A comparative biochemical and structural analysis of
the intracellular chorismate mutase (Rv0948c) from
Mycobacterium tuberculosis H
37
R
v
and the secreted
chorismate mutase (y2828) from Yersinia pestis
Sook-Kyung Kim*, Sathyavelu K. Reddy, Bryant C. Nelson, Howard Robinsonà, Prasad T. Reddy
and Jane E. Ladner
Biochemical Science Division, Chemical Science and Technology Laboratory, National Institute of Standards and Technology, Gaithersburg,
MD, USA
Keywords
chorismate mutase; Mycobacterium
tuberculosis; pathogenesis; shikimate
pathway; Yersinia pestis
Correspondence
P. T. Reddy, Biochemical Science Division,
Bldg 227, Rm B244, Chemical Science and
Technology Laboratory, National Institute of
Standards and Technology, Gaithersburg,
MD 20899, USA
Fax: +1 301 975 8505
Tel: +1 301 975 4871
E-mail:
J. E. Ladner, Biochemical Science Division,
Bldg 227, Rm B244, Chemical Science and
Technology Laboratory, National Institute of
Standards and Technology, Gaithersburg,
MD 20899, USA
Fax: +1 240 314 6225

X-ray structure shows that 90-MtCM is an all a-helical
homodimer (Protein Data Bank ID: 2QBV) with the topology of Escheri-
chia coli CM (EcCM), and that both protomers contribute to each catalytic
site. Superimposition onto the structure of EcCM and the sequence align-
ment shows that the C-terminus helix 3 is shortened. The absence of two
residues in the active site of 90-MtCM corresponding to Ser84 and Gln88
of EcCM appears to be one reason for the low k
cat
. Hence, 90-MtCM
belongs to a subfamily of a-helical AroQ CMs termed AroQ
d.
The CM
gene (y2828) from Yersinia pestis encodes a 186 amino acid protein with an
N-terminal signal peptide that directs the protein to the periplasm. The
mature protein, *YpCM, exhibits Michaelis–Menten kinetics with a k
cat
of
70±5s
)1
and K
m
of 500 ± 50 lm at 37 °C and pH 7.5. The 2.1 A
˚
X-ray
structure shows that *YpCM is an all a-helical protein, and functions as a
homodimer, and that each protomer has an independent catalytic unit
(Protein Data Bank ID: 2GBB). *YpCM belongs to the AroQ
c
class of
CMs, and is similar to the secreted CM (Rv1885c, *MtCM) from M. tuber-

revealed two genes for CM [4]. The Rv1885c gene
encodes a secreted CM (*MtCM) and the Rv0948c
gene encodes an intracellular CM (MtCM). Sasso et al.
[5], Prakash et al. [6] and Kim et al. [7] have character-
ized *MtCM. Kim et al. [7] have shown that *MtCM
has in fact an extracellular destination in M. tuber-
culosis. Prakash et al. [6] conducted a brief study of
the recombinant MtCM. Our work is aimed at the fur-
ther characterization of MtCM. The true primary
sequence of MtCM is complicated by virtue of a
number of presumptive in-frame initiator methionines
preceded by a reasonable ribosome-binding sequence.
The annotation Rv0948c for MtCM in a laboratory
strain of M. tuberculosis H
37
R
v
would encode a 105
amino acid protein (105-MtCM) [4], whereas the anno-
tation MT0975 for MtCM in the CDC1551 strain
would encode a 217 amino acid protein (217-MtCM)
[8]. Furthermore, alignment of 105-MtCM with the
genetically engineered Escherichia coli CM (EcCM) [9]
shows that the 105 amino acid protein has extra amino
acids beyond the N-terminus of EcCM. Hence, we
cloned 90-MtCM beginning with Met16 in Rv0948c.
We determined the 3D structure of the 90-MtCM and
kinetic parameters of all three proteins. The 90-MtCM
is an AroQ class CM and the protein functions as a
dimer. In this article, we also report on the cloning of

et al. [10] did not determine the translation start site
for Rv0948c.
Production and purification of MtCM
The 105-MtCM was overproduced as a fusion protein
with the subtilisin prodomain (Fig. 2, lane 2). The
fusion protein was completely soluble (Fig. 2, lane 3).
Cleavage of 105-MtCM from the prodomain was trig-
gered by fluoride-induced subtilisin activity (Fig. 2,
lane 5). We observed three major protein products at
this stage of purification: intact fusion protein (per-
haps not very tightly bound), 105-MtCM, and an
unidentified lower molecular mass protein. Hence,
105-MtCM was further purified by molecular sieve
chromatography to near homogeneity (Fig. 2, lane 6).
The molecular mass of 105-MtCM determined
by MALDI-TOF MS was 11 771 Da (theoretical
mass = 11 771 Da), and established that the protein is
intact. Similarly, 90-MtCM was overproduced as a
fusion protein with the subtilisin prodomain, and the
protein was purified to homogeneity (Fig. 3, lane 5).
As can be seen in lane 5 of Fig. 3, 90-MtCM migrated
as a  6 kDa protein. Hence, we determined the
molecular mass of 90-MtCM by MALDI-TOF MS as
10 090 ± 1 Da, which is identical to the theoretical
mass of 10 090 Da. The yield of 105-MtCM and
90-MtCM was 1 mg per 1 L of culture. Activity mea-
surements for CM using these two proteins showed
that both proteins catalyze the conversion of choris-
mate to prephenate (see kinetic measurements for k
cat

construct are shown.
1 2 3 4 5 6 7 kDa
32.5
Subtilisin prodomain:105 aa
MtCM fusion protein
25.0
16.5
105 aa MtCM monomer
6.5
Fig. 2. SDS ⁄ PAGE (16%) of the production and purification of
105-MtCM. Lane 1: uninduced cell-free extract of E. coli BL21(DE3)
harboring the pG58–105-MtCM clone (25 lg of protein). Lane 2:
induced cell-free extract of E. coli BL21(DE3) harboring the pG58–
105-MtCM clone (25 lg of protein). Lane 3: 48 000 g supernatant
of induced cells (same volume as used in lane 2). Lane 4: flow
through from subtilisin column (same volume as used in lane 2).
Lane 5: 10 lg of protein(s) eluted after equilibration with 100 m
M
sodium fluoride. Lane 6: 5 lg of purified 105-MtCM from a Sepha-
dex G-75 column. Lane 7: molecular mass markers.
1 2 3 4 5 6 kDa
32.5
25.0
16.5
Subtilisin prodomain: 90 aa
MtCM fusion protein
6.5
90 aa MtCM monomer
Fig. 3. SDS ⁄ PAGE (16%) of the production and purification of
90-MtCM. Lane 1: induced cell-free extract of E. coli BL21(DE3)

than that observed for EcCM. One obvious reason for
the low k
cat
and high K
m
exhibited by MtCM is the
absence of two of the substrate-binding residues found
in the C-terminus of EcCM (Fig. 1). In contrast,
*YpCM, in which all the catalytic site residues are pre-
served, exhibits a high k
cat
of 70 ± 5 s
)1
, similar to
that for EcCM.
Crystal structure of 90-MtCM
The crystal structure of 90-MtCM shows clearly that the
molecule is an all a-helical homodimer (Protein Data
Table 1. Comparison of the catalytic properties of MtCM, EcCM,
and *YpCM. MtCM proteins and *YpCM were purified as
described in Experimental procedures. One microgram of MtCM or
200 ng of *YpCM in 10 lL was used in each assay of 0.3 mL of
buffer. The buffer consisted of 50 m
M Tris ⁄ HCl (pH 7.5), 0.5 mM
EDTA, 0.1 mg BSAÆmL
)1
, and 10 mM b-mercaptoethanol. Choris-
mate concentrations were varied from 0.25 to 4 m
M. Assays were
performed at 37 °C for 5 min [34], and the reaction was stopped

the N-termini and C-termini are labeled in the same color as the
polypeptide chain. The three helices are labeled H1, H2, and H3.
(C) Helix 3 from each of the four structures is shown. The helices
were taken from the superimposed structures and then separated
by translating each horizontally in the plane of the page. The figures
were drawn with
PYMOL ().
S. -K. Kim et al. AroQ chorismate mutases
FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works 4827
Bank ID: 2QBV; Fig. 4). The polypeptide chain has one
long 36 residue helix (helix 1), an eight residue loop, an
11 residue helix (helix 2), a two residue loop, and a 15
residue helix (helix 3). The buried surface area of the
dimer is 3810 A
˚
2
. This crystal form has one protomer in
the asymmetric unit; the complete molecule is generated
by a crystallographic two-fold. The data and refinement
statistics are shown in Table 2. The Ramachandran plot
has 96.9% of the residues in the most favored region
and 3.1% in the additional allowed region. Five residues
were modeled with alternative conformations. No inter-
pretable density was observed for the first 12 residues or
for the last five residues. When the model is numbered
according to the 90 residue protein, residues 13–85 are
seen in the electron density map. Using matras [12] to
compare the structure with a representative library of
structures, three structures stood out as very similar;
these are Protein Data Bank IDs 2D8D, 1YBZ and

structures is 0.69 A
˚
. One difference between the struc-
tures is that five residues at the C-terminal end are dis-
ordered in our structure (2QBV) and only one residue
is disordered in 2VKL. In fact, although the space
group is the same for both structures, the c-axis is
10 A
˚
shorter in 2VKL. This difference is due to crystal
packing, which allows the C-terminal residues of
neighboring molecules (not in the same dimer) to inter-
act and the tail of one protomer to almost reach the
active site of the neighbor.
Active site of 90-MtCM
The structure of EcCM includes the TSA, which
clearly identifies the active site. From structural and
sequence homology with EcCM, the active site residues
of 90-MtCM can be identified, and are shown in
Fig. 5. The striking difference between EcCM and 90-
MtCM is that the EcCM residues Ser84 and Gln88 are
absent in 90-MtCM (Fig. 1). Structurally, Ser84 of
EcCM lines up with Gly84 of 90-MtCM. The final five
residues, GRLGH, of 90-MtCM are not seen in the
electron density map. However, none of these residues
is a candidate for performing the role of Gln88 in
EcCM. Of the other two structures, PfCM has the
conserved Ser70 and Gln74, and TtCM has Ser81 and
Glu85. There are two Protein Data Bank files for
TtCM; in the file 2D8D, Glu85 is only seen in one of

0.056 ⁄ 0.323 0.113 ⁄ 0.469
0% Completeness 100.0 ⁄ 100.0 99.4 ⁄ 95.3
Average I ⁄ r 25.3 ⁄ 7.0 12.0 ⁄ 2.0
Mosaicity 1.37 0.77
Radiation wavelength 1.54 0.979
Refinement
Resolution limits (A
˚
) 20.0–2.0 20.0–2.1
R-factor (95% of the data) 0.219 0.207
R
free
(5% of the data) 0.298 0.258
No. of water molecules 47 193
Bond length rmsd (A
˚
) 0.021 0.019
Bond angle rmsd (°) 1.98 1.86
Average B (main
chain ⁄ side chain) (A
˚
2
)
42.2 ⁄ 44.0 34.3 ⁄ 36.5
Average B for water (A
˚
2
) 41.5 34.5
AroQ chorismate mutases S. -K. Kim et al.
4828 FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works

2
N
H
2
N
NH
2
NH
Arg18′
(Arg127)
(Lys54)
(Asp63)
(Gln66)
(Arg43)
Arg58
Arg35
(Ala99)
Ser 84
(Gln 103)
(Glu67)
Gln 88
Residues in EcCM
missing in 90-MtCM
Arg46
Val55
Glu59
NH
O
HN
OH

2
N
H
2
N
H
2
N
Fig. 6. The active site of 90-MtCM: a diagrammatic view of the
active site of 90-MtCM is shown, with the superimposition of the
TSA from the EcCM structure. The corresponding residue numbers
for *YpCM are shown in parentheses.
A
B
C
Fig. 5. Stereo view of the active sites of EcCM, 90-MtCM, and
*YpCM: a stereo view of the active site of EcCM is shown in (A),
and the corresponding view of 90-MtCM is shown in (B). The
active site residues are shown in stick form, and the rest of the
structure is in cartoon form. In EcCM, one polypeptide chain is gray
and the other is rose. In 90-MtCM, one polypeptide chain is blue
and the other is green. The TSA from the EcCM structure is shown
with yellow carbon atoms in the 90-MtCM structure for orientation.
The active site residues are labeled, and the N-terminus of the
chain that contributes one residue (R11¢ in EcCM and R18¢ in 90-
MtCM) to the active site is labeled. In 90-MtCM, the observed
C-terminus of the structure visible in the electron density is indi-
cated for the second chain. The citrate from the crystal structure of
*YpCM is shown in the active site with yellow carbon atoms in (C).
All of the active site residues belong to the same chain. The figure

of the protein. The protein crystallized in the space
group C222
1
with two homodimers (A ⁄ B and C ⁄ D) in
the asymmetric unit. The protomers superimpose with
average rmsd values in the Ca coordinates of less than
0.8 A
˚
. The final model for *YpCM includes all 155
residues for chains A and C and 154 residues for
chains B and D, where the initial residue, Gln31, is
not ordered. The model also includes four citrate ions,
one in each active site, 13 sulfate ions with 11
modeled at 0.5 occupancy, and 193 water molecules.
[Correction added on 28 August 2008 after first online
publication: in the preceding sentence, ‘13 sulfate ion,
with 11’ was corrected to ‘13 sulfate ions with 11’]. In
the Ramachandran plots, 95.1% of the residues are in
the most favored regions, 4.5% in the additional
allowed regions, and 0.4% in the generously allowed
regions. The structure is all a-helical, and the protomer
has the fold of the EcCM dimer with an inserted loop
connecting the two chains. Each protomer of *YpCM
has one active site, and the molecule forms a homo-
dimer. In this crystal form, citrate ions from the crys-
tallization solution are present in all the active sites.
This is the same fold as for *MtCM [7,14,15]. The
superimposition of *MtCM on *YpCM aligns 132 resi-
dues and yields an rmsd for Ca atoms of 1.8 A
˚

tion, ScCM has a domain for regulation of the activity
by tryptophan and tyrosine [19], whereas *MtCM [7,14]
and *YpCM do not have such a regulatory domain.
Furthermore, structural motifs differ among the AroQ
and AroH classes of CMs. AroQ and *AroQ CMs exhi-
bit all a-helical bundles, whereas AroH CMs contain
both a-helices and b-sheets. The active site in EcCM is
formed by residues from all three helices of one pro-
tomer and by a residue from the N-terminal long helix
of the second protomer. In contrast, the active site in
ScCM [17], *MtCM [7,14,15] and *YpCM is formed
within a single protomer.
Further subclassification of AroQ CMs on the basis
of their distinct structural prototypes was proposed by
Okvist et al. [14] (Fig. 7). EcCM-like proteins whose
catalytic site is formed with residues from both
protomers are denoted as AroQ
a
. ScCM-like proteins
in which the catalytic site is formed within a single
protomer with a domain for regulation of activity by
tryptophan and tyrosine are denoted as AroQ
b
.
Secreted CMs such as *MtCM and *YpCM, in which
the catalytic site is formed within a single protomer
but without an apparent regulatory domain, are
denoted as AroQ
c
. A fourth subclass of CMs denoted

protein production vector pG58 was described by Ruan
et al. [20]. Briefly, pG58 was designed to produce a target
gene product as a fusion protein with the subtilisin prodo-
main. The fusion protein would be bound to a resin cou-
pled with a stable variant of subtilisin protease. Next,
equilibration with fluoride anion will trigger the cleavage
by subtilisin between the prodomain and the target protein,
thus releasing the target protein in its native form, begin-
ning with the initiator methionine.
Cloning of Rv0948c and MT0975 genes
The Rv0948c ORF for the 105 amino acid protein was ampli-
fied by PCR from M. tuberculosis H
37
R
v
genomic DNA.
Oligonucleotide pair 1 with specific restriction recognition
sequences for cloning into pG58 was: 5 ¢-GCTACG
TTTAAAGCGATGATGAGACCAGAACCCCCACATCA
CG-3¢ (forward primer with DraI site underlined) and
5¢-CG
GAATTCTTAGTGACCGAGGCGGCCCCTGCC-3¢
(reverse primer with EcoRI site underlined). Similarly, the
Rv0948c ORF for the 90 amino acid protein beginning
with Met16 was amplified with oligonucleotide pair 2:
5¢-GCTACG
TTTAAAGCGATGATGAACCTGGAAATG
CTCGAGTCC-3¢ (forward primer with DraI site underlined)
and the same reverse primer. Oligonucleotide pair 3 for
amplification of MT0975 (217 amino acid protein – another

c
is *YpCM. (D) AroQ
d
is
90-MtCM with the TSA from the superimposition of EcCM.
S. -K. Kim et al. AroQ chorismate mutases
FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works 4831
72 °C. One hundred nanograms of M. tuberculosis H
37
R
v
genomic DNA (generously provided by J. Belisle and
P. Brennan, Colorado State University) and 100 ng of prim-
ers were used in the amplification. The amplified DNA
obtained with oligonucleotide pairs 1, 2 and 3 was digested
with Dra I and EcoRI for cloning into the respective sites of
the pG58 plasmid. A recombinant was isolated from E. coli
Novablue and introduced into E. coli BL21(DE3) for protein
production.
Overproduction of the proteins
E. coli BL21(DE3) harboring either pG58–Rv0948c
(105 amino acids), pG58–Rv0948c (90 amino acids) or
pG58–MT0975 (217 amino acids) recombinant plasmid was
grown in 25 mL of LB medium containing ampicillin
(100 lgÆmL
)1
)at37°CtoanA
600 nm
 0.5. Protein pro-
duction was induced with 30 lm IPTG overnight at 24 °C,

100 mm sodium fluoride in the lysis buffer. Effluent fractions
containing CM, as judged by SDS ⁄ PAGE and by activity,
were pooled and concentrated to 5 mL in an Amicon cell
using a 5000 Da molecular mass cut-off membrane. MtCM
(105 amino acids ⁄ 90 amino acids) was further purified by
molecular sieve chromatography on a 480 mL Sephadex G-75
superfine column, which was equilibrated and eluted with
50 mm Tris ⁄ HCl (pH 7.5), 1 mm EDTA, and 100 mm NaCl.
Effluent fractions containing pure MtCM (105 amino
acids ⁄ 90 amino acids) were concentrated for protein determi-
nation and biochemical analysis. The 217-MtCM was simi-
larly purified with the subtilisin column. Further purification
was not pursued, as it exhibited extremely low CM activity.
Cloning and expression of the *YpCM gene
(y2828) in E. coli
The gene y2828 from the genome sequence of Y. pestis strain
Kim10+ [21] was annotated as CM. [Correction added on
28 August 2008 after first online publication: in the preceding
sentence, ‘The gene y2828 from the genome sequence of
Y. pestis strain Kim10+ (21) as CM’ was corrected to ‘The
gene y2828 from the genome sequence of Y. pestis strain
Kim10+ (21) was annotated as CM’]. The full-length
*YpCM gene coding sequence, including the signal peptide,
was amplified by PCR using the forward primer 5¢-GG
AATTC
CATATGCAACCCACTCATACGCTAACAAG-3¢
(with the NdeI restriction recognition sequence underlined)
and the reverse primer 5¢-CG
GGATCCTTATTTTAATT
TTACCTGATTGAAGGTTGAG-3¢ (with the BamHI

using the M9 salts ⁄ selenomethionine growth medium,
according to the manufacturer’s recommendation. Briefly,
cells were grown in 1 L of LB medium containing ampicillin
(100 lgÆmL
)1
) overnight at 37 °C. Cells were harvested,
washed twice with sterile water, and suspended in 100 mL of
M9 salts medium. Four 1 L volumes of M9 salts media con-
taining ampicillin were inoculated with 25 mL of the culture
per 1 L. Cells were grown at 37 °CtoA
600 nm
= 0.4. At this
stage, selenomethionine was added and induced with 10 lm
IPTG at 15 °C overnight. *YpCM was purified by molecular
sieve chromatography from the periplasmic fluid.
AroQ chorismate mutases S. -K. Kim et al.
4832 FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works
Crystallization of 90-MtCM
The 90-MtCM was concentrated to 8.3 mgÆmL
)1
in 50 mm
Tris ⁄ HCl (pH 7.5), 1 mm EDTA, and 100 m m sodium chlo-
ride. Crystallization conditions were surveyed by the sitting
drop vapor diffusion method using Emerald BioSystems
Wizard Screens I and II. There were several hits. The crystal
used for data collection was grown with a well solution of
0.1 m Tris ⁄ HCl (pH 8.6), 0.2 m magnesium chloride, and
20% poly(ethylene glycol) 400. The crystallization drops
were made with equal volumes of protein and well solution.
Crystallization of *YpCM

crystalclear [22], and the statistics are shown in Table 2.
Structure determination for 90-MtCM
The structure of 90-MtCM was solved by molecular
replacement using phaser [23], with the structure of PfCM
(Protein Data Bank ID: 1YBZ). The asymmetric unit of the
P4
3
2
1
2 crystal includes a single chain of 90-MtCM. Molecu-
lar replacement trials using a single protomer failed. How-
ever, when the symmetry was lowered to P4
3
and the dimer
was used as the search model, a solution was found. The
remainder of the structure determination was carried out in
the space group P4
3
2
1
2. refmac5 [24,25] was used to refine
the model, and resolve [26] was used to iteratively rebuild
the model to remove bias. The final refinement statistics are
shown in Table 2. coot [27] was used to view the model
graphically and to build portions not built by resolve. The
stereochemistry was checked with procheck [28] and with
routines inside coot.
Data collection for *YpCM
Preliminary data were collected on the home source
described above, and cryoprotection was accomplished in

Other methods
CM was assayed by the method of Davidson & Hudson
[34], essentially as described in our previous study [7]. One
microgram of MtCM protein or 200 ng of *YpCM protein
were used in the assay. Protein concentration was deter-
mined by the Micro BCA method with BSA as the stan-
dard (Pierce, Rockford, IL, USA). The monomeric
molecular mass of the native MtCM was determined by
MALDI-TOF MS. Mass spectra were collected and
analyzed using an Applied Biosystems Voyager-DE STR
Biospectrometry Workstation (Foster City, CA, USA). The
DNA sequence of the cloned genes was confirmed by the
dideoxy sequencing method [35], as adopted for the Applied
Biosystems model 3130 Genetic Analyzer.
S. -K. Kim et al. AroQ chorismate mutases
FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works 4833
Disclaimer
Certain commercial equipment or materials are identified in
this article in order to specify adequately the experimental
procedure. Such identification does not imply recommenda-
tion or endorsement by the National Institute of Standards
and Technology, and nor does it imply that the materials
or equipment identified are necessarily the best available
for the purpose.
Acknowledgements
We thank John Belisle and Patrick Brennan, Colorado
State University, for generously providing Mycobacterium
tuberculosis H37Rv DNA. We also thank Robert Perry,
University of Kentucky, for generously providing Yersinia
pestis Kim10+ DNA. We are grateful to the anonymous

terization of the secreted chorismate mutase (Rv1885c)
from Mycobacterium tuberculosis H
37
R
v
: an *AroQ
enzyme not regulated by the aromatic amino acids.
J Bacteriol 188, 8638–8648.
8 Fleischmann RD, Alland D, Eisen JA, Carpenter L,
White O, Peterson J, DeBoy R, Dodson R, Gwinn M,
Haft D et al. (2002) Whole-genome comparison of
Mycobacterium tuberculosis clinical and laboratory
strains. J Bacteriol 184, 5479–5490.
9 Stewart J, Wilson DB & Ganem B (1990) A genetically
engineered monofunctional chorismate mutase. JAm
Chem Soc 112, 4582–4584.
10 Schneider CZ, Parish T, Basso LA & Santos DS (2008)
The two chorismate mutases from both Mycobacterium
tuberculosis and Mycobacterium smegmatis: biochemical
analysis and limited regulation of promoter activity by
aromatic amino acids. J Bacteriol 190 , 122–134.
11 Liu DR, Cload ST, Pastor RM & Schultz PG (1996)
Analysis of active site residues in Escherichia coli choris-
mate mutase by site-directed mutagenesis. J Am Chem
Soc 118, 1789–1790.
12 Kawabata T (2003) MATRAS: a program for protein
3D structure comparison. Nucleic Acids Res 31, 3367–
3369.
13 Lee AY, Karplus PA, Ganem B & Clardy J (1995)
Atomic structure of the buried catalytic pocket of

19 Schnappauf G, Strater N, Lipscomb WN & Braus GH
(1997) A glutamate residue in the catalytic center of the
yeast chorismate mutase restricts enzyme activity to
acidic conditions. Proc Natl Acad Sci USA
94, 8491–
8496.
20 Ruan B, Fisher KE, Alexander PA, Doroshko V &
Bryan PN (2004) Engineering subtilisin into a fluoride-
triggered processing protease useful for one-step protein
purification. Biochemistry 43, 14539–14546.
21 Deng W, Burland V, Plunkett G III, Boutin A,
Mayhew GF, Liss P, Perna NT, Rose DJ, Mau B,
AroQ chorismate mutases S. -K. Kim et al.
4834 FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works
Zhou S et al. (2002) Genome sequence of Yersinia pestis
KIM. J Bacteriol 184, 4601–4611.
22 Pflugrath JW (1999) The finer things in X- ray diffrac-
tion data collection. Acta Crystallogr D 55, 1718–1725.
23 McCoy AJ, Grosse-Kunstleve RW, Storoni LC & Read
RJ (2005) Likelihood-enhanced fast translation func-
tions. Acta Crystallogr D 61, 458–464.
24 Murshudov GN, Vagin AA & Dodson EJ (1997) Refine-
ment of macromolecular structures by the maximum-
likelihood method. Acta Crystallogr D 53, 240–255.
25 Vagin AA, Steiner RA, Lebedev AA, Potterton L,
McNicholas S, Long F & Murshudov GN (2004) REF-
MAC5 dictionary: organization of prior chemical
knowledge and guidelines for its use. Acta Crystallogr
D 60, 2184–2195.
26 Terwilliger TC (2003) Automated main-chain model

S. -K. Kim et al. AroQ chorismate mutases
FEBS Journal 275 (2008) 4824–4835 Journal compilation ª 2008 FEBS. No claim to original US government works 4835