Assimilation of excess ammonium into amino acids and
nitrogen translocation in Arabidopsis thaliana – roles of
glutamate synthases and carbamoylphosphate synthetase
in leaves
Fabien Potel
1
, Marie-He
´
le
`
ne Valadier
1
, Sylvie Ferrario-Me
´
ry
1
, Olivier Grandjean
2
, Halima Morin
2
,
Laure Gaufichon
1
, Ste
´
phanie Boutet-Mercey
3
,Je
´
re
´
´
de Nutrition Azote
´
e des
Plantes, Institut National de la Recherche
Agronomique, Route de St-Cyr, 78026
Versailles cedex, France
Fax: +33 1 30 83 30 96
Tel: +33 1 30 83 30 87
E-mail: [email protected]
(Received 27 March 2009, revised 22 May
2009, accepted 27 May 2009)
doi:10.1111/j.1742-4658.2009.07114.x
This study was aimed at investigating the physiological role of ferredoxin-
glutamate synthases (EC 1.4.1.7), NADH-glutamate synthase (EC 1.4.1.14)
and carbamoylphosphate synthetase (EC 6.3.5.5) in Arabidopsis. Pheno-
typic analysis revealed a high level of photorespiratory ammonium, gluta-
mine ⁄ glutamate and asparagine ⁄ aspartate in the GLU1 mutant lacking the
major ferredoxin-glutamate synthase, indicating that excess photorespiratory
ammonium was detoxified into amino acids for transport out of the veins.
Consistent with these results, promoter analysis and in situ hybridization
demonstrated that GLU1 and GLU2 were expressed in the mesophyll and
phloem companion cell–sieve element complex. However, these phenotypic
changes were not detected in the GLU2 mutant defective in the second
ferredoxin-glutamate synthase gene. The impairment in primary ammonium
assimilation in the GLT mutant under nonphotorespiratory high-CO
2
con-
ditions underlined the importance of NADH-glutamate synthase for amino
acid trafficking, given that this gene only accounted for 3% of total gluta-
mary and photorespiratory ammonium assimilation
into amino acids could take place by four distinct
pathways in Arabidopsis, to meet the needs of protein
synthesis, the maintenance of amino acid pool levels
within the leaves, and nitrogen transport to the grow-
ing apical sinks and roots via the phloem. First, the
glutamine synthetase (GS)–glutamate synthase (GO-
GAT) cycle is the major assimilatory pathway. Gluta-
mine is generated from ammonium and glutamate by
cytosolic GS1 and plastidial GS2 (EC 6.3.1.2). Then,
GOGAT transfers the glutamine amide group to the
2-position of 2-oxoglutarate to yield two molecules of
glutamate, one of which is cycled to GS. The Arabid-
opsis nuclear genome carries multiple genes for many
of the nitrogen assimilatory enzymes, and GOGAT
exists as Fd-GOGAT (EC 1.4.7.1), encoded by GLU1
and GLU2 , and as NADH-GOGAT (EC 1.4.1.14),
encoded by GLT [3]. Second, either ammonium or a
glutamine amide group is integrated into asparagine
by cytosolic asparagine synthetase (AS) [ammonia-
ligasing AS (EC 6.3.1.1) or glutamine-hydrolyzing AS
(EC 6.3.5.4)] [4]. Third, carbamoylphosphate synthe-
tase (CPSase) forms carbamoylphosphate (CP) using
bicarbonate (HCO
À
3
), ATP and ammonium (ammonia-
ligasing CPSase; EC 6.3.4.16), or the glutamine amide
group (glutamine-hydrolyzing CPSase; EC 6.3.5.5) [5].
In Arabidopsis, a single copy each of carA and of
acid transport under the fine control of the cellular
and subcellular expression of the nitrogen assimilatory
genes and of the encoded enzymes [12]. Despite their
primary importance, the spatial location and expres-
sion patterns have not been investigated for Fd-GO-
GAT isoenzymes, NADH-GOGAT and CPSase in
Arabidopsis. Thus, we defined their subcellular localiza-
tion and cell type-specific and tissue-specific expression
patterns by promoter::GUS fusion expression in trans-
genic Arabidopsis , in situ mRNA hybridization, and
immunohistochemical localization. The results showed
that each isoenzyme of Fd-GOGAT, NADH-GOGAT
and CPSase had distinct physiological relevance in the
mesophyll and in the phloem for the biosynthesis and
transport of amino acids under photorespiratory and
nonphotorespiratory conditions.
Results
Expression of the genes for GOGATs and CPSase
In order to understand the physiological role of GO-
GATs and CPSase, we first examined the expression
pattern of the genes encoding these enzymes in leaves
and roots from 42-day-old Arabidopsis plants. A
search of the Arabidopsis genome database [13]
revealed that there are two genes for Fd-GOGAT
[GLU1 (AGI: At5g04140)] and GLU2 (At2g41220)],
and one gene for NADH-GOGAT [GLT (At5g53460)].
GLU1 and GLU2 are composed of 33 exons coding for
a protein of 165 kDa, containing a class II (purF)-type
glutaminase domain and short regions for binding to
FMN and iron sulfur center. GLT is composed of 20
homozygous mutant alleles were identified for GLU2,
GLT and carB by PCR in combination with the prim-
ers specific for the T-DNA left and right borders. The
GLU2 mutant was truncated by a T-DNA insertion in
intron 9 (Fig. 2A). With the use of primers down-
stream of the insertion site, the GLU2 mRNA level
was approximately 10% of the wild-type level in leaves
(Fig. 2D). The GLT mutant was characterized by a
T-DNA insertion in exon 13 about 50 amino acids
upstream of the FMN-binding domain (Fig. 2B). The
GLT T-DNA mutant contained about 20% of the
wild-type level of GLT mRNA (Fig. 2D). The carB
mutant was disrupted by a T-DNA insertion in the
promoter close to 600 nucleotides upstream of the
A
C
B
Fig. 1. Transcript levels of the genes for
GOGATs, CPSase and GSs in leaves and
roots of Arabidopsis. Arabidopsis plants
were grown for 42 days by hydroponic cul-
ture using 5 m
M nitrate [37] in air supple-
mented with 3000 p.p.m. CO
2
. Transcript
levels were determined by quantitative real-
time RT-PCR. (A) GOGAT genes: GLU1,
GLU2, and GLT. (B) CPSase genes: carA
and carB. (C) GS1 genes: Gln11, Gln12,
nium assimilation. The GS activity was not affected in
the mutants, except for a slight reduction in the GLT
mutant in high CO
2
(Table 1). The GDH activity var-
ied between 75% and 135% of the wild-type activity
for glutamate synthesis and between 45% and 65% for
glutamate oxidation in the three mutants (Table 1).
Phenotypic changes in the GOGAT and CPSase
mutants
As our target was to evaluate the impact of gene func-
tion on ammonium assimilation and amino acid
1 kb
A
B
C
D
3′5′
5′
3′
5′
3′
Fig. 2. Schematic presentation of the gene structure with the
T-DNA insertion site, and RT-PCR analysis of transcript levels in the
Arabidopsis T-DNA insertion mutants. (A) GLU2 with T-DNA inser-
tion in intron 9. (B) GLT with T-DNA insertion in exon 13. (C) carB
with T-DNA insertion in the promoter. Gray triangles correspond to
T-DNA, which is not to scale. Boxes indicate exons, and lines indi-
cate 5¢-flanking regions and introns. The nucleotide sequences at
the gene–insertion junction are shown. The number of the first
Fd-GOGAT 0.5 ± 0.1 28.5 ± 2.3 29.2 ± 2.7 30.2 ± 3.3
NADH-GOGAT 0.8 ± 0.1 0.7 ± 0.1 0.2 ± 0.1 0.9 ± 0.1
GS 84.1 ± 8.9 76.8 ± 7.1 76.6 ± 6.7 75.0 ± 7.0
NADH-GDH 45.7 ± 5.9 32.6 ± 2.8 44.2 ± 3.9 38.2 ± 3.9
NAD-GDH 5.9 ± 0.7 13.4 ± 1.1 11.1 ± 1.0 9.9 ± 0.7
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4064 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
metabolism, we determined the levels of ammonium
and free amino acids in leaves and compared them to
the levels in the control wild-type lines. The GLU1
mutant accumulated a large amount of ammonium
48 h after transfer from high CO
2
to air, owing to
photorespiratory ammonium release (Fig. 3A). A slight
accumulation of photorespiratory and nonphotorespi-
ratory ammonium was detected in the GLT mutant
(Fig. 3A). By contrast, the GLU2 and carB mutants
contained a wild-type level of ammonium (Fig. 3A,B).
The ammonium level of the control wild-type line of
the GLU1 mutant 48 h after transfer from high CO
2
to
air (0.66 lmolÆg
)1
fresh weight) (Fig. 3A) was higher
than that of the control wild-type line of the carB
mutant in air (0.5 lmolÆg
)1
fresh weight) (Fig. 3B).
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4065
being performed independently. However, many of the
reactions of nitrogen assimilation and amino acid syn-
thesis depend on ATP, reduced Fd, and NAD(P)H,
and take place in the chloroplast. Elevated CO
2
causes
an imbalance of energy and electron transport because
of the lack of photorespiration, which dissipates excess
photochemical energy and reducing equivalents [14].
This increases the number of chloroplasts and starch
grains per mesophyll cell [15], and higher ammonium
accumulation suggests that the control wild-type line
did not completely recover the nitrogen assimilatory
capacity damaged in high CO
2
. In high CO
2
, the
GLU1 and GLT mutants had reduced glutamate levels
and increased glutamine levels (Fig. 3C). The gluta-
mate and glutamine levels were unaffected in the
GLU2 mutant (Fig. 3C). These observations indicate
that the GS ⁄ GLU1 Fd-GOGAT and GS ⁄ GLT
NADH-GOGAT cycles are involved in nonphotorespi-
ratory ammonium assimilation. In air, the highest glu-
tamine ⁄ glutamate ratio of 13.3 was obtained for the
GLU1 mutant, confirming that the GS ⁄ GLU1 Fd-GO-
GAT cycle is the main pathway of photorespiratory
ammonium reassimilation (Fig. 3D). No impairment in
whether expression of the ammonium assimilatory
genes of GOGAT, CPSase and GS1 is modified in
response to exogenous excess ammonium (10 mm),
provided as a supplement to the culture medium. Both
GLU1 and GLT were expressed at higher levels than
GLU2 (Fig. 4A). The ammonium caused up to 4.7-fold
induction of GLT mRNAs; the GLU1 mRNA was
induced to a lesser extent (Fig. 4A). The level of carA
mRNA was unaffected and that of carB mRNA was
lowered by the ammonium treatment (Fig. 4B). The
GS1 genes exhibited the contrasting patterns in
response to excess ammonium: a decrease in the Gln12
mRNA and increases in the Gln11 and Gln13 mRNAs
(Fig. 4C).
Expression of promoter::GUS fusions
To investigate the tissue-specific expression of the
genes for GOGATs and CPSase, transgenic lines
expressing an N-terminal translational construct fused
to a GUS reporter gene were generated. The promoter
region upstream of ATG, including a partial coding
sequence, was isolated by PCR from GLU1 (2385 bp)
()1931 ⁄ 454), GLU2 (1501 bp) ()1089 ⁄ 412), carA
(1121 bp) ()1021 ⁄ 100), and carB (992 bp) ()922 ⁄ 70).
The translational fusions to the uidA gene under the
control of the gene promoter were constructed by
inserting the PCR product in-frame to the 5¢-end of
the GUS reporter gene. In the leaf sections of the
transformed Arabidopsis lines, the GLU1::GUS fusion
was expressed in chloroplasts of the mesophyll
(Fig. 5A). Furthermore, a high level of expression was
mRNA probe gave no specific signal in the mesophyll
or in the vascular cells (Fig. 6D). The GLT mRNAs
were strongly expressed in the phloem, whereas a weak
GLT mRNA signal was associated with the mesophyll
(Fig. 6F), indicating that GLT was mainly expressed in
the vascular cells.
Immunohistochemical localization
As the GLU1::GUS fusion and the GLU1 mRNAs
were expressed both in the mesophyll cells and in the
vascular cells, we examined the localization of Fd-GO-
GAT by the indirect immunofluorescence method,
using a specific antibody against tobacco Fd-GOGAT
as the primary antibody [4]. With the use of confocal
laser-scanning microscopy, the Alexa 405 fluorochrome
signal was detected in the mesophyll cells and in the
vascular cells of minor veins bordering the mesophyll
cells (Fig. 7A). With higher-magnification resolution,
the specific fluorescence of Fd-GOGAT was found to
be located in the mesophyll chloroplasts (Fig. 7C). The
immunofluorescent signal and the corresponding trans-
mission microscopy of the magnified vascular section
showed that the specific signal was associated with the
clustered oval companion cells, which flanked the sieve
elements in close vicinity to the phloem parenchyma
(Fig. 7E,F). With nonimmune serum as the first anti-
body, no signal was found in the leaf sections
(Fig. 7B,D).
Discussion
Recovery of excess ammonium into amino acids
in the mesophyll
type of the GLU1 mutant confirm that the defect in
the GLU1 Fd-GOGAT cycle caused the inhibition of
photosynthesis, owing to the extensive release of pho-
torespiratory ammonium (up to 5–20 lmolÆh
)1
Æg
)1
fresh weight) [2,16,17]. The high levels of glutamine
and glutamate (nitrogen-rich five-carbon amino acids)
and asparagine and aspartate (four-carbon amino
acids) (up to 80% of the total amino acids) (Fig. 3)
suggest that excess photorespiratory ammonium was
detoxified, in part, in the form of amino acids for
export out of parenchyma cells of the veins. The high
glutamine ⁄ glutamate ratio in the GLU1 mutant (13.3)
as compared with the wild type in air (1.4) (Fig. 3)
reflects the inability of mitochondrial GDH to act as
an alternative ammonium assimilatory pathway in the
leaves, as GDH is a vascular-located enzyme [18]. As
demonstrated here, the minor effects on ammonium
accumulation in the GLU2 mutant in air (Fig. 3) pro-
vide evidence that the GS ⁄ GLU2 Fd-GOGAT cycle
does not contribute to photorespiratory ammonium
reassimilation. The low GLU2 mRNA levels in the
chl
mc
mc
se
te
cc
lar section for carA. (E) Mesophyll and vascular section for carB. (F)
Control mesophyll and vascular section from Arabidopsis trans-
formed with an empty vector. bs, bundle sheath; cc, companion
cell; chl, chloroplast; mc, mesophyll cell; se, sieve element; te,
tracheary element. Bar: 10 lm.
chl
mc
cc
te
cc
cc
pp
bs
mc
chl
cc
se
te
cc
mc
chl
se
chl
cc
se
bs
cc
tecc
te
bs
of the ornithine d-amino group with CP leads to the
formation of citrulline as a precursor of arginine syn-
thesis (see Fig. 8 for a diagram of arginine synthesis).
It has been proposed that photorespiratory ammonium
released by mitochondrial glycine decarboxylase com-
plex (GDC; EC 1.4.4.2 ⁄ 2.1.2.10) is reassimilated into
glutamine by GS, and then into CP by CPSase in the
mitochondria [19]. However, the subcellular compart-
mentation of CPSase has been unclear. We showed
that the promoter from either carA or carB directed
the GUS signal to the mesophyll chloroplasts (Fig. 5),
indicating that photorespiratory ammonium is shuttled
via glutamine to CP in the chloroplasts. Glutamine is
hydrolyzed via the class I or trpG-type glutaminase of
the CPSase small subunit. The carB domain of the
CPSase large subunit forms the Cys-NH
2
intermediate
by the conserved triad (Cys293-His377-Glu379) to acti-
vate HCO
À
3
-dependent ATP cleavage prior to release
of CP [20]. The databases also predict importation of
the large subunit (cleavage at Cys62) and small subunit
(cleavage at Val33) to the chloroplast stroma [21,22].
In addition, plastid-located carbonic anhydrase 1
(At1g58180, cleavage at Ala113) and cytosolic carbonic
anhydrase 2 (At5g14740) can increase the HCO
À
bioinformatic tools to predict to what extent the large
and small precursors are seemingly dual-targeted, a
dual organelle location of the CPSase in the chloro-
plasts and mitochondria cannot not be excluded.
Excess ammonium from either endogenous photores-
piration or exogenous medium appears to be, in part,
shuttled to arginine (Fig. 3). The fact that there were
only slight effects of the carB mutation on overall argi-
nine synthesis, either with excess ammonium or under
standard nitrate conditions, suggests that CPSase is
not the limiting enzyme for arginine biosynthesis.
However, the GLU1 mutant accumulated arginine at a
higher level than the wild-type plants under photore-
spiratory conditions (Fig. 3). It can thus be assumed
that photorespiratory ammonium was shuttled to argi-
nine under the control of N-acetyl-glutamate kinase
(NAGK; EC 2.7.2.8), a key regulatory enzyme in the
arginine synthetic pathway [6].
Nitrogen entry into amino acids and
translocation in the vascular tissue
Under high-CO
2
conditions, when photorespiration is
suppressed, leaf cells depend on the importation of
cc
cc
bs
cc
cc
pp
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4069
nitrogen via the tracheary elements for amino acid syn-
thesis and subsequent export of the derived amino
acids via phloem sieve elements for use by sink cells
(Fig. 8). Cellular localization of GOGATs and CPSase
in the vascular tissue has been unknown in Arabidop-
sis. To dissect the regulation of amino acid transloca-
tion, we determined whether GOGATs and CPSase
were localized in the phloem companion cell–sieve ele-
ment complex. Cis-acting regulatory elements upstream
of ATG were examined in silico, using the place data-
base [26]. The TATA or TATA-like boxes were identi-
fied for GLU1 (
)61
TTATTT
)56
and
)37
TTATTT
)32
),
GLU2 [
)506
TTATTT
)501
and
)90
TTATTT
)85
()strand)],
In addition, the strong cis-elements that determine
vascular patterning were identified: the BS1 motif [28]
[carA (
)875
AGCGGG
)869
), )strand] and the NtBBF1
motif (ACTTTA) [GLU1 ()1180 ⁄ )1175), GLU2
()381 ⁄ )376), GLT ()1499 ⁄ )1494), carA ()237 ⁄ )232),
and carB ()526 ⁄ )521)]. The NtBBF1 motif directs
expression of the oncogene rolB in phloem and xylem
parenchyma [29]. By in situ hybridization, the GLT
mRNAs were found to be confined to the phloem
companion cell–sieve element complex (Fig. 6). The
GLT mutant showed strong inhibition of primary
Fig. 8. Proposed diagram for the role of GOGATs and CPSase in primary nitrogen assimilation, the photorespiratory nitrogen cycle, and
nitrogen translocation. The organelle localizations and stoichiometries of the interconnected enzymatic reactions are not included. CH
2
-THF,
N
5
,N
10
-methylene tetrahydrofolate; FdH, reduced ferredoxin; glycolate-P, 2-phosphoglycolate; N-acetylglutamate-5-P, N-acetyl-glutamate
5-phosphate; OH-pyruvate, hydroxypyruvate; OTC, ornithine transcarbamoylase (EC 2.1.3.3); PGA, 3-phosphoglycerate; RuBP, ribulose
1,5-bisphosphate.
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4070 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
ammonium assimilation, with a high glutamine ⁄ gluta-
mate ratio under high-CO
support the view that the GS1 ⁄ NADH-GOGAT cycle
in the phloem functions to enable the entry of excess
ammonium and incoming primary nitrogen into gluta-
mine and glutamate (Fig. 8). These amino acids are
trafficked under the fine control of amino acid trans-
porters [32,33]. Active uptake into yeast cells suggests
that the basic amino acids arginine and lysine are
transported by the specific permeases (AAP3 and
AAP5) for their retrieval along the translocation path-
way and accumulation [34]. Based on the finding of
CPSase in the phloem, the low ability of [
14
C]arginine
to move out of the vascular bundles can be attributed
to the synthesis of arginine precursor by CPSase in the
vascular tissue (Fig. 5). Consistently, leaves fed with
[
14
C]arginine via the xylem saps show more extensive
labeling of the vein than the mesophyll, and the
reverse holds for [
14
C]glutamate and [
14
C]aspartate
[35].
In conclusion, in response to the enhanced levels
of photorespiratory ammonium and exogenously
added ammonium, high levels of ammonium were
converted to amino acids to allow for transport in
Centre (Nottingham, UK). Homozygous mutant lines were
isolated by PCR with the gene-specific primers and T-DNA
border primer. The first PCR was carried out using the fol-
lowing gene-specific primers: GLU2 (SALK_087050) LP, 5¢-
AAACCTGCGAAACCTGAAGCC-3¢; GLU2 RP, 5¢-TCA
CCAAGCAAACCCTCAAGC-3¢; GLT (SALK_072454)
LP, 5¢-TCTCTGGAGGCGCATACAACC-3¢; GLT RP,
5¢-CCAGCGAGATGCACCAGTACC-3¢; carB (SALK_
034177) LP, 5¢-GAGAAGGACATGCGGTACTAG-3¢; and
carB RP, 5 ¢-AGTGAGACACGAGAGAGAGGG-3¢. The
reaction mixture consisted of 0.4 ng of genomic DNA iso-
lated from rosette leaves, 10 pmol of forward primer,
10 pmol of reverse primer and 0.2 units of Taq polymerase
in a total volume of 25 lL. The following program was
used: presoaking at 95 °C for 3 min, and 35 cycles of 94 °C
for 30 s, 55–69 °C for 1 min 30 s, and 72 °C for 1 min
30 s, with postsoaking at 72 °C for 10 min. The second
PCR analysis was carried out using one of two gene-specific
primers (forward or reverse) and the following LBb1 border
primer: 5¢-GCGTGGACCGCTTGCTGCAATT-3¢. The
T-DNA insertion was located, and levels of transcripts
downstream of the insertion site were determined by
RT-PCR. Amplified fragments were visualized by ethidium
bromide staining in agarose gels, and bands were quantified
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4071
by scanning with an ImageGauge imaging system (Fujifilm
S.A.S., St-Quentin, France).
Plant culture
A. thaliana ecotype Col-0, T-DNA insertion mutants, the
For the ammonium induction experiments, seedlings were
then transferred to the nutrient solution supplemented with
10 mm ammonium for an additional 48 h under the same
regime.
Real-time RT-PCR analysis
Total RNA was extracted, and first cDNA strands were
synthesized from 2 lg of RNA, using an Invitrogen RT
kit (Invitrogen SARL, Cergy Pontoise, France). Real-time
RT-PCR was carried out with a RealMasterMix Cybr
Rox 2.5x kit according to the manufacturer’s instructions
(5 PRIME; Dominique Dutscher SA, Brumath, France).
Amplification was carried out with the following condi-
tions, using 1 lL of a 1 : 10 or 1 : 20 dilution of cDNA
in a total volume of 20 lL: 2 min at 95 °C, and 40
cycles of 95 °C for 19 s, 55 °C for 15 s, and 68 °C for
40 s, on an Eppendorf Realplex
2
MasterCycler (Eppen-
dorf SARL, Le Pecq, France). A melting curve was
obtained to confirm the specificity of the amplification.
For the genes of the multigene family, the following pri-
mer sets were designed along the nonconserved stretches
of the genes. The results were expressed as percentage
relative to EF1a (At5g60390) as a constitutive gene. The
primers used for quantitative real-time PCR are listed in
Table 2.
Construction of GUS fusions by attB
recombination reactions
Binary vectors containing the promoter sequence upstream
of ATG carrying a partial coding sequence of GLU1
carB (At1g29900) F: AGGAAGACCACATGCTGCTGA
R: TCAAAGAAGTCCTGAAGAGCGG
Gln11 (At5g37600) F: CCTCTCAGACTCCACTGACAAA
R: TTCACTGTCTTCACCAGGAGC
Gln12 (At1g66200) F: TCTCAGACAACAGTGAAAAGATCA
R: TGTCTTGACCAGGAGCTTGAC
Gln13 (At3g17820) F: GCCACCGGGAAAATCATC
R: TTCACTGTCTTCTCCAGCAGC
Gln14 (At5g16570) F: CGATTCCACTGACCAGACCAT
R: GACTTCACTGTCATCGCCC
Gln2 (At5g35630) F: CACCAAACCTTACTCTGACAGG
R: CACTATCTTCACCAGGTGCTTG
EF1a (At5g60390) F: CTGGAGGTTTTGAGGCTGGTAT
R: CCAAGGGTGAAAGCAAGAAGA
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4072 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
Recombinant vectors containing the GUS fusion construct
were transferred by electroporation into Agrobacterium
tumefaciens (strain C58PMP90) [39]. A. thaliana ecotype
Col-0 was transformed by dipping floral tissues into trans-
formed Ag. tumefaciens containing 5% sucrose and 0.005%
(v ⁄ v) surfactant Silvet L-77 [40]. Transformants were recov-
ered from the seeds selected on Murashige–Skoog medium
containing 30 mgÆL
)1
hygromicine B.
GUS histochemical analysis
In situ staining of GUS activity was carried out by incubating
tissues in 50 mm sodium phosphate (pH 7.0), 0.1 mm
K
Total RNA was extracted using an RNA isolation kit (Qia-
gen, GmbH, Germany), and first cDNA strands were syn-
thesized from 2 lg of RNA using an Omniscript RT kit
(Qiagen). Sense and antisense DNA probes were amplified
by PCR using the following gene-specific primers by intro-
ducing a T7 sequence (5¢-TGTAATACGACTCACTA
TAGGGC-3¢) at the 5¢-ends of reverse and forward prim-
ers, respectively: GLU1 forward, 5¢-ATCATTCAAGA
GCAGGTTGT-3¢; GLU1 reverse, 5¢-GACAGTTGAAAG
CAGTTATT-3¢; GLU2 forward, 5¢-TCAACATTTGATCG
TGGTTT-3¢; GLU2 reverse, 5¢-AATCGAAAACCCTT
TCTTAA-3¢; GLT forward, 5¢-GGTGGGCTGATGATGT
ATGGA-3¢; and GLT reverse, 5¢-CATCATCCGTTTTG
GTGAGGA-3¢. Amplified sense and antisense DNAs
(400 ng each) were subjected to in vitro transcription using
a transcription kit (Promega, Madison, WI, USA) in the
presence of digoxigenin-UTP. DNAs were removed by DNase
digestion. RNA probes were controlled by electrophoresis.
In situ hybridization
Eight-micrometer sections were prepared using a microtome
and dried on glass slides (DAKO 2024; Dako, Basingstoke,
UK). Samples were deparaffined in histoclear, hydrated
through a gradual ethanol series (96%, 85%, 50%, and
30%, v ⁄ v), and washed in NaCl ⁄ P
i
(6.5 mm Na
2
HPO
4
,
solution. After washing with T3 solution, alkaline phospha-
tase activity was developed with 5-bromo-4-chloro-3-indol-
yl-phosphate (50 mgÆmL
)1
) and Nitroblue tetrazolium
(75 mgÆmL
)1
). Slides were washed with TE and sealed with
gel mount formol 1 (Microm Microtech France, Franche-
ville, France). Fluorescence was observed using a Leica
DMR microscope (Leica Microsystems).
Indirect immunofluorescence analysis
Leaf sections were fixed in 3.7% (w ⁄ v) formaldehyde dis-
solved in 50 mm Pipes buffer (pH 6.9), 5 mm MgSO
4
, and
5mm EGTA (MTSB), and then in NaCl ⁄ P
i
(6.5 mm
Na
2
HPO
4
, 1.5 mm KH
2
PO
4
, pH 7.3, 14 mm NaCl, 2.7 mm
KCl). Tissues were dehydrated in a graded series of ethanol
(30%, 50%, 70%, 90%, and 97%), and embedded in wax.
by ion exchange chromatography on a JLC-500 ⁄ V amino
acid analyzer (Jeol Ltd, Tokyo, Japan).
Enzyme preparation and assays
GS was extracted and assayed by measuring c-glutam-
ylhydroxamate produced by its synthetase reaction
according to [44]. Fd-GOGAT and NADH-GOGAT were
extracted and assayed as described in [12]. Glutamate
formation with ferredoxin or NADH as electron donor
was determined by HPLC. GDH was assayed for
NADH-dependent glutamate synthetic activity and NAD-
dependent glutamate oxidation activity as described in
[44].
Determination of metabolites and total soluble
proteins
Free ammonium contents were determined by the phenol
hypochlorite assay of Berthelot [45]. Soluble protein con-
tents were determined by the Coomassie Blue dye-binding
assay (Bio-Rad Laboratories, Hercules, CA, USA).
References
1 Crawford NM & Forde BG (2002) Molecular and
developmental biology of inorganic nitrogen nutrition.
In The Arabidopsis Book (Somerville C & Meyerrowitz
E, eds), pp 1–25. American Society of Plant Biologists,
Rockville, MD.
2 Somerville CR & Ogren WL (1980) Inhibition of photo-
synthesis in Arabidopsis mutants lacking leaf glutamate
synthase activity. Nature 286, 257–259.
3 Suzuki A & Knaff D (2005) Glutamate synthases: struc-
tural, mechanistic and regulatory properties, and role in
the amino acid metabolism. Photosynth Res 83, 191–
chloroplasts. Plant Cell 16, 2048–2058.
10 van Bel AJE (2003) The phloem, a miracle of ingenuity.
Plant Cell Environ 25, 125–149.
11 Lam H-M, Coschigano K, Schultz C, Melo-Oliverira
R, Tjaden G, Oliveira I, Ngai N, Hsieh MH &
Coruzzi G (1995) Use of Arabidopsis mutants and
genes to study amide amino acid biosynthesis. Plant
Cell 7, 887–898.
12 Valadier M-H, Yoshida A, Grandjean O, Morin H,
Kronenberger J, Boutet S, Raballand A, Hase T,
Yoneyama T & Suzuki A (2008) Implication of the
glutamine synthetase ⁄ glutamate synthase pathway in
conditioning the amino acid metabolism in bundle
sheath and mesophyll cells of maize leaves. FEBS
J 275, 3139–3206.
13 Arabidopsis Genome Initiative (2000) Analysis of the
genome sequence of the flowering plant Arabidopsis tha-
liana. Nature 408, 796–815.
14 Ogren WL (1984) Photorespiration: pathways,
regulation, and modification. Annu Rev Plant Physiol
35, 415–442.
15 Teng N, Wang J, Chen T, Wu X, Wang Y & Lin J
(2006) Elevated CO2 induces physiological, biochemical
and structural changes in leaves of Arabidopsis thaliana
.
New Phytol 172, 92–103.
16 Suzuki A & Rothstein S (1997) Structure and regula-
tion of ferredoxin-dependent glutamate synthase from
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4074 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
expression of two cDNAs encoding carbonic anhydr-
ase in Arabidopsis thaliana. Plant Physiol 105, 707–
713.
24 Chollet R, Vidal J & O’Leary MH (1996) Phosphoenol-
pyruvate carboxylase: a ubiquitous highly regulated
enzyme in plants. Annu Rev Plant Physiol Plant Mol
Biol 47, 273–298.
25 Yamaya T, Oaks A, Rhodes D & Matsumoto H (1986)
Synthesis of [
15
N]glutamate from [2-
15
N]glutamate and
[
15
N]glycine by mitochondria isolated from pea and
corn shoots. Plant Physiol 81, 754–757.
26 Higo K, Ugawa Y, Iwamoto M & Korenga T (1999)
Plant cis-acting regulatory DNA elements (PLACE)
database. Nucleic Acids Res 27, 297–300.
27 Gowik U, Burscheidt J, Akyldiz M, Schlue U, Koczor
M, Streubel M & Westhoff P (2004) cis-Regulatory ele-
ments for mesophyll-specific gene expression in the C4
plant Flaveria trinervia, the promoter of the C4 phos-
phoenolpyruvate carboxylase gene. Plant Cell 16, 1077–
1090.
28 Lacombe E, Van Doorsselaere J, Boerjan W, Boutet
AM & Grima-Pettenatti J (2000) Characterization of
cis-elements required for vascular expression of the
Cinnamoyl CoA reductase gene and for protein–DNA
and utilisation of xylem-born amino compounds
by shoot organs of legume. Plant Physiol 63,
1076–1081.
36 Orsel M, Eulenburg K, Krapp A & Daniel-Vedele F
(2004) Disruption of the nitrate transporter
genes AtNRT2.1 and AtNRT2.2 restricts growth at
low external nitrate concentration. Planta 219,
714–721.
37 Coı
¨
c Y & Lesaint C (1971) Comment assurer une bonne
nutrition en eau et en ions mine
´
raux en holticulture.
Holticulture Franc¸ aise 8, 11–14.
38 Curtis MD & Grossniklaus U (2003) A gateway
cloning vector set for high-throughput functional
analysis of genes in planta. Plant Physiol 133, 462–469.
39 Koncz C & Schell J (1986) The promoter of
TL-DNA gene 5 controls the tissue-specific expression
of chimeric genes carried by a novel type of
Agrobacterium binary vector. Mol Gen Genet 204,
383–396.
40 Clough SJ & Bent AF (1998) Floral dip: a simplified
method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J 16, 735–743.
41 Jefferson RA (1987) Assaying chimeric gene in plants:
the GUS gene fusion system. Plant Mol Biol Rep 5,
387–405.
42 Feraud M, Masclaux-Daubresse C, Ferrario-Me