by bovine stefin B. FEBS Lett.
339, 155–159.
18. Pol,E.,Olsson,S.L.,Estrada,S.,Prasthofer,T.W.&Bjo
¨
rk, I.
(1995) Characterization by spectroscopic, kinetic and equilibrium
methods of the interaction between recombinant human cystatin
A (stefin A) and cysteine proteinases. Biochem. J. 311, 275–282.
19. Dieckmann,T.,Mitschang,L.,Hofmann,M.,Kos,J.,Turk,V.,
Auerswald, E.A., Jaenicke, R. & Oschkinat, H. (1993) The
structures of native phosphorylated chicken cystatin and of a
recombinant unphosphorylated variant in solution. J. Mol. Biol.
234, 1048–1059.
20. Martin, J.R., Craven, C.J., Jerala, R., Kroon-Zitko, L., Zerovnik,
E., Turk, V. & Waltho, J.P. (1995) The three-dimensional solution
structure of human stefin A. J. Mol. Biol. 246, 331–343.
21. Ekiel, I., Abrahamson, M., Fulton, D.B., Lindahl, P., Storer,
A.C., Levadoux, W., Lafrance, M., Labelle, S., Pomerleau, Y.,
Groleau, D., LeSauteur, L. & Gehring, K. (1997) NMR structural
studies of human cystatin C dimers and monomers. J. Mol. Biol.
271, 266–277.

and dissociation rate constants for binding of cystatins to target
proteinases occurring on N-terminal truncation of the inhibitors
indicate that the interaction mechanism varies with different
enzymes. Biochem. J. 299, 219–225.
29. Machleidt, W., Thiele, U., Laber, B., Assfalg-Machleidt, I., Esterl,
A., Wiegand, G., Kos, J., Turk, V. & Bode, W. (1989) Mechanism
of inhibition of papain by chicken egg white cystatin. Inhibition
constants of N-terminally truncated forms and cyanogen bromide
fragments of the inhibitor. FEBS Lett. 243, 234–238.
30. Machleidt, W., Thiele, U., Assfalg-Machleidt, I., Forger, D. &
Auerswald, E.A. (1991) Molecular mechanism of inhibition of
cysteine proteinases by their protein inhibitors: kinetic studies with
natural and recombinant variants of cystatins and stefins. Biomed.
Biochim. Acta 50, 613–620.
31. Abrahamson, M., Mason, R.W., Hansson, H., Buttle, D.J.,
Grubb, A. & Ohlsson, K. (1991) Human cystatin C. Role of
the N-terminal segment in the inhibition of human cysteine
proteinases and in its inactivation by leucocyte elastase. Biochem.
J. 273, 621–626.
32. Lindahl, P., Nycander, M., Ylinenja
¨
rvi,K.,Pol,E.&Bjo
¨
rk, I.
(1992) Characterization by rapid-kinetic and equilibrium methods
of the interaction between N-terminally truncated forms of
chicken cystatin and the cysteine proteinases papain and actinidin.
Biochem. J. 286, 165–171.
33. Hall, A., Ha
˚

rk, I. (1998) The role of Gly-4 of human cystatin A (stefin A) in
the binding of target proteinases. Characterization by kinetic and
equilibrium methods of the interactions of cystatin A Gly-4
mutants with papain, cathepsin B, and cathepsin L. Biochemistry
37, 7551–7560.
39. Higuchi, R., Krummel, B. & Saiki, R.K. (1988) A general method
of in vitro preparation and specific mutagenesis of DNA frag-
ments: study of protein and DNA interactions. Nucleic Acids Res.
16, 7351–7367.
40. Cohen, S.N., Chang, A.C.Y. & Hsu, L. (1972) Nonchromosomal
antibiotic resistance in bacteria: genetic transformation of
Escherichia coli by R factor DNA. Proc. Natl. Acad. Sci. USA 69,
2110–2114.
41. Lindahl, P., Alriksson, E., Jo
¨
rnvall, H. & Bjo
¨
rk, I. (1988) Inter-
action of the cysteine proteinase inhibitor chicken cystatin with
papain. Biochemistry 27, 5074–5082.
42. Laber, B., Krieglstein, K., Henschen, A., Kos, J., Turk, V., Huber,
R. & Bode, W. (1989) The cysteine proteinase inhibitor chicken
cystatin is a phosphoprotein. FEBS Lett. 248, 162–168.
43. Ellman, G.L. (1959) Tissue sulfhydryl groups. Arch. Biochem.
Biophys. 82, 70–77.
44. Barrett, A.J. & Kirschke, H. (1981) Cathepsin B, cathepsin H, and
cathepsin L. Methods Enzymol. 80, 535–561.
45. Mason, R.W. (1986) Species variants of cathepsin L and their
immunological identification. Biochem. J. 240, 285–288.
46. Dalet-Fumeron, V., Guinec, N. & Pagano, M. (1991) High-

53. Craven, C.J., Baxter, N.J., Murray, E.H., Hill, N.J., Martin, J.R.,
Ylinenja
¨
rvi, K., Bjo
¨
rk, I., Waltho, J.P. & Murray, I.A. (2000)
Wild-type and Met-65 fi Leu variants of human cystatin A are
functionally and structurally identical. Biochemistry 39, 15783–
15790.
54. Guex, N., Diemand, A. & Peitsch, M.C. (1999) Protein modelling
for all. Trends Biochem. Sci. 24, 364–367.
55. Lakowicz, J.R. (1983) Principles of Fluorescence Spectroscopy,pp.
187–214. Plenum Press, New York.
5658 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002