The effect of amino-acid substitutions I112P, D147E and K152N
in CYP11B2 on the catalytic activities of the enzyme
Stephanie Bechtel
1
, Natalya Belkina
2
and Rita Bernhardt
1
1
Universita
¨
t des Saarlandes, Saarbru
¨
cken, Germany;
2
Insitute of Biomedical Chemistry RAMS, Moscow, Russia
By replacing specific amino acids at positions 112, 147 and
152 of the human aldosterone synthase (CYP11B2) with the
corresponding residues from human, mouse or rat
11b-hydroxylase (CYP11B1), w e have been able to investi-
gate whether these residues belong to structural determi-
nants of individual enzymatic activities. When incubated
with 11-d eoxycorticostero ne ( DOC), the 11b-h ydroxylation
activity of the m utants was most effectively increased b y
combining D147E and I112P (sixfold increase). The two
substitutions displayed a n additive effect. The same tendency
can be observed when using 11-deoxycortisol as a substrate,
although the effect is less pronounced. The second step of the
CYP11B2-dependent DOC conversion, the 18-hydroxyla-
tion activity, was not as strongly increased as the
11b-hydroxylation potential. A ctivity was unaffected by

aldosterone, respectively), take place in t he adrenal gland.
It has been shown that i n pig [2] and frog [3] t his synthesis
is performed by a single P450 enzym e (CYP11B1). In
contrast, bovine h as two closely relate d isoenzymes
encoded by different genes [4,5] that synthesize both
cortisol and aldosterone. In several other species, including
human [6,7], mouse [ 8] and r at [9,10], t wo distinct isofo rms
of the CYP11B subfamily, namely CYP11B1 and
CYP11B2, have been characterized, w hich are specialized
to synthesize cortisol or aldosterone. In human, the
terminal three steps in the biogenesis of aldosterone are
catalyzed by the aldosterone synthase (CYP11B2) exclu-
sively in the z ona glomerulosa [11]. The 11b-and
18-hydroxylation of the substrate 11-deoxycorticosterone
(DOC) leads to corticosterone (B) and 18-hydroxycorticos-
terone (18-OH-B), whose 18-oxidation yields aldosterone.
In the zona fasciculata/reticularis, the 11b-hydroxylase
(CYP11B1) catalyzes the 11b-hydroxylation of 11-deoxy-
cortisol to produce cortisol which is normally secreted
100- to 1 000-fold in excess over a ldosterone [12]. C YP11B1
is also able to produce corticosterone from 11-deoxycorti-
costerone but it cannot convert c orticosterone i nto
aldosterone [7,13]. The translated proteins of t he two
human i soenzymes o f C YP11B contain 503 amino acids,
including a 24-residue N-terminal mitochondrial targeting
sequence, and s hare 93% sequence i dentity [6]. There are
only 32 a mino-acid differences in the mature forms of t he
two cytochrome P450 proteins. The apparent molecular
masses of the aldosterone synthase and 11b-hydroxylase
have been determined to be 48.5 and 50 kDa, respectively

gene consisting of a 5 ¢-CYP11B1 r egulatory s equence fused
to a 3¢-CYP11B2 portion, causing glucocortico id-remedi-
able aldosteronism. The encoded chimeric p rotein, w hich is
a result of an unequal meiotic cross-over upstream of
intron 5, possessed efficient aldosterone synthase activity.
Previous studies have primarily concentrated on the
C-terminal amino a cids, emphasizing t heir importance f or
the individual a ctivities of CYP11B1 a nd CYP11B2. For
instance, by s ubstituting the positions 301, 30 2 a nd 32 0 i n
CYP11B2 by CYP11B1-specific residues, a switch in the
regio- and stereospecificity of the enzymatic activity can be
observed [17]. Moreover, an aldosterone synthase activity
could b e converted from CYP11B2 to the 11b-hydroxylase,
when creating a C YP11B1 double mutant c ontaining the
aldosterone synthase specific amino acids glycine and
alanine a t positions 288 and 320, respectively [18 ]. Bo
¨
ttner
et al . [ 19] have shown that the mutant A320V of CYP11B1
displays only 20% aldostero ne synthase wild-type activity
when expressed in COS-1 cells in the presence of DOC,
indicating that other amino acids, including some at the
N-terminus, contribute to efficient CYP11B1 and CYP11B2
wild-type activity. In addition, it is known from the crystal
structures of CYP101, CYP108 and CYP102 that the
N-terminal region encodes an amino-acid sequence that is
involved in substrate recognition and binding as well as
redox partner binding [20]. This finding was also supported
by results obtained with microsomal P 450 proteins.
Ridderstro

Materials
Expression vector pSVL was purchased from Pharmacia
Biotech Inc. Oligonucleotides were synthesized on an
Applied Biosystems model 380A DNA synthesizer at
BioTez (Berlin). COS-1 cells were obtained from the
American Type Culture Collection. Cell culture media,
pyruvate, glutamine, antibiotics and Hepes were from
Sigma. Fetal bovine serum and DEAE-dextran were
obtained from GibcoBRL and Pharmacia Biotech Inc.,
respectively. Chloroquine, Hank’s balanced salt solution,
dimethylsulfoxide, 11-deoxycorticosterone, corticosterone,
18-hydroxycorticosterone, aldosterone, 11-deoxycortisol,
cortisol, 4-chlor-1-naphthol and secondary horseradish
conjugated anti-(rabbit IgG) Ig were all from Sigma.
[
14
C]11-deoxycorticosterone and [
3
H]11-deoxycortisol were
purchased from DuPont NEN. HPTLC plates silica ge l 60
F
254
and s olvents w ere f rom M erck. The BCA a ssay kit for
quantitation of total protein was purchased from Pierce.
Site-directed mutagenesis and expression vectors
Mutations were inserted into human C YP11B2 cDNA by
site-directed mutagenesis u sing th e Q uick Change Kit from
Stratagene Ltd (Cambridge, UK), according to m anufac-
turer’s instructions and using mutagenic p rimers listed in
Table 1 . The cell culture expression construct pSVL/

pyruvate and 4 m
M
L
-glutamine.
Table 1. Sequences of forward oligonucleotides e mployed fo r t he
mutagenesis of the human aldosterone synthase and the corresponding
amino-acid exchanges. Nucleotides represented in bold characters
indicate mismatched bases in CYP11B2. Codons for the changed
amino acids ar e underlined.
Mutation Oligonucleotide sequences
I112S CCTGCAGGATG
CCCCTGGAG
I112P CCTGCAGGATG
AGCCTGGAG
D147E GCTGAACCCA
GAAGTGCTGTCGCCC
D147E/K152N ACCCA
GAAGTGCTGTCGCCCAACGCCG
TGC
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1119
Transient transfections and enzymatic assays
Transfections were performed using the DEAE-dextran
method as described previously [27], modified a s f ollows:
COS-1 cells we re plated at a density of 6 · 10
5
cells per 6-cm
dish and grown overnight. Next day, the medium was
aspirated and the cells were subjected to starvation by
incubating in 2 mL fetal bo vine serum-free medium
containing Hepes to a final c oncentration of 5 0 m

period, steroids were extracted twice from the c ell culture
supernatant with m ethylene c hloride a nd the organic phase
was dried. The residues were d issolved in 10 lL methanol
and spotted onto glass-baked silica-coated high perfor-
mance thin layer chromatography (HPTLC) plates. The
HPTLC plates were developed twice in methylene chloride/
methanol/water (300 : 20 : 1, v/v/v). The reacti on products
were identifie d by comigration o f unlabeled steroid refer-
ences an d quantified after 2 days exposure on a bioimaging
analyser (BAS-2500, Fuji P hoto Film Co., Ltd). After
substrate incubation, the transfected COS-1 cells were lysed,
as described p reviously [19], a nd subjected to immunolog-
ical d etection of cytochro me P 450 expression a ccording to
standard procedures [26,28] using an anti-(human CYP11B)
serum (a kind gift from H. Takemori, Department of
Physiological Chemistry, O saka University Medical School
Osaka, Japan). The total amounts of protein were quanti-
fied using a BCA assay kit, according to t he manufacturer’s
protocol.
Alignment of P450 sequences and protein modelling
Multiple s equence a lignment was carried out usin g
CLUSTALW
1.8 [29]. The secondary structure p redictions
were produced by the network method using
PHDSEC
[30].
The modelling o f t he thre e-dimensional structure of
CYP11B1 was carried out by homology modelling with
bacterial c ytochromes w ith known three-dimensional s truc-
ture from the Protein Data Bank [31], using the

Energy m inimizatio n was perfo rmed for t he structures of
the models in the presence o f water; t he Tripos Force Field
was used. The optimum was r eached when the energy
gradient was lower than 0.05 kcalÆmol
)1
ÆA
˚
)1
. However, n o
more than 500 minimization steps were u sed. The Powell
Conjugate Gradient method was u sed for energy minimi-
zation in both cases. V erification of the obtained models
was c arried out using
PROCHECK
[33] and
PROSA
[34] and all
the models showed appropriate quality.
RESULTS
Alignment of human, mouse and rat CYP11B1
and CYP11B2 with crystallized cytochromes P450
and human microsomal CYP2C9
Although the sequence identities between the multitude of
P450 enzymes, identified t o date, are frequently less t han
20%, there is a Ôstructural coreÕ common to all P450s [23],
indicating high conservation of secondary structu re. Based
on this fact, we performed amino-acid sequence and
structure alignments o f human 1 1b-hydroxylase and aldo-
sterone synthase with structurally known P450s and the
human CYP2C9 ( Fig. 1). W e focused on the distribution o f

important functional role, especially with regard to the
interaction w ith Adx, i n a ccordance with the observation
that the helices B, C, J, J ¢, K, L of several known b acterial
P450s seem to be involved in redox partner binding [24].
Site-directed mutagenesis and expression
of CYP11B2 mutants
Three single mutants, two double mutants and one triple
mutant of CYP11B2 were created by site-directed muta-
genesis u sing the oligonucleotides listed i n Table 1, in
addition to th e complementary oligonucleo tides. Thus, the
human aldosterone synthase wild-type amino acids were
replaced with the corresponding residues of human, mouse
and rat CYP11B1, respectively, as summarized in Table 2 .
The successful insertion of the intended mutations was
verified by sequence analysis.
By performing three independent transfection experi-
ments, we found no substantial deviations in expression
levels b etween the wild-type and mutant proteins. This result
suggests t hat the amino-acid exchanges had no influence o n
protein stability o r expression le vel (data not shown).
Enzymatic activity of aldosterone synthase mutants
To analyse the enz ymatic specificities of the CYP11B2
mutants, as compared to the wild-type proteins, we
contransfected the resultant plasmids together with pBAdx4
into COS-1 cells. The coexpression of bovine adrenodoxin
has been demonstrated to be a u seful approach to increase
the activity of the human s teroidogenic enzymes, as well as
the sensitivity of the t est system [ 17,36–38]. To estimate the
aldosterone-producing or cortisol-synthesizing potential,
the cells were incubated with either DOC or 11-deoxycor-

and 18-OH-B) were produced from DOC due to a
substantial increase in the activities of the mutants. How-
ever, the three enzymatic steps were affected to diffe rent
extents, represented b y the relative activities as shown in
Fig. 2B. As e vident from the comparison of the 11b-
hydroxylation activities of all constructs (Fig. 2B), the
introduction of Pro a t position 112 enhanced the activity of
the first enzymatic reaction s tep more than three fold,
Table 2. Corresponding amino ac ids of human CYP11 B2 and
CYP11B1 as well as m ouse and rat CYP11B1 at t he positions s elected
for mutagenesis.
Position
Human
CYP11B2
Human
CYP11B1
Mouse and
rat CYP11B1
112 I S P
147 D E N
152 K N K
Fig. 2. Enzymatic activities of aldosterone synthase and 1 1b-hydroxy-
lase. (A) Enzymatic activities of aldosterone synthase and 11b-
hydroxylase w ild-type enzymes and different CYP11B2 site-directed
mutants expressed in COS-1 cells towards 11-deoxycorticosterone
(30 l
M
DOC a nd 6 nCi of [
14
C]DOC). Mock rep resen ts the tran sfec-

ter of the corresponding mutants (Fig. 2 B). The second
catalytic step performed by human C YP11B2 was not as
strongly enhanced as the fi rst enzymatic modification i n all
mutants studied (Fig. 2 B). The construct containing the
I112P substitution could be clearly identified as the single
mutant displaying the strongest activation of the 18-
hydroxylation; 1.7-fold compared to the CYP11B2 wild-
type, suggesting a critical r ole of t his residue in the second
enzymatic r eaction step o f C YP11B2 (Fig. 2B). In c ontrast,
this reaction step seems to be unaffected by the single
replacement D147E. The same observation was made f or
the double replacement mutant I112P/D147E showing 18-
hydroxylation activity c omparable to C YP11B2 wild-type
(Fig. 2 B), thus suggesting a slightly negative influ ence of
D147E on the second hydroxylation s tep when combined
with I112P.
Interestingly, insertion o f one more human CYP11B1-
specific residue at position 152 (I112P/D147E/K152N) leads
to an increase (13%) in h ydroxylation a t position 18
(Fig. 2 B), c ompared to the corresp onding double mutant
without K152N. This data indicates that K152N positively
affected the 1 8-hydroxylation potential when c ombined
with I112P and D147E. Investigation of aldosterone
synthesizing abilities demonstrated that all mutants pro-
duced slightly higher amounts of this steroid than CYP11B2
wild-type (Fig. 2A). Comparing the relative amounts o f
aldosterone and 18-OH-B formation ( Fig. 2A), it becomes
clear that 18-oxidation activity displays a s lightly d ecreased
efficiency in all investigated mutants, except f or I112S a nd
D147E, when compared to the CYP11B2 wild-type emzyme

DISCUSSION
In humans, certain phenotypical abnormalities, such as
essential hypertension, cardiovascular or endocrine diseases,
Fig.3.Assessmentof11b-h ydroxylase a ctivity and determination of
11b-hydroxylase capacity. (A)Assessmentof11b-hydroxylase activity
of CYP11B2 var iants e xpressed i n COS-1 cells. Cells were cotrans-
fected with the indicated wild-type proteins, mutants or the empty
vector pSVL a s a negative control (Mock) an d the c DNA o f b ovine
Adx.Datashownaremeans±SEMoffourseparatetransfections,
each done in duplicate. (B) Determination of 11b-hydroxylase capacity
of CYP11B2 mutants in relation to the wild-type enzyme, when
incubated with 11-deoxycortisol. The 11b-hydroxylation of
11-deoxycortisol catalysed by the mutated proteins is shown as
percentage of CYP11B2 wild-type ac tivity, fixed t o 100%. The values
given are means ± SEM of four separate transfections, each
performedinduplicate.
ÓFEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1123
are p artially caused by gen etic variations of CYP11B1 and/
or CYP11B2 [39,40]. Due to this fact, it is of great interest to
obtain a deeper insight i nto the structural features under-
lying the determination o f individual activities of these
enzymes. Several structural determinants of human 11b-
hydroxylase and aldosterone synthase have already been
elucidated in previous studies [17–19,41,42]. These stuc tures
are mainly located in the C-terminal regions of CYP11B1
and CYP11B2. So far, the role of distinct amino acids of the
N-terminal regions of human C YP11B isozymes h as n ot
been studied extensively, although it is known that the
N-terminal domains of CYP11B1 and CYP11B2 differ
more from each other than the C-terminal ones, as also seen

147, the replacement I112P also increased the 18-hydroxy-
lation activity (1.7-fold increase c ompared t o t he CYP11B2
wild-type enzyme; Fig. 2B), in addition to significantly
enhancing the 11b-hydroxylation potential. The absolute
amount of aldosterone formation was slightly enhanced for
all mutants (Fig. 2A). However, the 18-oxidation activity
(Fig. 2 B) was either e qual to the wild-typ e (D147E only), or
even slightly decreased ( all o ther mutants). Although the
enzymatic activity remained unchanged by th e intraspecies
replacement I112S (Table 2), the esse ntial r ole o f residue
112 of human aldosterone synthase was clearly shown by
mutant I112P. This demonstrated the importance of the
correct residue at position 112 to ensure the s pecies-specific
selectivity of substrate hydroxylation. Thus, mutant I112P
produced an increased amount of 18-OH-B compared to
the w ild-type. This is in a ccordance with the observation
that rat CYP11B2, which contains proline instead of
isoleucine in position 112, produces higher levels of 18-
OH-B than human CYP11B2 [45,46]. I112 and S112 seem
to be conserved in the human enzymes to prevent the
strongly increased 18-OH-B production as seen when
proline is i nserted. The position of residue 112 in the
recently developed computer model of human C YP11B2
[32] (Fig. 4 ) suggests structural modifications in the sub-
strate access channel induced by its r eplacement. Therefore,
the observed significantly higher hydroxylation activities of
the r esulting mutants m ight be attributed to a faster a nd
easier passage of the substrate, possibly caused by a
substrate access channel enlargement (Fig. 5). Also, t he
slightly reduced oxidation activity of these constructs

heme-group of the P450 enzyme which are marked. The arrow
indicates the putative substrate access channel. The p utative I-helix,
running through the molecule like a tunnel, is s hown in th e center.
1124 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
sizing activity was suppressed [49]. However, this effect
seems to be species-specific, as in the human system n o effect
of CYP11A1 on the product pattern has been found [37]. As
the observed effects o f mutant D147E investig ated here can
be attributed to a c onservative a mino-acid exchange, t he
side-chain size variations at position 147 seem to be
important. A similarly crucial e ffect on the e nzymatic
activity was demonstrated for mutant E198D of human
CYP11B2, leading t o a reduction in aldosterone synthase
activity [50].
Taken together, our data clearly d emonstrate for th e first
time the functional relevance of N-terminal amino acids in
human CYP11B2 for substrate recognition. In addition,
they provide evidence t hat amino acids that a re placed
outside the a ctive center ( Fig. 4) are essential for efficient
catalytic activity of human aldosterone synthase. Our
observations are supported by data obtained with other
cytochrome P450 family members. Amino-acid 4 of Gunn
rat CYP2C11 has been shown t o play a n important role in
testosterone hydroxylation, possibly in modulating sub-
strate channel conformation [51], whereas Arg112 of
CYP101, located on the protein surface, is essential for
electron transfer from putidaredoxin to this cytochrome
P450 enzyme [52].
However, i t becomes a pparent by our data that in
contrast to studies on Dahl SR rats [22], the examined

Deutsche Forschu ngsgemeinschaft to N. B. We thank Michael Lisurek
for assistance with computer modelling and Katharina Bo mpais for
expert DNA sequenc ing. We also express our gratitude to Achim Heinz
for h elpful discussion.
REFERENCES
1. Bernhardt, R. (1996) Cytoc hrome P450 structure, function, and
generation of reactive oxygen species. Rev. Physiol. Biochem.
Pharmacol. 127, 137–221.
2. Yanagibashi, K., Haniu, M., Shively, J.E., Shen, W.H. & Hall, P.
(1986) The synthesis of aldosterone b y the adrenal c ortex. Two
zones (fasciculata and glomerulosa) possess one enzyme for 11
beta-, 18-hydroxylation, and aldehyde synthesis. J. Bi ol. Chem.
261, 3 556–3562.
3. Nonaka, Y ., Takemori, H., Halder, S.K., Sun, T., Ohta, M.,
Hatano, O., Takakusu, A. & Okamoto, M. (1995) Frog
cytochrome P-450 (11 beta, aldo), a single enzyme involved in the
final steps of glucocorticoid and mineralocorticoid biosynthesis.
Eur. J. Bio c hem. 229, 2 49–256.
4. Morohashi, K., Yoshioka, H., G othoh, O., Okada, Y., Yamam-
oto, K., Miyata, T., Sogawa, K., Fujii-Kuriyama, Y. & Omura, T.
(1987) Molecular c lo ning and nucleotide s eq uence of DNA of
Fig. 5. P utative structures of the s ubstrate access c hannel of human
CYP11B2 wild-type enzyme ( A) an d t he two mutants I112S (B) and
I112P (C). The heme-groups and the analysed amino acids in position
112 are displayed i n capped sticks.
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1125
mitochondrial cytochrome P-450 (11 beta) of bovine adrenal
cortex. J. Biochem. 102, 559– 568.
5. Mitani, F., Shimizu, T., Ueno, R., Ishimura, Y., Izumi, S.,
Komatsu, N. & Watanabe, K. (1982) Cytochrome P-45011 beta

dria. Molec. Cell. B iochem. 24, 21–43.
12. Pascoe, L., Curnow, K.M., Slutsker, L., Connell, J.M.C., Speiser,
P.W., New, M.I. & White, P.C. (1992) Glucocorticoid-suppress-
ible hyperaldosteronism results from hybrid genes created by
unequal crossovers betwee n CYP11B1 and CY P11B2. Proc. Natl
Acad. Sci. USA 89 , 8327–8331.
13. Ogishima, T., Shibata, H., Mitani, F., Suzuki, H., S aruta, T. &
Ishimura, Y. (1991) Aldosterone synthase cytochrome P-450
expressed in the adrenals of patients with p rimary aldosteronism.
J. Biol. Chem. 26 6, 10731–10734.
14. Sagara, Y., Takata, Y., Miyata, T., Hara, T. & Horiuchi, T. (1987)
Cloning and sequence analysis of adrenodoxin reductase cDNA
from bovine adrenal cortex. J. Biochem. (Tokyo) 102, 1333–1336.
15. Grinberg, A.V., Hannemann, F., Schiffler, B., Mu
¨
ller, J.,
Heinemann, U. & B ernhard t, R. (2000) Adrenodoxin: s tructure,
stability, an d electron t ransfer properties. Proteins 40 , 590–612.
16. Lifton, R.P., Dluhy, R.G. & Powers, M. (1992) Chimaeric 11 beta-
hydroxylase/aldosterone s ynthase gene c auses glucocorticoid-
remediable aldosteronism and human hypertension. Nature 355,
262–265.
17. Bo
¨
ttner, B., Schrauber, H. & Bernhardt, R . (1996) Engineering a
mineralocorticoid- to a g lucoco rticoid-synthesizing cyto chro me
P450. J . Biol. Chem. 271, 8028–8033.
18. Curnow, K.M., Mulatero, P., Emeric-Blanchouin, N., Aupetit-
Faisant, B., Corvol, P. & Pascoe, L. (1997) The amino acid
substitutions Ser288Gly and Val320Ala convert the cortisol

26. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory M anual, 2nd ed n. Cold Spring Harbor
Laboratory Press, C old Spring Harbor, New Yo rk .
27. Zuber, M .X., Mason, J.I., S impson, E.R. & Wa terman, M.R.
(1988) Simultaneous tra nsfection of COS-1 c ells with mitochon-
drial and microsomal steroid hydroxylases: incorporation of a
steroidogenic pathway into nonsteroidogenic cells. Proc. Natl
Acad. Sci. USA 85 , 699–703.
28. Laemmli, U.K. (1970) Cleavage of structural proteins during the
assembly of the head o f bacteriophage T4. Nature 227, 680–685.
29. Thompson, J.D., Higgins, D.G. & Gibson, T.J. ( 1994) CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap pen-
alties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
30. Rost, B. & Sander, C . (1993) Prediction of protein s tructure at
better than 70% ac curacy. J. M ol. Biol. 232, 5 84–599.
31. Berman, H.M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T.N.,
Weissig, H., Shindyalov, I.N. & Bourne, P.E. (2000) The protei n
data bank. N uc leic Acids Re s. 28, 235–242.
32. Belkina, N.V., Lisurek, M., Ivanov, A.S. & B ernhardt, R. (2001)
Modelling of 3D-structures of cytochromes P450 11B1 and 11B2.
J. Inorg. Biochem. 87, 197–207.
33. Laskowski, R.A., M acArthu r, M .W ., Moss, D.S. & Thornton,
J.M. (1993) PROCHECK: a program to check the stereochemical
quality of p rotein structures. J. Appl. Cryst. 26, 283–291.
34. Sippl, M.J. (1993) Recognition of errors in three-dimensional
structures of proteins. Proteins 17, 355–362.
35. Gotoh, O. (1992) Sub strate recognition sites in cytochrom e P450
family 2 (CYP2) proteins inferred from comparative analyses of
amino a cid and co ding nucleotide sequences. J. Biol. C hem. 267,

in aldosterone synthase causes corticosterone methyloxidase type I
deficiency. J. Clin. Endocrinol. M etab. 80, 424–429.
1126 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
43. Hasemann, C.A., Kurumbail, R.G., Boddupalli, S.S., Peterson,
J.A. & Deisenhofer, J. (1995) Structure and function of
cytochromes P450: a comparative analysis of three crystal struc-
tures. St ructure 3, 41–62.
44. Fisher, A., Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino
acid residue 147 of human aldosterone synthase and 11beta-
hydroxylase plays a key role in 11beta-hydroxylation. J. Clin.
Endocrinol. Metab. 85, 1 261–1266.
45. Nonaka, Y., Fujii, T., Kagawa, N., Waterman, M .R., Takemori,
H. & Okamoto, M. (1998) Structure/function relationship of
CYP11B1 associated with Dahl’s salt-resistant rats – expression of
rat CYP11B1 and CYP11B2 in Escherichia c oli. Eur. J. Bioche m.
258, 8 69–878.
46. Nonaka, Y., Fujii, T., Bernhardt, R. & O kamoto, M. (1998)
Amino acid r esidues in I- a nd K-helices of r at CYP11B1 and
CYP11B2 a re important in expression o f 18-hydroxylation a ctiv-
ity. Endocr. R es. 24, 6 15–618.
47. Graham, S.E. & Peterson, J.A. (1999) How similar are P450s and
what c an t heir differences teach u s? Arch. Biochem. B iophys. 369 ,
24–29.
48. Schwarz, D ., Chernogolov, A. & K isselev, P. (1999) Complex
formation in vesicle-reconstituted mitoch ondrial cytochrome P450
systems ( CYP11A1 and C YP11B1) as evidenced by r otational
diffusion experiments using EPR and ST-EPR. Biochemistry 38,
9456–9464.
49. Ikushiro, S., Kominami, S. & Takemori, S. ( 1992) Adrenal
P-450scc modulates activity of P-45 011 beta in liposomal a nd