Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast - Pdf 12

Leishmania infantum LeIF protein is an ATP-dependent
RNA helicase and an eIF4A-like factor that inhibits
translation in yeast
Mourad Barhoumi
1
, N. K. Tanner
2
, Josette Banroques
2,3
, Patrick Linder
2
and Ikram Guizani
1
1 Laboratoire d’Epide
´
miologie et d’Ecologie Parasitaire, Institut Pasteur de Tunis, Tunisia
2De
´
partement de Microbiologie et Me
´
dicine Mole
´
culaire, Centre Me
´
dical Universitaire, Gene
`
ve, Switzerland
3 Centre de Ge
´
ne
´

Correspondance
I. Guizani, Laboratoire d’Epide
´
miologie et
d’Ecologie Parasitaire, Institut Pasteur de
Tunis, 13 Place Pasteur, BP74, 1002 Tunis,
Tunisia
Fax: +216 71 791 833
Tel: +216 71 844 171
E-mail:
(Received 7 July 2006, revised 15 September
2006, accepted 18 September 2006)
doi:10.1111/j.1742-4658.2006.05506.x
LeIF, a Leishmania protein similar to the eukaryotic initiation factor
eIF4A, which is a prototype of the DEAD box protein family, was origin-
ally described as a Th1-type natural adjuvant and as an antigen that indu-
ces an IL12-mediated Th1 response in the peripheral blood mononuclear
cells of leishmaniasis patients. This study aims to characterize this protein
by comparative biochemical and genetic analysis with eIF4A in order to
assess its potential as a target for drug development. We show that a His-
tagged, recombinant, LeIF protein of Leishmania infantum, which was puri-
fied from Escherichia coli, is both an RNA-dependent ATPase and an
ATP-dependent RNA helicase in vitro, as described previously for other
members of the DEAD box helicase protein family. In vivo experiments
show that the LeIF gene cannot complement the deletion of the essential
TIF1 and TIF2 genes in the yeast Saccharomyces cerevisiae that encode
eIF4A. In contrast, expression of LeIF inhibits yeast growth when endog-
enous eIF4A is expressed off only one of its two encoding genes. Further-
more, in vitro binding assays show that LeIF interacts with yeast eIF4G.
These results show an unproductive interaction of LeIF with translation

forms of all the different Leishmania species tested [8].
Its role in the biology of the parasite is unknown.
In silico predictions and expression levels seem to indi-
cate an involvement in the translation process [17],
although recent alignments of the LeIF protein from
Leishmania braziliensis and Leishmania major with
eIF4A from other organisms show some divergence
[18]. The purpose of this work is to characterize the
LeIF protein by a comparative biochemical and gen-
etic analysis with its apparent homologue in yeast,
eIF4A, in order to assess its potential as a target for
drug development.
The eIF4A-like proteins are the archetype of the
DEAD box family of proteins [19]. The DEAD box
helicases belong to superfamily 2 (SF2) in the classifi-
cation of Gorbalenya and Koonin [20]. All members
of the DEAD box family share nine conserved amino
acid motifs [21–24], including the sequence Asp-Glu-
Ala-Asp (D-E-A-D) that inspired their name. Members
of the DEAD box family are found in a wide range of
organisms, including bacteria and eukaryotes ranging
from yeast to humans, and they are implicated in vir-
tually every cellular process involving RNA. These
include transcription, ribosomal biogenesis, pre-mRNA
splicing, RNA export, translation, and RNA degrada-
tion [25–27]. In vitro analyses of purified proteins show
an RNA-dependent ATPase activity and in some cases
ATP-dependent unwinding activity [28–31]. The solved
crystal structures of various DEAD box proteins,
including yeast eIF4A, show a core structure that

eIF4F complex has been initiated [42]. However, little
is known regarding the role of these factors in trans-
lation.
In this work we studied the biochemical properties
of purified, recombinant, LeIF protein from Leishma-
nia infantum, and we demonstrate that it is an
RNA-dependent ATPase and an ATP-dependent RNA
helicase. Sequence alignments show that LeIF is closely
related to known eIF4A factors, but its closest homo-
logue in humans is DDX48, also known as eIF4AIII,
which plays a role in nonsense-mediated mRNA decay
and nuclear mRNA splicing [43–46]. Genetic studies in
the yeast Saccharomyces cerevisiae provided evidence
that LeIF can impair cell growth and can associate
with yeast proteins involved in translation initiation,
although it is not able to complement the deletion of
the yeast-encoded eIF4A. Finally, in vitro coimmuno-
precipitation experiments show that LeIF interacts
with the yeast translation initiation factor eIF4G. Our
results also point to the importance of the 25 amino
terminal residues in enhancing the ability of the pro-
tein to interfere with the translation machinery of
yeast. All this confirms an unproductive interaction of
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5087
LeIF with translation initiation factors in yeast and
interest for it as a potential drug target.
Results
Sequence analysis
LeIF protein of L. infantum has 98% and 100% iden-

DDX48. The differences on the sequence level seem to
be randomly distributed on the carboxyl terminal
RecA-like domain (domain 2) while they tend to be
more clustered in the amino terminal domain (domain
1). In particular, the most notable differences are seen
in the sequence upstream of the isolated, highly con-
served phenylalanine of the recently identified Q motif
[49] and between motifs I and II. The LeIF protein
has all the conserved motifs characteristic of DEAD
box helicase (motifs Q, I, Ia, Ib, II, III, IV, V, and VI)
that are known to be important for ATP binding and
hydrolysis, for RNA binding and for RNA unwinding.
This prompted us to characterize its biochemical activ-
ities and compare them to yeast eIF4A.
LeIF protein has an RNA-dependent ATPase
activity
We subcloned the LeIF gene into a pET22b plasmid
containing a carboxyl terminal His6 tag, expressed the
protein in the Origami Escherichia coli strain and puri-
fied the soluble protein by nickel-nitrilotriacetic acid
agarose chromatography (Fig. 2). We estimated the
protein to be greater than 90% pure after this column.
We also cloned, expressed and purified a mutant in
motif I (K76A) as a control; a similar mutation in
eIF4A disrupts ATP binding and ATPase activity
[49,50]. The identity of the proteins was verified using
antibodies raised against His and LeIF (data not
shown).
The purified recombinant proteins were used in ATP-
ase assays that measured the free phosphate released,

)118
IF42_Hu (Q14240) 407 46402 5.33 56.3 84.6 e
)117
IF42_Mus (P10630)
IF41_Hu (P60842) 406 46154 5.32 56.1 84.1 e
)115
IF41_Mus (P60843)
eIF4A_Sc (P10081) 394 44566 5.02 54.6 83.4 e
)109
Fal1_Sc (Q12099) 399 45213 9.09 52.6 83.9 e
)104
124 K
80.0K
49.0K
34.8K
28.9K
20.6K
209 K
MW
GST-elF4G
LeIF
elF4A
Δ25LeIF
Fig. 2. Expression and purification of the proteins used. Aliquots of
purified His6-LeIF, His6-D25LeIF, His6-eIF4A and GST-eIF4G protein
were resolved by SDS polyacrylamide gel and stained with Coo-
massie brilliant blue. The positions of the Bio-Rad prestained mark-
ers (in kDa) are indicated at the left. The K76A mutant of LeIF had
purity similar to LeIF (not shown).
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase

cat
was 72 ± 9 s
)1
and the k
cat
⁄ K
m
was 0.21 ± 0.7 s
)1
Ælm
)1
. LeIF was
inhibited by ADP, which had a binding affinity similar
to that for ATP. We also determined the kinetic
parameters for eIF4A. However, ADP binds eIF4A
with a higher affinity than ATP [49], which made our
measurements less reliable, especially at higher ATP
concentrations. Nevertheless, the values were in
the same range as those for LeIF with a K
m
of
250 ± 90 lm,ak
cat
of 39 ± 7 s
)1
and a k
cat
⁄ K
m
of

themselves. Although the same oligonucleotide was
hybridized on both RNAs (calculated DG° ¼ –19.8
kcalÆmol
)1
under standard conditions), the 5¢ duplex
had a slightly lower T
m
, which probably resulted
because the 5¢ duplex RNA (K06) could form a
moderately stable (calculated DG° ¼ –4.5 kcalÆmol
)1
)
intramolecular hairpin that could compete for the
A

0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
Velocity (µM/min)
[ATP] mM
B
0
10
20

Our biochemical analyses showed that LeIF had very
similar properties to yeast eIF4A. However, this provi-
ded only circumstantial evidence that LeIF is a transla-
tion initiation factor. Consequently, we used genetic
studies in the yeast S. cerevisiae to understand the
potential role of LeIF in the translation initiation pro-
cess. In order to test whether the LeIF gene can com-
plement the deletion of the essential TIF1 and TIF2
genes in yeast, which encode eIF4A, we subcloned the
LeIF gene into both low and high copy number yeast
plasmids, p415-PL-ADH and p424-PL-ADH, respect-
ively, containing strong, constitutively expressed, ADH
promoters [49]. We also cloned the LeIF gene in an
equivalent plasmid containing a galactose-inducible
promoter p424-PL-GAL. As a control, the yeast eIF4A
gene was cloned into the same vectors.
The various constructs were transformed into the
yeast strain SS13-3A, where both chromosomal copies
of the essential eIF4A genes were deleted and eIF4A
was expressed off the YCplac33-TIF1 (CEN-URA3)
plasmid [49]. Because this plasmid contained a URA3
marker we could selectively eliminate it from trans-
formed cells by plating them on 5-fluoro-orotic acid
(5-FOA)-containing medium. Thus, the protein enco-
ded by the transforming plasmid could ensure growth
of the yeast only if it had the ability to complement
for the missing function. Protein expression was veri-
fied by western blot analysis of cell extracts separated
on 12% SDS Laemmli gels and revealed with anti-HA
IgG (data not shown). None of the LeIF-containing

80
100
15
30
60
0
5
15
30
60
0
5
15
30
60
0
5
15
30
60
0
5
1 mM ATP
no ATP
%Free
Time(min)
LeIF eIF4A
LeIF eIF4A
3 Duplex
5 Duplex

32
P] end-labeled
DNA oligonucleotide was hybridized to two RNA transcripts that
yielded 3¢ and 5¢ duplexes. (B) Time course for ATP-dependent
unwinding of 3¢ and 5¢ duplexes by LeIF protein. Briefly, 50 n
M of
duplex were incubated with 1 l
M protein with or without 1 mM
ATP, at 30 °C, for the times indicated in minutes. To prevent rean-
nealing of the displaced [
32
P]-labeled oligonucleotide, 1 lM cold
DNA oligonucleotide was added as a competitor. Products were
separated on a 15% polyacrylamide gel, which was then subject to
autoradiography and quantification. (C) Comparison of the relative
helicase activities of LeIF to yeast eIF4A.
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5091
GAL promoter. Because the expression of the TIF1
gene under its own promoter is several-folds lower
than that of the TIF2 gene [54], this strain produces
less eIF4A protein on glucose-containing medium than
a normal strain, but it can be induced for higher
eIF4A production on galactose-containing medium.
This strain was previously used to see dominant-negat-
ive phenotypes of eIF4A mutations [54]. Cells expres-
sing the full-length LeIF showed strongly reduced
growth on glucose-containing medium compared to
the cells transformed with the vector alone or with the
plasmid carrying the TIF1 gene (Fig. 5). The difference

SD-Trp plates. Three independent cultures were made
for full-length LeIF and two independent cultures were
made for the other constructs. The cells expressing
full-length LeIF grew about 50% less rapidly than the
cells transformed with the plasmid alone, with a doub-
ling time of 5.0 h versus 2.5 h, respectively. Overex-
pression of eIF4A showed a slight inhibitory effect
(3.0 h) as did the D25LeIF (3.3 h). To rule out the
possibility that the deletion of the amino terminus
affected the expression or stability of the protein, total
cellular proteins were extracted from exponentially
growing cells (D
600
¼ 0.8), separated on an SDS
Laemmli gel, transferred to nitrocellulose membrane
and analyzed by a western blot analysis using anti-HA
and anti-LeIF IgG. The results showed that the recom-
binant HA-tagged D25LeIF protein had a stable
expression comparable to the HA-tagged LeIF protein
(data not shown).
Interaction between LeIF protein and GST-eIF4G
in vitro
The dominant-negative phenotype that we observed
with the LeIF protein suggested that it was capable of
interacting nonproductively with the yeast translation
initiation factors, which resulted in translation inhibi-
tion. However, a more trivial explanation was that
expression of the LeIF protein had a general toxic
effect on the cells that was unrelated to translation per
se. This possibility was unlikely because increased

umns with the bound eIF4G and washed. The retained
proteins were eluted with reduced glutathione, separ-
ated on an SDS Laemmli gel, transferred to a nitrocel-
lulose membrane and then subjected to western blot
analysis using anti-GST, anti-LeIF and anti-His-tag
IgGs. As a control, we carried out the same experi-
ment with recombinant yeast eIF4A.
The results showed that recombinant LeIF and
D25LeIF were capable of binding to the column with
the yeast GST-eIF4G fusion, but not to GST alone
(Fig. 6). Similarly, the yeast eIF4A was retained on
the GST-eIF4G column. Interestingly, a minor degra-
dation product of LeIF was preferentially retained on
the column by the GST-eIF4G in some experiments,
probably as a result of protease cleavage while bound
to the matrix. The visible contaminants on the Coo-
massie blue-stained gel were extracted and sequenced
with a MALDI-TOF mass spectrometer; the 23 kDa
fragment corresponds to the carboxyl terminal region
consisting of domain 2 and residues just amino ter-
minal to motif III. Although previous studies showed
it is the amino terminal domain of eIF4A that binds
to eIF4G [56], recent NMR studies indicate that,
although both domains 1 and 2 interact with the
middle domain of eIF4G, it is the carboxy terminal
domain 2 that forms the main interactions [52]. The
result that the LeIF carboxyl terminal domain was
selectively retained in some experiments would imply
that the LeIF interactions with eIF4G are similar to
those of eIF4A. Regardless, these results show that

borne by chromosome 1, are identified in L. infantum
as LinEIF4A1 (LinJ01.0780 and LinJ01.0790), which
encode for LeIF protein. Another gene, LinEIF4A2
(LinJ28.1600) on chromosome 28, encodes for a sim-
ilar protein that has only 49% identity with LeIF, and
it is predicted to be 14 amino acids shorter. This work
was undertaken to characterize the biochemical prop-
erties of the LeIF protein and to compare its bio-
chemical and genetic properties with its counterpart in
yeast, eIF4A.
The in vitro biochemical studies show that LeIF pro-
tein is an RNA-dependent ATPase that has the ability
to unwind RNA ⁄ DNA heteroduplexes in an ATP-
dependent manner. As is true of the other DEAD box
proteins characterized, nucleotide binding and hydro-
124 K
80.0K
49.0K
34.8K
28.9K
Load
+eIF4G
Control
Load
+eIF4G
Load
+eIF4G
25
LeIF LeIF eIF4A
Fig. 6. Interaction between recombinant His6-LeIF, His6-D25LeIF

lar concentration of ATP (5–10 mm), indicates that
LeIF can bind and hydrolyze ATP in the cell cyto-
plasm. The k
cat
measured for ATP hydrolysis by LeIF,
1.2 min
)1
, is in the range of k
cat
values for eIF4A
(1 min
)1
for the mammalian factor [61] and 0.65 min
)1
for the yeast factor; this study), E. coli SrmB
(1.2 min
)1
[62]) and RNA helicase II (1.9 min
)1
[63])
but is much lower than that of yeast Ded1 (300 min
)1
[28]), yeast Prp22p (400 min
)1
[31]) and E. coli DbpA
(600 min
)1
[60]). This relatively weak ATPase activity
measured in vitro could reflect low intrinsic catalytic
activity. Alternatively, the lack of post-translational

tent with an intrinsic (ATP-independent) affinity of the
protein for RNA. We demonstrate that LeIF protein
can exert its activity in a bidirectional way and unwind
RNA ⁄ DNA heteroduplexes that have either a 3¢
duplex relative to the loading strand or a 5¢ duplex.
This suggests that LeIF acts nonprocessively, and it is
only capable of unwinding short RNA duplexes. The
majority of RNA helicases studied so far are thought
to have directional unwinding. Nevertheless, Ded1,
eIF4A and p68 were reported to unwind duplexes in
both directions in vitro [49,51,59]. Although LeIF has
similar biochemical properties to the eIF4A proteins
from other organisms, there are some differences
between LeIF and the yeast eIF4A that include a
wider range for the optimum magnesium concentra-
tion, a similar affinity for ATP and ADP, and a higher
affinity for RNA. These differences could reflect
fundamental differences in the dynamics of the interac-
tion of the protein within the eIF4F complex or within
the translation machinery. In this regard, the eIF4B
protein has not been described so far and was not
uncovered by the Leishmania or Trypanosoma sp. gen-
ome projects ( />Translation initiation in mammals and yeast is well
studied; it involves many RNA–RNA, protein–RNA,
and protein–protein interactions. In contrast, know-
ledge about the process of protein synthesis in Trypan-
osomatidae protozoans is inferred by indirect evidence,
such as sequence similarities between individual trans-
lation factors with homologues from higher eukaryo-
tes. Recently, Dhalia et al. [17] reported the in silico

eIF4A, abolishes the severe dominant-negative pheno-
type of LeIF. However, this variant also did not
complement the eIF4A double-deletion strain on
5-FOA plates. The simplest explanation for our results
is that LeIF protein can assemble with the yeast pro-
teins to form stable, but nonproductive, interactions
that inhibit translation initiation. The stability or
severity of these interactions are correlated with the
25 amino terminal residues because deletion of them
gives a slight dominant-negative phenotype that is
comparable to that obtained with overexpression of
the yeast eIF4A on the same ADH promoter. Thus,
both D25LeIF and the excess eIF4A sequester the
translation initiation factors in a more transient, or
less inhibitory, fashion. This implies that full-length
LeIF also could act as a translational inhibitor of the
mammalian host cells.
In higher eukaryotes, eIF4A is assumed to be recrui-
ted to the mRNA through its interaction with eIF4G,
which acts as a molecular adapter that coordinates all
steps in translation initiation [68]. It was also shown
that interactions between this fragment and eIF4A are
important for translation initiation and cell growth in
yeast [55]. Our in vitro binding assay demonstrated
that LeIF can interact with the central domain of yeast
eIF4G, preferentially through its carboxy terminal
domain, as has been previously noted for eIF4A [52].
It is likely that this interaction occurs in vivo as well
and that this is, at least partially, the cause of the
dominant-negative phenotype. This is further suppor-

(LeIF, DDX48, eIF4A and Fal1; Fig. 1 and data not
shown). Because it is the amino terminus of LeIF that
confers the strong dominant-negative phenotype in
yeast, it is possible that this short sequence modifies
the function of the RecA domains or alters their inter-
actions with other factors.
Our results provide evidence for the potential
involvement of LeIF in the translation machine in
Leishmania. This is further supported by data recently
published that used RNAsi in T. brucei [72]. The high
identity scores of Leishmania sp. LeIF with proteins
from other Trypanosomatidae species, such as T. bru-
cei and T. cruzi ( which are
pathogens responsible for human African trypanosom-
iasis and Chagas disease, respectively, provides evi-
dence that LeIF could be functional homologue of
eIF4A, and that they all use similar mechanisms for
translation initiation. This is supported by the similar
biochemical properties of LeIF and yeast eIF4A. Nev-
ertheless, definitive evidence must wait for the develop-
ment of an in vitro translation system for Leishmania.
However, the potential interactions of these proteins
with the host systems in the particular context of each
infectious process also will need to be defined. Anti-
genic properties of LeIF, a cytosolic protein, could
result from the infectious process when macrophages
are lysed and the amastigotes, and the contents of the
parasitophorous vacuoles, are released and scavenged
by macrophages. LeIF could also be involved in direct
interactions with the host cell and thereby constitute a

tein deleted for the first 25 amino terminal residues, were
amplified from genomic DNA of L. infantum parasite by
PCR using 5¢ oligonucleotides containing SpeI and NdeI
sites and a 3¢ oligonucleotide containing an XhoI site. The
sequences of oligonucleotides used for PCR amplification
were as follow: (1) the entire LeIF gene 5¢ oligo (LeIF2_up;
GCGCGACTAGTCATGGCGCAGAATGATAAGATCG)
and 3¢ oligo (LeIF2_low; GCGCGCTCGAGCTC
AC
CAAGGTAGGCAGCGAAG; the underlined nucleotide
was a silent mutation added to disrupt a stable hairpin in
the oligo); (2) the LeIF deletion 5¢ oligo (GCGCGACTAG
TCATATGCCGTCCTTCGAC) and the 3¢ oligo as above.
A mutation in motif I (K76 fi A) of LeIF was made using
the fusion PCR technique [77]. In brief, the 5¢ and 3¢
regions flanking the site of mutation were independently
PCR amplified with oligonucleotides containing the muta-
tion and the oligonucleotides specific to the 5¢ or 3¢ ends of
the ORF (LeIF2_up & LeIF2_low). The two PCR frag-
ments were purified on a 0.9% agarose gel, and a second
PCR reaction was done with an aliquot of each fragment
and the 5¢ and 3¢ flanking oligonucleotides. The PCR prod-
ucts were purified on 0.9% agarose gel and cloned into a
Bluescript plasmid (Stratagene, La Jolla, CA, USA) cut
with SpeI and XhoI. Sequences were confirmed by DNA
sequencing.
Protein expression and purification
LeIF variants were subcloned into a pET-22b vector (Nov-
agen, San Diego, CA, USA) cut with NdeI and XhoI, and
they were expressed in the Origami E. coli strain (Nov-

Rad (Hercules, CA, USA) Protein Assay with BSA as the
standard. Purity and concentrations were verified on a 12%
Coomassie-stained SDS polyacrylamide gel. Yeast eIF4A
expression and purification were as previously described
[49].
ATPase assays and analysis
We used a colorimetric assay based on molybdate-Malachite
Green as described previously [49,51]. Buffer conditions
were optimized for LeIF protein (50 mm potassium acetate,
20 mm Mes pH 6.0, 5 mm magnesium acetate, 100 lgÆmL
)1
BSA, and 2 mm dithiothreitol) or for eIF4A (same as for
LeIF except with 1 mm magnesium acetate). Reactions were
in 50 lL volume containing 25 ngÆlL
)1
of protein, 1 mm
ATP and 500 ngÆlL
)1
of total yeast RNA (type III Sigma;
Sigma-Aldrich, St Louis, MO, USA; phenol-chloroform
extracted). Reactions were incubated at 30 °C for various
times, stopped by adding 5 lL of 0.5 m EDTA, pH 8.0, and
pipetted into 96 well microtiter plate to which 150 lLof
molybdate-Malachite Green was added. Absorbance was
measured at 630 nm. The phosphate concentration was
determined from a dilution series of known phosphate con-
centration (0–60 lm) measured at the same time. The back-
ground signal was determined by measuring the reactions in
the absence of protein, in the absence of RNA substrate or
in the absence of ATP. Data were analyzed using kaleida-

duplex, 12.5 lm unlabeled oligonucleotide, 20 mm Mes,
pH 6.0, 50 mm potassium acetate, 5 mm magnesium acet-
ate, 10 mm dithiothreitol, 0.1 mgÆmL
)1
BSA, 1 UÆlL
)1
RNasin (Promega, Madison, WI, USA), various concentra-
tions of protein and 1 mm ATP were used. Assays with
eIF4A were the same except 1 mm magnesium acetate was
used. Reactions were incubated at 37 °C for various times
and then quenched by placing them on ice. A 5 lL solution
of 40% glycerol, 10 mm EDTA, 0.025% Bromophenol Blue
and 0.025% Xylene Cyanole was added and the sample
was loaded onto a 0.75 mm thick 15% polyacrylamide gel
(29 : 1). The gel was subjected to electrophoresis in a Mini-
Protean apparatus (Bio-Rad) at 4 °C for 1 h at 16 W with
100 mm Tris-base, 90 mm boric acid and 1 mm EDTA run-
ning buffer. The radioactive bands within the gel were
detected with a Cyclone phosphoimager (Packard [Perkin-
Elmer], Wellesley, MA, USA) and quantified using the op-
tiquant software (Packard).
Yeast strains, vectors and genetic manipulation
Yeast manipulations, including media preparations, growth
conditions, and 5-fluoro-orotic acid (5-FOA) selection, were
carried out according to standard techniques [78]. The LeIF
gene cloned into the Bluescript vector was subcloned into
p415-PL and p424-PL vectors containing two HA tags, and
SpeI, NdeI, and XhoI restriction sites [49]. Complementa-
tion was tested by transforming the eIF4A-deletion strain,
SS13-3A (tif1::HIS3 tif2::ADE2), containing the YC-

University of Geneva, Switzerland). Antigen–antibody com-
plexes were revealed using peroxydase-coupled secondary
antibodies and diamino-benzidine.
Acknowledgements
We thank Michael Altmann for providing us with
pGEX-6P1-eIF4G and Gerhard Wagner for sending us
a preprint of his paper. We thank Sayda Kamoun for
help with preparation of rabbit anti-LeIF, Olivier
Deloche for the anti-GST IgG and Monique Doe
`
re for
excellent technical help. We are grateful to Olivier
Cordin for technical help, advice, and fruitful discus-
sions. This study received financial support from the
UNICEF ⁄ UNDP ⁄ World Bank ⁄ WHO special pro-
gramme for research and training in tropical diseases,
TDR (ID: A30134), from the Tunisian Ministry of
Scientific Research, Technology and Development of
Competencies (Contrat programme 2004-08 grant to
IG) and by a Swiss National Science Foundation grant
to PL.
References
1 de Almeida MC, Vilhena V, Barral A & Barral-Netto
M (2003) Leishmanial infection: analysis of its first
steps. A review. Mem Inst Oswaldo Cruz 98, 861–870.
2 Herwaldt BL (1999) Leishmaniasis. Lancet 354, 1191–
1199.
3 Echeverria P, Dran G, Pereda G, Rico AI, Requena
JM, Alonso C, Guarnera E & Angel SO (2001)
Analysis of the adjuvant effect of recombinant

leishmaniasis caused by Leishmania infantum is achieved
by immunization with a heterologous prime-boost
regime using DNA and vaccinia recombinant vectors
expressing LACK. Vaccine 21, 2474–2484.
10 Skeiky YA, Guderian JA, Benson DR, Bacelar O,
Carvalho EM, Kubin M, Badaro R, Trinchieri G &
Reed SG (1995) A recombinant Leishmania antigen that
stimulates human peripheral blood mononuclear cells to
express a Th1-type cytokine profile and to produce
interleukin 12. J Exp Med 181, 1527–1537.
11 Skeiky YA, Kennedy M, Kaufman D, Borges MM,
Guderian JA, Scholler JK, Ovendale PJ, Picha KS,
Morrissey PJ, Grabstein KH et al. (1998) LeIF: a recom-
binant Leishmania protein that induces an IL-12-medi-
ated Th1 cytokine profile. J Immunol 161, 6171–6179.
12 Tonui WK, Mejia JS, Hochberg L, Mbow ML, Ryan
JR, Chan AS, Martin SK & Titus RG (2004) Immuni-
zation with Leishmania major exogenous antigens pro-
tects susceptible BALB ⁄ c mice against challenge
infection with L. major. Infect Immun 72, 5654–5661.
13 Webb JR, Kaufmann D, Campos-Neto A & Reed SG
(1996) Molecular cloning of a novel protein antigen of
Leishmania major that elicits a potent immune response
in experimental murine leishmaniasis. J Immunol 157,
5034–5041.
14 Borges MM, Campos-Neto A, Sleath P, Grabstein KH,
Morrissey PJ, Skeiky YA & Reed SG (2001) Potent
stimulation of the innate immune system by a Leishmania
brasiliensis recombinant protein. Infect Immun
69, 5270–

driving forces behind RNA metabolism. Nat Rev Mol
Cell Biol 5, 232–241.
23 Silverman E, Edwalds-Gilbert G & Lin RJ (2003)
DExD ⁄ H-box proteins and their partners: helping RNA
helicases unwind. Gene 312, 1–16.
24 Tanner NK & Linder P (2001) DExD ⁄ H box RNA heli-
cases: from generic motors to specific dissociation func-
tions. Mol Cell 8, 251–262.
25 de la Cruz J, Kressler D & Linder P (1999) Unwinding
RNA in Saccharomyces cerevisiae: DEAD-box proteins
and related families. Trends Biochem Sci 24, 192–198.
26 Fuller-Pace FV (1994) RNA helicases: modulators of
RNA structure. Trends Cell Biol 4, 271–274.
27 Schmid SR & Linder P (1992) D-E-A-D protein family
of putative RNA helicases. Mol Microbiol 6, 283–291.
28 Iost I, Dreyfus M & Linder P (1999) Ded1p, a DEAD-
box protein required for translation initiation in Sac-
charomyces cerevisiae, is an RNA helicase. J Biol Chem
274, 17677–17683.
29 Okanami M, Meshi T & Iwabuchi M (1998) Characteri-
zation of a DEAD box ATPase ⁄ RNA helicase protein
of Arabidopsis thaliana. Nucleic Acids Res 26, 2638–
2643.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5098 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
30 Rogers GW Jr, Richter NJ & Merrick WC (1999) Bio-
chemical and kinetic characterization of the RNA heli-
case activity of eukaryotic initiation factor 4A. J Biol
Chem 274, 12236–12244.
31 Wagner JD, Jankowsky E, Company M, Pyle AM &

ing protein I of Leishmania: functional analysis and
localisation in trypanosomatid parasites. Nucleic Acids
Res 28, 1211–1220.
40 Batista JA, Teixeira SM, Donelson JE, de Kirchhoff LV
& CM (1994) Characterization of a Trypanosoma cruzi
poly(A)-binding protein and its genes. Mol Biochem
Parasitol 67, 301–312.
41 Hotchkiss TL, Nerantzakis GE, Dills SC, Shang L &
Read LK (1999) Trypanosoma brucei poly(A) binding
protein I cDNA cloning, expression, and binding to 5
untranslated region sequence elements. Mol Biochem
Parasitol 98, 117–129.
42 Yoffe Y, Zuberek J, Lewdorowicz M, Zeira Z, Keasar
C, Orr-Dahan I, Jankowska-Anyszka M, Stepinski J,
Darzynkiewicz E & Shapira M (2004) Cap-binding
activity of an eIF4E homolog from Leishmania. RNA
10, 1764–1775.
43 Chan CC, Dostie J, Diem MD, Feng W, Mann M, Rapp-
silber J & Dreyfuss G (2004) eIF4A3 is a novel compo-
nent of the exon junction complex. RNA 10, 200–209.
44 Ferraiuolo MA, Lee CS, Ler LW, Hsu JL, Costa-Mattioli
M, Luo MJ, Reed R & Sonenberg N (2004) A nuclear
translation-like factor eIF4AIII is recruited to the mRNA
during splicing and functions in nonsense-mediated
decay. Proc Natl Acad Sci USA 101, 4118–4123.
45 Palacios IM, Gatfield D, St Johnston D & Izaurralde E
(2004) An eIF4AIII-containing complex required for
mRNA localization and nonsense-mediated mRNA
decay. Nature 427
, 753–757.

by eIF4B, eIF4H, and eIF4F. J Biol Chem 276, 30914–
30922.
54 Schmid SR, Buser P, Coppolecchia R, Fischli A &
Linder P (1993) Analysis of the genes encoding eIF-4A
from yeast. In Protein Synthesis and Targeting in Yeast
(Brown AJP, Tuite MF & McCarthy JEG, eds), pp.
131–142. Springer-Verlag, Berlin.
55 Dominguez D, Altmann M, Benz J, Baumann U &
Trachsel H (1999) Interaction of translation initiation
factor eIF4G with eIF4A in the yeast Saccharomyces
cerevisiae. J Biol Chem 274, 26720–26726.
56 Korneeva NL, First EA, Benoit CA & Rhoads RE
(2005) Interaction between the NH2-terminal domain of
eIF4A and the central domain of eIF4G modulates
RNA-stimulated ATPase activity. J Biol Chem 280,
1872–1881.
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5099
57 Rocak S, Emery B, Tanner NK & Linder P (2005)
Characterization of the ATPase and unwinding activities
of the yeast DEAD-box protein Has1p and the analysis
of the roles of the conserved motifs. Nucleic Acids Res
33, 999–1009.
58 Yao N, Hesson T, Cable M, Hong Z, Kwong AD, Le
HV & Weber PC (1997) Structure of the hepatitis C
virus RNA helicase domain. Nat Struct Biol 4, 463–467.
59 Hirling H, Scheffner M, Restle T & Stahl H (1989)
RNA helicase activity associated with the human p68
protein. Nature 339, 562–564.
60 Tsu CA & Uhlenbeck OC (1998) Kinetic analysis of the

myces cerevisiae. Biochim Biophys Acta 1050, 140–145.
68 Hentze MW (1997) eIF4G: a multipurpose ribosome
adapter? Science 275, 500–501.
69 Ivens AC, Peacock CS, Worthey EA, Murphy L,
Aggarwal G, Berriman M, Sisk E, Rajandream MA,
Adlem E, Aert R et al. (2005) The genome of the kineto-
plastid parasite, Leishmania major. Science 309, 436–442.
70 Mayer MG & Floeter-Winter LM (2005) Pre-mRNA
trans-splicing: from kinetoplastids to mammals, an easy
language for life diversity. Mem Inst Oswaldo Cruz 100,
501–513.
71 Conti E & Izaurralde E (2005) Nonsense-mediated
mRNA decay: molecular insights and mechanistic varia-
tions across species. Curr Opin Cell Biol 17, 316–325.
72 Dhalia R, Marinsek N, Reis CR, Katz R, Muniz JR,
Standart N, Carrington M & de Melo Neto OP (2006)
The two eIF4A helicases in Trypanosoma brucei are
functionally distinct. Nucleic Acids Res 34, 2495–2507.
73 Kamoun-Essghaier S, Guizani I, Strub JM, Van Dors-
selaer A, Mabrouk K, Ouelhazi L & Dellagi K (2005)
Proteomic approach for characterization of immunodo-
minant membrane-associated 30- to 36-kiloDalton frac-
tion antigens of Leishmania infantum promastigotes,
reacting with sera from Mediterranean visceral leishma-
niasis patients. Clin Diagn Lab Immunol 12, 310–320.
74 Nandan D & Reiner NE (2005) Leishmania donovani
engages in regulatory interference by targeting macro-
phage protein tyrosine phosphatase SHP-1. Clin Immu-
nol 114, 266–277.
75 Chang KP & McGwire BS (2002) Molecular determi-


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status