Structural and functional investigations of Ureaplasma
parvum UMP kinase – a potential antibacterial drug target
Louise Egeblad-Welin
1
, Martin Welin
2,
*, Liya Wang
1
and Staffan Eriksson
1
1 Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden
2 Department of Molecular Biology, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden
Ureaplasma parvum belongs to the class Mollicutes,
which have the smallest genomes known in any free-
living organisms, and a very low G + C content [1]. It
is a human pathogen that normally colonizes the
urogenital tract, where it is involved in a variety of
diseases such as urethritis and prostatitis. During
pregnancy, it is an opportunistic pathogen and can
cause spontaneous abortions and premature birth. The
bacteria can be transferred vertically from mother to
child during birth, and give rise to meningitis and
pneumoniae in newborns [2].
U. parvum uridine monophosphate kinase
(UpUMPK) (EC 2.7.4.22), coded by the PyrH gene,
catalyses the reversible phosphorylation of uridine
monophosphate (UMP) using a nucleoside triphosphate
(NTP) as phosphate donor [3,4]. It has been cloned and
the recombinant enzyme characterized [4]. UpUMPK
has high sequence identity to other UMPKs from bacte-
ria and archaea (Fig. 1); the sequence identity to UMP-
binant UpUMPK exhibited Michaelis–Menten kinetics with UMP, with K
m
and V
max
values of 214 ± 4 lm and 262 ± 24 lmolÆmin
)1
Æmg
)1
, respec-
tively, but with ATP as variable substrate the kinetic analysis showed posi-
tive cooperativity, with an n value of 1.5 ± 0.1. The end-product UTP was
a competitive inhibitor against UMP and a noncompetitive inhibitor
towards ATP. Unlike UMPKs from other bacteria, which are activated by
GTP, GTP had no detectable effect on UpUMPK activity. An attempt to
create a GTP-activated enzyme was made using site-directed mutagenesis.
The mutant enzyme F133N (F133 corresponds to the residue in Escherichia
coli that is involved in GTP activation), with F133A as a control, were
expressed, purified and characterized. Both enzymes exhibited negative coo-
perativity with UMP, and GTP had no effect on enzyme activity, demon-
strating that F133 is involved in subunit interactions but apparently not in
GTP activation. The physiological role of UpUMPK in bacterial nucleic
acid synthesis and its potential as target for development of antimicrobial
agents are discussed.
Abbreviations
NDPK, nucleoside diphosphate kinase; UMPK, uridine monophosphate kinase.
FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6403
primary sequence and crystal structures of E. coli
UMPK and the archaea P. furiosus and S. solfataricus
UMPKs showed that these enzymes belong to the amino
acid kinase family [5–8]. In eukaryotic cells, the corre-
idues in yellow.
UMP kinase from Ureaplasma parvum L. Egeblad-Welin et al.
6404 FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS
GTP, which was previously suggested to be specific
to archaeal UMPKs [8].
In this study, recombinant UMPK from U. parvum
was enzymatically characterized, particular with regard
to the substrates UMP and ATP, the inhibitor UTP
and the potential activator GTP. The crystal structure
was determined by X-ray crystallography in complex
with a phosphate ion. A cross-talk region between two
subunits of UpUMPK was identified, which corre-
sponded to the region in E. coli UMPK that contains
the key residues Thr138 and Asn140 that are involved
in GTP activation. Residue Phe133 of UpUMPK (cor-
responding to Asn140 in E. coli UMPK, Fig. 1) was
mutated to either Asn or Ala, and the resulting mutant
enzymes were characterized.
Results
Overall structure
The structure of the UpUMPK was determined by
X-ray crystallography to a resolution of 2.5 A
˚
with a
final R value of 23.3% and R
free
of 28.5% (Table 1).
The enzyme is a hexamer composed of three dimers
that are related by threefold symmetry (Fig. 2A). The
monomer subunit consists of an a ⁄ b-fold with a nine-
Resolution (A
˚
) 33.4–2.5 (2.64)
Completeness (%) 99.9 (99.9)
R
meas
(%) 11.7 (41.5)
I ⁄ rI 11.4 (3.1)
Redundancy 3.8
Number of observed reflections 182 623
Number of unique reflections 48 558
Beam line ESRF, ID14 eh4
Wavelength (A
˚
) 0.976
Temperature (K) 100
R (%) 23.3
R
free
(%) 28.5
rmsds
Bond length (A
˚
) 0.007
Bond angle (°) 1.04
Mean B value (A
˚
2
) 34.7
α2
forces that hold the hexamer together are (a) hydro-
phobic interactions between the dimeric couples
(A + B, C + D and E + F), (b) a few hydrogen
bonds, and a hydrophobic interaction between A + C,
B + E and D + F, and (c) electrostatic forces in the
central channel of the hexamer between B, C and F,
and A, D and E. The hydrophobic interactions
between A and B (Fig. 3A,B) are formed between the
antiparallel a3-helices from each subunit, primarily by
Leu, Met and Ile. One hydrogen bond could be identi-
fied at each end of the interacting a-helices between
Asn86 and the carbonyl carbon of Leu62. Between A
and C, the a7 from each subunit is connected via
two hydrogen bonds between Thr197 and Glu204
(Fig. 3A,C), and a hydrophobic interaction between
Thr131 and Phe133 (Fig. 3D). The central channel of
the hexamer is made up of two layers of electrostatic
forces on top of each other, with one layer rotated by
60°. The amino acids found in the electrostatic hole in
each layer are Lys102 and Asp104. Lys102 is held in
position by Asp104, and, in the interaction between A,
D and E, a water molecule is hydrogen-bonded to the
three lysines (Fig. 3E). There is no water molecule fix-
ing the three lysines from the B, C and F subunits,
and there is no direct interaction between subunits A
and F, B and D, or C and E.
A phosphate ion was found in the donor site of all
subunits (Fig. 2B), although the protein was crystal-
lized in the presence of 5 mm GTP. The B factors for
the phosphate ions in the subunits varied from 46–
sponding to Asn140 in E. coli. The probable binding
motif for the uracil base is through hydrogen bonds
from N3 to the backbone O of Phe133, and from O4
to the backbone N and the side chain of Thr131, with
the ribose moiety anchored by two hydrogen bonds,
one from 2¢-OH to the side chain of Asp70, and one
from the backbone N of Gly63, and the phosphate
group forming hydrogen bonds from O1 to Arg55,
from O2 to the backbone N and the side chain of
Thr138, and from O3 to the backbone N of Gly50. A
P-loop (GXXXXGKS ⁄ T) that is usually found in
nucleotide binding enzymes is not present in UpUMPK
[19]. UpUMPK contains instead a glycine-rich motif
within amino acids 44–54 that is responsible for bind-
ing of the phosphate ion. These amino acids are rela-
tively conserved among the UMPKs, with an amino
acid sequence motif as follows: V ⁄ IXV ⁄ IXGGGXXXR
(Fig. 1).
Functional characterization
The substrate specificity of purified recombinant
UpUMPK was explored using a coupled spectrophoto-
metric assay [20], and several ribonucleoside mono-
phoshates and deoxyribonucleoside monophosphates
were tested as phosphate acceptors with ATP as phos-
phate donor. The only effective acceptor was found to
be UMP, and the pH optimum of the reaction was
6.8. It was also observed that a stoichiometry between
Mg
2+
and ATP of 2 : 1 gave 1.6-fold higher catalytic
the Hill equation, giving an n value of 1.54 ± 0.10,
demonstrating positive cooperativity with ATP. With
1mm UMP, the K
0.5,app
(ATP) was 316 ± 54 lm and
the V
max,app
(ATP) was 172 ± 23 lmolÆmin
)1
Æmg
)1
,
which is similar to the values calculated in the initial
kinetic analysis.
UTP as end-product inhibitor
The nature of UTP inhibition was investigated in
assays with fixed ATP (1 mm) and variable UMP con-
centrations (50–1000 lm). Double-reciprocal plots at
various UTP concentrations demonstrated that UTP
was a competitive inhibitor towards UMP, with a K
i
C
AB
B
A
A
B
E204
E204
T197
the V
max
values, while the K
0.5
⁄ K
m
values at various
UTP concentrations were in the same range. Thus,
UTP inhibition was noncompetitive towards ATP,
with a K
i
value of 1.2 mm (Fig. 6B). When this data
set was fitted to the Hill equation, the n values were
1.4, 0.98 and 1.0 for UTP at 0, 0.5 and 1.0 mm, respec-
tively, which indicates that the positive cooperativity
behavior with ATP is altered by the presence of UTP.
Determination of enzyme-bound orthophosphate
and inhibition of enzyme activity by
orthophosphate
In the UpUMPK structure, a phosphate ion was found
in the active site, and this raised a question concerning
the actual orthophosphate content in the enzyme used
in the functional studies. Therefore, the phosphate
content in the enzyme preparation was determined
using a colorimetric method. A concentrated enzyme
solution was precipitated with 5% perchloric acid at
low temperature to release bound phosphate ions. The
concentration of free phosphate in the supernatant was
3.52 lm, and the total concentration of enzyme was
A
6408 FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS
91.12 lm, giving a molar ratio of UpUMPK ⁄ phos-
phate of 25 ⁄ 1.
The effect of orthophosphate on enzyme activity
was examined. It was shown that phosphate inhibited
UpUMPK activity with an IC
50
value of 1 mm
(Fig. 7).
Functional consequences of F133N and F133A
mutations
GTP is an activator for all bacterial UMPKs studied
to date [5,14–17], and it was therefore tested with
UpUMPK. In an assay with 1 mm UMP and ATP, the
addition of 0.5 or 1 mm GTP resulted in no detectable
change in UpUMPK activity.
In order to find an explanation for the lack of GTP
activation, the UpUMPK structure was compared to
that of E. coli UMPK. In E. coli UMPK, residue
Asn140 forms a hydrogen bond to Thr138 of a neigh-
boring subunit (Fig. 8). The backbone of Asn140 and
the side chain of Thr138 also form hydrogen bonds to
the uracil base. Mutations of either Thr138 or Asn140
to Ala abolished GTP activation, indicating that these
residues are involved in GTP activation of the E. coli
UMPK [6]. In UpUMPK, a region between subunits A
and C had a Phe133 in the position corresponding to
Asn140 in the cross-talk region of E. coli UMPK.
Phe133 is not able to form hydrogen bonds due to its
hydrophobic interactions with Thr131 (Fig. 3D).
A
A
C
N140
T138
N140
T138
Fig. 8. Cross-talk region of E. coli UMPK between subunits A and
C, with UMP bound to the active site. Amino acid residues T138
and N140 are found in the cross-talk region (Protein Data Bank
accession number 2BNE) [6].
L. Egeblad-Welin et al. UMP kinase from Ureaplasma parvum
FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6409
With variable UMP concentration and fixed ATP
concentration, both the F133N and F133A mutants dis-
played negative cooperativity, and the Hill coefficients
were 0.65 ± 0.05 and 0.85 ± 0.05, respectively (Fig. 9).
At 1 mm ATP, the K
0.5,app
(UMP) and V
max,app
values
for F133N were 1100 ± 150 lm and 107 ± 15 lmolÆ
min
)1
Æmg
)1
, respectively. For F133A, the K
0.5,app
(UMP)
methodological. At present, we cannot distinguish the
possibilities that the enzyme contains tightly bound
phosphate ions that cannot be released by acid precipi-
tation, or alternatively that only the phosphate-binding
fraction of the enzyme can form crystals.
The K
m
value for UpUMPK with UMP is high
(214 ± 4 lm) compared to the K
m
values for other
UMPKs, e.g. S. solfataricus,14lm; E. coli,43lm (at
pH 7.4); B. subtilis,30lm; St. pneumoniae, 100 lm
[8,14–16]. A possible reason for the high K
m
value for
UpUMPK with UMP could be the presence of a phos-
phate ion in the active site. However, as discussed
above, the kinetic results most likely reflect the proper-
ties of the native fully active UpUMPK enzyme.
Positive cooperativity with ATP was observed when
the assays were performed with ATP as the variable
substrate (n value of 1.5). However, in the inhibition
experiment with UTP, the n values were close to 1.0,
indicating that the presence of UTP abolished the
positive cooperativity observed with ATP alone. At
present, there is no clearcut explanation for this obser-
vation. Nevertheless, the cooperative behavior of
UpUMPK with varied ATP concentrations is less pro-
nounced than that reported with other Gram-positive
observed. UpUMPK F133N exhibited negative cooper-
ativity with UMP as a substrate (n value of 0.65), and
the same was true of UpUMPK F133A to a lesser
extent (n value of 0.85). This is the first time that nega-
tive cooperativity has been described with a bacterial
UMPK. The observed negative cooperativity may be
explained by alteration of the geometry of the active
site in the neighboring subunit when UMP binds to
the enzyme, i.e. mutation of residue F133, which is
F133A
F133N
60
50
40
30
V/(u/mg)
20
10
0
0 200 400 600
[UMP]/µ
M
800 1000 1200
Fig. 9. Substrate saturation curves of UpUMPK mutant enzymes:
F133N and F133A with UMP as variable substrate.
UMP kinase from Ureaplasma parvum L. Egeblad-Welin et al.
6410 FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS
located in the interface of two subunits, may have
affected the mode of subunit interaction.
Jensen et al. (2007) have compared the sequence and
its lifestyle, as it grows in the urinary tract where the
salvage of uridine and uracil may serve as a rich source
for UMP biosynthesis. One of the goals of this investi-
gation was to evaluate whether UpUMPK is a promis-
ing new target for development of antibacterial agents.
Bacterial UMPKs have no sequence or structural
homology to the human enzyme CMP–UMPK, which
makes them potential targets for drug development,
but, in the case of UpUMPK, a search for non-nucleo-
side ⁄ nucleotide inhibitors may be more successful.
Experimental procedures
Site-directed mutagenesis
The expression plasmid pET-14b-UpUMPK has been
described previously by Wang [4]. The mutants UpUMPK-
F133N and UpUMPK-F133A were constructed by site-
directed mutagenesis using the plasmid pET-14b containing
cDNA for UMPK. The F133N mutation was created using
the following primers: F133N-fw (5¢-GATTTTTGTGGCT
GGAACAGGA
AACCCATATTTTACAACTGATTCG)
and F133N-rv (5¢-CGAATCAGTTGTAAAATATGG
GT
TTCCTGTTCCAGCCACAAAAAT), with the altered
nucleotides shown in bold and underlined. The F133A
mutation was created using the following primers: F133A-
fw (5¢-GTGGCTGGAACAGGA
GCGCCATATTTTACA
ACTGATTCG) and F133A-rv (5¢-CGAATCAGTTGTAA
AATATGG
CGCTCCTGTTCCAGCCAC). The mutations
The UMPK contained an N-terminal His-tag with the
sequence MGSSHHHHHHSSGLVPRGSHM. Crystals
were grown by vapor diffusion, under conditions of
0.2 m ammonium fluoride and 20% (w ⁄ v) poly(ethylene
glycol) 3350 at 15 °C. The enzyme concentration was
1.8 mgÆmL
)1
, and 5 mm GTP was added to the protein.
The protein and crystallization solution were mixed equally
(2 lL of each) in a hanging drop.
Data collection
The crystals were flash-frozen in liquid nitrogen, using
mother solution with the addition of 15% (v ⁄ v) poly(ethylene
L. Egeblad-Welin et al. UMP kinase from Ureaplasma parvum
FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6411
glycol) 400 as cryoprotectant, and data were collected at
ID14-eh4 at the European synchotron radiation facility
(ESRF), Grenoble, France. The data were indexed, scaled
and merged using mosflm [24] and scala [25], and the crys-
tals were found to belong to the space group P2
1
with a sol-
vent content of 48%. The content of the asymmetric unit was
six monomers.
Structure determination and refinement
The structure was solved by molecular replacement using
molrep [26], with the monomer of UMPK from H. influen-
zae (Protein Data Bank accession number 2A1F) as the
search model. Simulated annealing was performed in cns
[27], and further refinement was performed in refmac5
previously [34]. The concentration of orthophosphate was
3.52 lm,andtheUpUMPK concentration was 91.12 lm.
Enzyme assays
The UMPK activity was determined using a coupled spec-
trophotometric assay [20] with a Cary 3 spectrophotometer
(Varian Techtron, Mulgrave, Australia) at 37 °C. The
reaction medium (final volume 1 mL) contained 50 mm
Tris ⁄ HCl pH 6.8, 5 mm dithiothreitol, 0.5 mg mL
)1
BSA,
1mm phosphoenolpyruvate, 0.3 mm NADH and 4 lmolÆ
min
)1
Æmg
)1
ÆmL
)1
of pyruvate kinase and lactate dehydroge-
nase. Nucleoside diphosphate kinase (NDPK) was not
added, as this did not lead to a significant change in the
rates determined, as observed by Fassy et al. [14], and
avoids the complication of potential UTP formation. The
coupling enzymes (pyruvate kinase and lactate dehydroge-
nase) were tested with ADP and UDP, and ADP showed a
rate that was > 20 times that of UDP.
In order to determine the true K
m
for UMP and ATP, a
two-substrate assay was performed at four concentrations
of UMP and ATP (100, 200, 500 and 1000 lm). In the
the value of the substrate concentration [S] where v ¼
0.5 V
max
, and n is the Hill coefficient. If n ¼ 1, there is no
cooperativity, if n < 1 there is negative cooperativity, and
if n > 1 there is positive cooperativity. One unit corre-
sponds to 1 lmol min
)1
.
The inhibition studies were analyzed using equations for
competitive and noncompetitive inhibitors. For competitive
inhibition, the equation is v ¼ V
max
Æ[S] ⁄ (K
m
(1 + [I] ⁄
K
i
) + [S]), and for noncompetitive inhibition the equation
is v ¼ V
max
Æ[S] ⁄ (K
m
+ [S])(1 + [I] ⁄ K
i
). K
i
for UTP towards
ATP was determined using the secondary plot of slope
versus [UTP].
FEBS J 274, 1983–1990.
5 Serina L, Blondin C, Krin E, Sismeiro O, Danchin A,
Sakamato H, Gilles A-M & Baˆ rzu O (1995) Escherichia
coli UMP-kinase, a member of the aspartokinase family,
is a hexamer regulated by guanine nucleotides and
UTP. Biochemistry 34, 5066–5074.
6 Briozzo P, Evrin C, Meyer P, Assairi L, Joly N, Baˆ rzu
O & Gilles A-M (2005) Structure of Escherichia coli
UMP kinase differs from that of other NMP kinases
and sheds new light on enzyme regulation. J Biol Chem
280, 25533–25540.
7 Marco-Marı
´
n C, Gil-Ortiz F & Rubio V (2005) The
crystal structure of Pyrococcus furiosus UMP kinase
provides insight into catalysis and regulation in micro-
bial nucleotide biosynthesis. J Mol Biol 352, 438–454.
8 Jensen KS, Johansson E & Jensen KF (2007) Structural
and enzymatic investigation of the Sulfolobus solfatari-
cus uridylate kinase shows competitive UTP inhibition
and lack of GTP stimulation. Biochemistry 46, 2745–
2757.
9 Yan H & Tsai MD (1999) Nucleoside monophosphate
kinases: structure, mechanism, and substrate specificity.
Adv Enzymol Relat Areas Mol Biol 73, 103–134.
10 Hutchison CA III, Peterson SN, Gill SR, Cline RT,
White O, Fraser CM, Smith HO & Venter JC (1999)
Global transposon mutagenesis and a minimal myco-
plasma genome. Science 286, 2165–2169.
11 Glass JI, Assad-Garcia N, Alperovich N, Yooseph S,
Onu A, Assairi L, Ionescu M, Palibroda N, Baˆ rzu O &
Giles AM (2007) Regulatory mechanisms differ in UMP
kinases from gram-negative and gram-positive bacteria.
J Biol Chem 282, 7242–7253.
18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin
A&Baˆ rzu O (1998) Mutational analysis of UMP
kinase from Escherichia coli. J Bacteriol 180, 473–477.
19 Saraste M, Sibbald PR & Wittinghofer A (1990) The
P-loop – a common motif in ATP- and GTP-binding
proteins. Trends Biochem Sci 15, 430–434.
20 Blondin C, Serina L, Wiesmu
¨
ller L, Gilles A-M &
Baˆ rzu O (1994) Improved spectrophotometric assay of
nucleoside monophosphate kinase activity using the
pyruvate kinase ⁄ lactate dehydrogenase coupling system.
Anal Biochem 220, 219–221.
21 Schulz GE (1992) Binding of nucleotides by proteins.
Curr Opin Struct Biol 2, 61–67.
22 Laemmli UK (1970) Cleavage of structural proteins dur-
ing the assembly of the head bacteriophage T4. Nature
227, 680–685.
23 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein–dye binding. Anal
Biochem 72, 248–254.
24 Leslie AGW (1992) Joint CCP4 + ESF-EAMCB News-
letters on Protein Crystallography, no.26.
25 Collaborative Computational Project Number 4 (1994)
The CCP4 suite: programs for protein crystallography.
Bioinformatics 15, 305–308.
34 Gonzalez-Romo P, Sanchez-Nieto S & Gavilanes-Ruiz
M (1992) A modified colorimetric method for determi-
nation of orthophosphate in the presence of high ATP
concentrations. Anal Biochem 200, 235–238.
UMP kinase from Ureaplasma parvum L. Egeblad-Welin et al.
6414 FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS