Báo cáo khoa học: Characterization and synthetic applications of recombinant AtNIT1 from Arabidopsis thaliana doc - Pdf 12

Characterization and synthetic applications of recombinant AtNIT1
from
Arabidopsis thaliana
Steffen Osswald,
1
Harald Wajant
2
and Franz Effenberger
1
1
Institut fu
È
r Organische Chemie, and
2
Institut fu
È
r Zellbiologie und Immunologie, Universita
È
t Stuttgart, Germany
The nitrilase AtNIT1 from Arabidopsis thaliana was over-
expressed in Escherichia coli with an N-terminal His
6
tag
and puri®ed by zinc chelate anity chromatography in a
single step almost to homogeneity in a 68% yield with a
speci®c activity of 34.1 U ámg
)1
. The native enzyme
( 450 k Da) consists of 11±13 subunits (38 kDa). The
temperature optimum was determined to be 35 °C, and a
pH optimum of 9 was fo und. Thus, recombinant AtNIT1

[4,5]. The genes of AtNIT1±3 are clustered on chromosome 3
and have sequence identities of more than 80% at the
amino acid level, whereas AtNIT4 has a distinct chromo-
somal localization a nd is only 65% identical with AtNIT1±3
[5]. The subdivision of the Arabidopsis nitrilases i nto
AtNIT1±3 and AtNIT4 is also re¯ected by functional
differences between these enzymes. Whereas AtNIT1±3
convert 3-indolylacetonitrile (IAN) into the plant hormone
3-indolylacetic acid, IAN is not a substrate for AtNIT4
[6,7]. Moreover, homologs of AtNIT1±3 have exclusively
been found in Arabidopsis and other members of the
brassicaceae, whereas AtNIT4 isoforms have also been
reported in species from other taxonomic groups such as
tobacco [8] and rice [7]. In accordance with the brassi-
caceae-restricted occurrence of nitrilases of the AtNIT1±3
type, t hese en zymes seem to be involved in the degradation
of nitriles released from glucosinolates, which can be found
in high concentrations in various species of the brassicaceae
[9]. Recent studies have shown that AtNIT4 and two
related n itrilases f rom t obacco are b-cyano-(
L
)-alanine
nitrilases [7]. As nitrilases of the AtNIT4 type have been
found in taxonomically quite distinct groups, it seems likely
that AtNIT4 homologs may exist in all higher plants.
In accordance with this is the fact that the substrate of the
AtNIT4-type nitrilases, b-cyano-(
L
)-alanine, seems to occur
in all plants as t he result of detoxi®cation of cyanide, which

3-indolylacetonitrile.
Note: This is part 42 of the series of publications Enzyme catalyzed
reactions. Part 41 is Eenberger , F. & Osswald, S. (2001) Select ive
hydrolysis of aliphatic dinitriles to monocarboxylic acids by a nitrilase
from Arabidopsis thaliana. Synthesis 1866±1872.
(Received 3 September 2001, revised 23 November 2001, accepted 26
November 2001)
Eur. J. Biochem. 269, 680±687 (2002) Ó FEBS 2002
MATERIALS AND METHODS
Expression cloning of AtNIT1
AtNIT1 cDNA was cloned in the expression vector pQE10
(Qiagen), which allows isopropyl b-
D
-thiogalactoside-
induced expression of N-terminally His-tagged recombinant
protein. In brief, the c oding region and p art of the
3¢-noncoding region of AtNIT1 cDNA were ampli®ed
from an A. thaliana cDNA library (Stratagene) with an
advanced polymerase system (Clontech) using the primers
AtNIT1-for (5¢-GCTGCTAGATCTTATGTC AACTGT
CCAAAA CGCAACTCCTTTTAACGGCGTTGCCCC
ATCCACC -3¢; start codon according to [4] in bold) and
AtNIT1-rev (5¢-ACAATTGATGATTCAACGCCCAAC
3¢). Using the BglII sites in the 5¢ overhang of AtNIT1-for
and the 3¢-noncoding region of the cDNA, the AtNIT1
cDNA was inserted in-frame in the BamHI site of pQE10.
The resulting expression plasmid pQE10-AtNIT1 was
sequenced to con®rm the identity of the AtNIT1 sequence
after PCR ampli®cation. pQE10-AtNIT1 was transformed
in Escherichia coli M15[pREP4] cells (Qiagen) for over-

-charged HiTrap
metal c helate af®nity chromatography column (Pharmacia).
The column was rinsed successively with 20 mL each of
sodium p hosphate buffer B (50 m
M
,100 m
M
NaCl, p H 7.8)
and buffer A until the absorbance reached the base line of
column equilibration. Nonspeci®cally bound proteins were
eluted at a ¯ow rate of 2 mLámin
)1
in a 22.5-mL linear
gradient of 0±100 m
M
imidazole in buffer A, and succes-
sively in 5 mL of sodium phosphate buffer C (50 m
M
,
100 m
M
imidazole, pH 7.8). After additional rinsing with
11.25 mL buffer A, AtNIT1 was eluted with 11.25 m L
sodium phosphate buffer (50 m
M
,100 m
M
EDTA, pH 7.8).
To the collected fractions (2.5 mL), 25 lL sodium phos-
phate buffer (50 m

methanol (0.25
M
). The reaction was carried out for 1 h at
35 °C. An aliquot of 1 mL was acidi®ed with 50 lLHCl
(5
M
) and ex tracted with d iethyl ether (5 mL). After
centrifugation (5 min, 2000 g) and cooling at )30 °Cfor
30 min to freeze the aqueous layer, the organic layer was
decanted and derivatized with ethereal diazomethane
(0.2
M
). After concentration, the residue was taken up in
1 m L d iethyl ether and subjected to gas chromatography on
a C arlo Erba Fractovap 4160 wit h FID and Spectra Physics
minigrator using a capillary glass column ( 50 m) with PS086
and carrier gas 50 kPa hydrogen. Peak areas were calibrated
as follows. A volume of 5 mL each of a solution of
3-phenylpropionitrile (181.5 mg) and 3-phenylpropionic
acid (205.2 mg) in methanol (10 mL), and Tris/HCl buffer
(990 mL, 70 m
M
, pH 8.5) were mixed, and 5 mL from this
mixture was added to 5 mL of the 3-phenylpropionitrile
solution. This procedure w as repeated three times. A sample
of 1 mL from each solution was treated as described above
and analyzed by gas chromatography. The conversion
factor was determined from the plot of ratio areas vs. ratio
concentrations. One unit is de®ned as 1 lmol convert-
edámin

diluted (1 : 5000) at 4 °C w ith the respectiv e buffer. Aft er
preliminary w arming at room temperature, the reaction w as
initiated by the addition of 50 lL 3-phenylpropionitrile in
methanol.
RESULTS
Puri®cation and determination of
K
m
values
Recombinant AtNIT1 was puri®ed from E. coli lysates by
metal chelate af®nity chromatography using a Zn
2+
-charged
Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 681
HiTrap column. After a wash step with 100 m
M
imidazole,
the tightly bound AtNIT1 was eluted with h igh recovery by
100 m
M
EDTA (Fig. 1A). This single-step puri®cation
yielded almost pure AtNIT1 (Fig. 1B) with a speci®c activity
of 34.1 Uámg
)1
(Table 1) and a subunit mass of 38 kDa
(Fig. 1 B). Recombinant AtNIT1 was e luted during
gel-®ltration chromatography (Fig. 1C) in fractions corre-
sponding to a molecular m ass of  450 kDa, s uggesting that
native AtNIT1 occurs as a homomeric protein complex of
11±13 subunits (data not shown).

result with protease inhibitors was achieved using EDTA at
a concentration of 2 m
M
(Table 2). Thus, all buffers used
for cell disintegration and conversions were supplemented
with dithiothreitol a nd EDTA (2 m
M
each). In this way, we
succeeded in signi®cantly increasing the enzyme stability of
both crude extract and puri®ed enzyme: after 2 days at
room temperature and 3 months at 4 °C, 95% and 90%
enzyme activity, respectively, remained.
Temperature optimum
The nitrilases investigated so far generally show highest
activity in the temperature range 35±40 °C, no matter what
the enzyme source [18,21±23]. However, as little is known
about their stability a t higher temperatures, which is a
decisive factor in their application as biocatalysts in
chemical reactions, the effect of temperature on AtNIT1
stability was investigated. Recombinant AtNIT1 shows a
sharp temperature optimum at 35 °C, determined after 1 h
of incubation, with a gentle slope at < 35 °C a nd a steeper
slope at > 35 °C (Fig. 3). E nzyme stability at different
temperatures was determined after 24 h of incubation. At
25 °Cand35°C, only a slight decrease in activity was
found. At 35 °C, the relative enzyme activity amounts to
 80%, whereas the enzyme was almost completely deac-
tivated at 40 °C. The highest absolute enzyme activity,
Fig. 1. Puri®cation and characterization of recombinant AtNIT1 in
E. c oli. (A) Lysate of isopropyl b-

activity (U)
Total
protein (mg)
Speci®c
activity (Uámg
)1
)
Puri®cation
(fold)
Yield (%)
Crude extract 459 4350 0.10 1 100
HiTrap 312 9.15 34.10 326 68
682 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
however, w as found at 35 °C, and, moreover, t he stability at
this temperature is suf®cient for applications in longer
lasting biotransformations.
PH dependence of AtNIT1
The pH dependence of AtNIT1 was investigated with
different buffer systems in order to guarantee suf®cient
buffering capacity in the range pH 6±10 (Fig. 4).
As can be seen from Fig. 4, the choice of the buffer
system affects the enzyme activity slightly, changing from
Tris/HCl to glycine/NaOH. With both buffer systems,
however, an activity optimum of pH 9.0 was found, with
97% of the maximum activity being measured at pH 8.5.
The decrease in enzyme activity at pH values > 9 is not an
irreversible process: acidifying an enzyme solution with
pH 10 back to pH 9 r esulted in > 80% r ecovery of activity.
The pH optimum measured in this way is in slight contrast
with the value of pH 7.5 reported for the nitrilase from

)1
in the case of inhibitors.
Reagent
Concn
(m
M
)
Relative
activity
(%)
Mercaptoethanol
a
162
264
554
Dithiothreitol
a
161
280
578
Aminophenylmethanesulfonyl ¯uoride
b
176
523
EDTA
b
188
296
10 94
100 97

Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 683
to be a poor substrate (Table 3). Also the hydrolytic rate of
cinnamonitrile, an a,b-unsaturated system, is signi®cantly
diminished compared with the corresponding saturated
phenylpropionitrile. A double bond in th e b,c-position,
however, has almost no effect on enzyme activity, as can be
seen if 4-phenyl-3-butenenitrile is compared with 4-phenyl-
butyronitrile. Suitability as a substrate is strongly in¯ue nced
by the substituents in the 2-position. All substituents other
than ¯uoro inhibit enzymatic hydrolysis almost completely
(Table 3). Nitriles with substituents in the 3-position, for
example 3-methylbutyronitrile, a re also poor substrates, b ut
the decrease in the hydrolytic rate is less pronounced.
Interestingly, benzoylglycine nitrile is a much better
substrate for AtNIT1 than glycine nitrile itself.
Acid amides as byproducts of AtNIT1-catalyzed
nitrile hydrolysis
Acid amide was ®rst detected as a major product of
AtNIT1-catalyzed nitrile hydrolysis with fumaronitrile as
substrate. In this reaction, which was followed by gas
chromatography, less than 10% of the expected amount of
3-cyanoacrylic acid, estimated from the calibration, was
formed. A product mixture of an unidenti®ed product and
3-cyanoacrylic acid in the ratio 93 : 7 (Table 4) was found
by HPLC. As demonstrated by co-injection, fumaric acid
was not formed in the r eaction. After extractive separation
from 3-cyanoacrylic acid and subsequent recrystallization
from chloroform, the unknown product was isolated in
68% yield and unambiguously characterized as 3-cyano-
acrylamide by elemental analysis and NMR spectroscopy.

)1
á(mg protein)
)1
 100% at pH 8.0;
1.736 lmolámin
)1
á(mg protein)
)1
 100% at pH 6.0].
Substrate
Relative
activity
(%)
Product
distribution
(amide : acid)
a
Relative activity referred to the E-isomer.
b
Conversion at
pH 6.0, relative activity referred to butyronitrile under these
conditions.
Table 3. Relative activities of recombinant AtNIT1-catalyzed hydrolysis of nitriles. The reactions were performed in Tris/HCl buer (7 0 m
M
,with
dithiothreitol and EDTA, 2 m
M
each, pH 8) at room temperatu re. At a concen tratio n of 1.25 m
M
, all substrates were completely soluble; the

a
154 Glycine nitrile 0.4
Cinnamonitrile 48 2-Amino-4-methylpentanenitrile < 0.03
b
4-Phenylbut-3-enenitrile 188 Benzoylglycine nitrile 65
a
See also literature data [9].
b
24 h reaction time.
c
Hydrolysis at pH 7.0.
684 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
(Table 4). Amides have also been found as major products
in the AtNIT1-catalyzed hydrolysis of a-¯uoroarylaceto-
nitriles [15]. An a-¯uoro substituent, however, does not
conclusively result in amide formation as can be seen in the
hydrolysis of a-¯uorobutyronitrile, y ielding 95% of the
corresponding acid (Table 4). Nevertheless, both a ¯uoro
substituent in the a position and a second nitrile group
conjugated to the nitrile (fumaronitrile) seem to play a
decisive role in amide formatio n.
The assumption that electron-withdrawing substituents
favor the formation of amides was supported by the
hydrolysis of differently 3-substituted acrylonitriles
(Table 4). Whereas 3-nitroacrylonitrile was hydrolyzed to
3-nitroacrylamide as sole product, in the case of the donor-
substituted 3-methoxyacrylonitrile and crotononitrile, the
corresponding acids were formed almost quantitatively
(Table 4). As 3-nitroacrylonitrile tends to decompose under
basic conditions, the reaction was performed at pH 6

accessibility and reasonable stability make AtNIT1 a
promising c andidate for applications in organic chemistry,
in particular the synthesis of optically active 2-¯uorocarb-
oxylic acids, which are very useful as analogs o f pheromones
and antirheumatics, for example [15]. Also the mono-
hydrolysis of aliphatic dinitriles to monocarboxylic acids is
of great industrial interest because selective chemical
hydrolysis is virtually impossible [16].
Amide formation
The formation of amides as byproducts of nitrilase-
catalyzed reactions was ®rst reported as early as 1964
[28,29]. Furthermore, in subsequent publications [19,30±
32], small amounts of amides (< 15%) could be detected
besides the carboxylic acids during nitrilase catalysis. In all
cases, the amide to acid ratio was indepen dent of reaction
conditions (temperature and pH) and the applied enzyme
concentrations. In their basic work on the four A. thaliana
nitrilases NIT1±4, Bartel & Fink [5] described the
conversion of IAN into 3-indolylacetic acid and indole-
3-acetamide and found that the latter is not a substrate
for these enzymes. For the hydrolysis of b-cyano-
(
L
)-alanine, catalyzed by NIT4, Piotrowski et al.[7]
reported the simultaneous formation of asparagine and
aspartic acid in a ratio of 1.5 : 1, independent of reaction
conditions. A dependence of the amide to acid ratio on
the substituents, however, has not been reported in the
literature so far.
Until now the reaction mechanism of n itrilase-catalyzed

on the kind of substituent. The preference for acid amide
formation by a-¯uoro substituents or by acceptor groups
(CN, NO
2
)inp-conjugated nitriles is clear evidence of an
electronically preferred formation and stabilization of the
tetrahedral intermediate A in the enzyme±substrate com-
plex. Becau se the crystal stru cture o f the active site of
AtNIT1 is not known, how the stabilization of the
tetrahedral intermediate assists the elimination of cysteine
to yield the acid amide cannot be explained.
CONCLUSIONS
Chemical hyd rolysis of many nitriles with labile substituents
catalyzed by acid or base is virtually impossible because of
the drastic reaction conditions required. Therefore, over the
last few y ears, b iocatalysts capable of hydrolyzing nitriles to
carboxylic acids have been intensively investigate d [36].
In most cases, however, nitrile hydratase±amidase s ystems
have been described, although not exclusively [36]. The
nitrilase AtNIT1 from A. thaliana is the ®rst plant nitrilase to
be investigated with respect to its synthetic potential. Because
of optimized expression, the enzyme is now accessible in
suf®cient quantities. Clear optimization of enzyme stability
under the reaction conditions, which is important for
practical a pplication, could be achieved b y addition of the
protease inhibitor EDTA (Table 2). Therefore, slowly
reacting nitriles can also be hydrolyzed without problem.
The most important criteria for practical applications,
however, are the substrate range and selectivity of an
enzyme. In contrast with other nitrile-hydrolyzing enzymes,

rster for fermentation, and Dr A. Baro for
preparing the manuscript.
REFERENCES
1. Legras, J.I., Chuzel, G ., Arnaud, A. & Galzy, P. (1990) Natural
nitriles and their metabolism. World J. Microbiol. Biotechnol. 6,
83±108.
2. Faber, K. (1995) Biotransformations in Organic Chemistry,2nd
edn. Springer, Berlin .
3. Drauz, K. & Waldmann, H. (1995) Enzyme Catalysis in Organic
Synthesis. Verlag Chemie, Weinheim.
4. Bartling, D., Seedorf, M., Mitho
È
fer, A. & Weiler, E.W. (1992)
Cloning and expression of an Arabidopsis nitrilase which can
convert indole-3-acetonitrile to t he plant hormone, indole-3-acetic
acid. Eur. J. Biochem. 205, 417±424.
5. Bartel,B.&Fink,G.R.(1994)Dierentialregulationofanauxin-
producing nitrilase gene family in Arabidopsis thaliana. Proc. Natl
Acad. Sci. USA 91, 6649±6653.
6. Schmidt, R.C., Mu
È
ller, A., H ain, R., Bartling, D. & Weiler, E.W.
(1996) Transgenic tobacco plants expressing the Arabidopsis
thaliana nitrilase II enzyme. Plant J. 9, 683±691.
7. Piotrowski, M., Sc ho
È
nfelder, S. & Weiler, E.W. (2001) The
Arabidopsis thaliana iso ge n e NIT4 and its orthologs in tobacco
encode b-cyano-
L

J. Biotechnol. 60, 165±174.
15. Eenberger, F. & Oûwald, S. (2001) Enantioselective hydrolysis of
(RS)-2-¯uoroarylacetonitriles using nitrilase from Arabidopsis
thaliana. Tetrahedron: Asymmetry 12, 279±285.
16.Eenberger,F.&Oûwald,S.(2001)Selectivehydrolysisof
aliphatic dinitriles to monocarboxylic acids by a nitrilase from
Arabidopsis thaliana. Synthesis 1866±1872.
17. Harper, D.B. (1977) Microbial metabolism of aromatic nitriles.
Enzymology of C±N cleavage by Nocardia sp. (Rhodococcus
group) N.C.I.B. 11216. Biochem. J. 165, 309±319.
18. Bhalla, T.C., Miura, A., Wakamoto, A., Ohba, Y. & Furuhashi,
K. (1992) Asymmetric hydrolysis of a-aminonitriles to optically
active amino acids by a nitrilase of Rhodococcus rhodochrous
PA-34. Appl. Microbiol. Biotechnol. 37, 184±190.
19. Stevenson,D.E.,Feng,R.,Dumas,F.,Groleau,D.,Mihoc,A.&
Storer, A.C. (1992) Mechanistic and structural studies on
Rhodococcus ATCC 39484 nitrilase. Biotechnol. Appl. Biochem. 15,
283±302.
20. Kobayashi, M., Yanaka, N ., Nagasawa, T. & Y amada, H. (1990)
Puri®cation and characterization of a novel nitrilase of
686 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
Rhodococcus rhodochrous K22 that acts on aliphatic nitriles. J.
Bacteriol. 172, 4807±4815.
21. Bestwick, L.A., Gronning, L.M., James, D.C., Bones, A. &
Rossiter, J.T. (1993) Puri®cation and characterization of a nitrilase
from Brassica napus. Physiol. Plant. 89, 811±816.
22. Nagasawa, T., Mauger, J. & Yamada, H. (1990) A novel nitril ase,
arylacetonitrilase, of Alcaligenes faecalis JM3: puri®cation and
characterization. Eur. J. Biochem. 194, 765±772.
23. Kobayashi, M., Nagasawa, T. & Yamada, H . (1989) Nitrilase of

32. Goldlust, A. & Bohak, Z. (1989) Induction, puri®cation, and
characterization of the nitrilase of Fusarium oxysporum f. sp.
melonis. Biotechnol. Appl. Biochem. 11, 581±601.
33. Dufour, E., Storer, A .C. & Me
Â
nard, R. ( 1995) Engineering n itrile
hydratase a ctivity into a cysteine protease by a single mutation.
Biochemistry 34, 16382±16388.
34. Chaturvedi, R.K., MacMahon, A.E. & Schmir, G.L. (1967) The
hydrolysis of thioimidate esters. Tetrahedral intermediates and
general acid catalysis. J. Am. Chem. Soc. 89, 6984±6993.
35. Chaturvedi, R.K. & Schmir, G.L. (1969) The hydrolysis of
thioimidate esters. II. Evidence for the formation of three species
of the tetrahedral intermediate. J. Am. C hem. Soc . 91, 737±746.
36. Wieser, M. & Nagasawa, T. (2000) Stereoselective nitrile-con-
verting enzymes. In Stereoselective Biocatalysis (Patel, R.N ., ed.),
pp. 463±465. Marcel Dekker, New York.
37. Bengis-Garber, C. & Gutman, A.L. (1988) Bacteria in organic
synthesis: se lective conversion o f 1,3-dicyanobenzene into
3-cyanobenzoic acid. Tetrahedron Lett. 29, 2589±2590.
38. Eenberger, F. & Oûwald, S. (2001) E-Selective hydrolysis of
E,Z a,b-unsaturated nitrile s by the recombinant nitrilase A tN IT1
from Arabidopsis thaliana. Tetrahedron: Asymmetry 13, 2581±
2587.
39. Quiro
Â
s, M., Astorga, C., Rebolledo, F. & Gotor, V. (1995)
Enzymic selective transformations of diethyl fumarate. Tetra-
hedron 51, 7715±7720.
40. Klibanov, A.M. & Siegel, E.H. (1982) Geometric speci®city of


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status