Expression in yeast of a novel phospholipase A1 cDNA
from
Arabidopsis thaliana
Alexandre Noiriel
1
, Pierre Benveniste
1
, Antoni Banas
2
, Sten Stymne
2
and Pierrette Bouvier-Nave
´
1
1
Institut de Biologie Mole
´
culaire des Plantes du CNRS, De
´
partement Isopre
´
noı
¨
des, Institut de Botanique, Strasbourg, France;
2
Department of Crop Science, Swedish University of Agricultural Sciences, Alnarp, Sweden
During a search for cDNAs encoding plant sterol acyl-
transferases, we i solated four full-length cDNAs from Ara-
bidopsis thaliana that encode proteins with substantial
identity with animal lecithin : c holesterol a cyltransferases
(LCATs). The expression of one of these c DNAs, AtLCAT3

Ca
2+
. Its se quence is unrelated to all other known phos-
pholipases. Further studies are in progress to elucidate its
physiological role.
Keywords: Arabidopsis thaliana; e xpression in yeast; phos-
pholipase A1; triacylglycerol i ncrease.
Phospholipases A1 (PLA1) and A2 (PLA2) hydrolyse,
respectively, the sn -1 and sn-2 acylester bond o f phospho-
lipids, generating free fatty acids (FAs) and lysophospho-
lipids. Phospholipases B sequencially remove two FA from
phospholipids and thus have both phospholipase A and
lysophospholipase a ctivities [1]. These three types of phos-
pholipase activities ( A1, A2 a nd B) have been described in
microsomal preparations from triacylglycerol (TAG)-accu-
mulating tissues of vario us plants [2]. A PLA1 activity has
been identified in the tonoplast from Acer pseudoplatanus
cells [3] and an Arabidopsis thaliana cDNA encoding a PLA1
was shown to be expressed in the chloroplast [4]. But most of
the plant PLA papers describe s oluble PLA(2) activities [1].
Participation o f PLAs in p lant signal transduction is
mentioned for auxin stimulation of growth [5–7] and in
response t o bacterial an d fungal elicitors [8–10], wounding
[11] or viral infection [10,12]. This involvement of plant
PLAs in sign al transduction has j ust been reviewed [13].
PLAs are also directly implicated in phospholipid retailor-
ing or degradation during TAG synthesis [2,14] or senes-
cence [15]. The participation o f PLAs in these vario us
aspects of plant development and response to stress is likely
to occur in coordination with phospholipases C a nd D [16].

phosphatidylcholine; PDAT, phospholipid:diacylglycerol acyltrans-
ferase; PE, phosphatidylethanolamine; PLA1, phospholipase A1;
PS, phosphatidylserine; SE, steryl ester; TAG, triacylglycerol.
Enzymes: DGAT, diacylglycerol:acylCoA acyltransferase (EC
2.3.1.20); LCAT, lecithin:cholesterol acyltransferase (EC 2.3.1.43);
PDAT, phospholipid:diacylglycerol acyltransferase (EC 2.3.1.158);
PLA1, phospholipase A1 or phosphatidylcholine 1-acylhydrolase
(EC 3.1.1.32).
Note: Part of this s tudy was presented at the 16th International Plant
Lipid Symposium, Budapest, Hungary, 1–4 June 2004 (abstract
book pp. 33 and 105; http://www.mete.mtesz.hu/pls/).
(Received 16 April 2004, revised 27 July 2004, accepted 2 August 2004)
Eur. J. Biochem. 271, 3752–3764 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04317.x
A second group of plant PLAs is formed by soluble,
patatin-like (phospho)lipases A(2): an allergen from the latex
of Hevea brasiliensis [19], three tobacco leaf soluble proteins
induced by virus infection [12], a cowpea galact olipid
acylhydrolase stimulated by drought stress [20] and four
A. tha liana PLAs [6]. Patatin is the major storage protein of
the potato t uber. When cloned and expressed via a baculo-
virus vector in S f9 insect cells, it was sh own to be an aspecific
lipid acyl hyd rolase that h ydrolyses monoacylglycerols,
phosphatidylcholine (PC), monogalactosyldiacylglycerols,
di- and triacylglycerols with decreasing efficiency [21]. When
assayed with PC, purified patatin exhibited a PLA2 activity
[22]. Recent studies reve aled that patatin h as a Ser–Asp
catalytic dyad and a folding topology related to that of the
catalytic domain o f animal cytosolic PLA2s. Mutagenesis
confirmed the critical role of Ser77 a nd Asp215 in enzymatic
activity and of His109 in enzyme stability [23,24]. Moreover

study by site-directed mutagenesis and molecular modelling
[29] showed that LCA T shares the Ser/Asp(Glu)/His
catalytic t riad and t he Gly-X-Ser-X-Gly m otif with Ser
hydrolases. We isolated f our A. thaliana cDNAs, t he
deduced amino acid sequences of which s hare 25–35%
identity with human LCAT, i ncluding the catalytic triad.
After e xpression in yeast, one of these cDNAs was clearly
shown to encode a PLA1.
Experimental procedures
Chemicals
All of t he lipids and Triton X -100 w ere 9 8–99% pure
products from Sigma. [4-
14
C]Cholesterol (49 mCiÆmmol
)1
),
[1a,2a(n)-
3
H] cholesteryl oleate (29 Ci Æmmol
)1
), [1-
14
C]oleic
acid (50 mCiÆmmol
)1
), [1-
14
C]oleylCoA (55 m CiÆmmol
)1
),

)1
) were synthetized as described
previously [2].
Strains, media and culture conditions
Escherichia coli strain used, XL1 blue recA
–
[recA1, lac
–
,
endA1, gyrA96, thi, hsdR17, SupE44, relA1 (F’proAB,
lac1q, lacZ, DM15, Tn10)].
For Saccharomyces cerevisiae , two strains o f com-
mon genetic background (can1-100, his3-11,15, leu2-3,112,
trp1-1, ura3-1): are1are2 (SCY059, MATa, ade2-1,
met14D14HpaI-SalI, are1DNA::HIS3, are2D::LEU2)and
the corresponding wild-typ e ( SCY062, MATa) were a kind
gift of S. L. Sturley (Columbia University College of
Physicians and Surgeo ns, New York). Two strains were
from Euroscarf, Frankfurt: dga1 (BY4742, MATa, his3D1,
leu2D0, lys2D0, ura3D0, YOR245c::kanMX4)andlro1
(FY, Mat a, ura3-52, HIS3, leu2 D1, LYS2, trp1D63,
YNR008w(8, 1768)::kanMX2).
Yeast strains transformed with plasmid pYeDP60,
harbouring either no insert or the plant cDNA under
study, were simultaneously grown for 3 days at 30 °Cin
minimum medium c ontaining su itable supplements, then
transferred into complete m edium and gr own overnight
at 30 °C as previously described [30]. The cells were then
centrifuged and either freeze-dried for neutral lipid
analysis or disrupted for complete lipid analysis or

ORF was reconstituted b y P CR using a d irect primer 353
(152 nucleotides) b ringing the lacking moiety of the cDNA
and a reverse primer 354 complementary to the 3¢ end of the
ORF (Table 1) and BE525177 as template. Final concen-
trations of primers w ere 400 n
M
, t emplate (20 ng) , High
Fidelity PCR Master DNA polymerase (Boehringer;
25 lL), total volume 50 lL. The PCR was performed using
29 cycles (30 s 94°,30s50°,2min72°). This resulted in the
amplification of a 1 344 b p fragment w hich after d igestion
with BamHI and KpnI was subcloned into pBlueScript SK
yielding the plasmid AtLCAT3-pSK. After checking for the
absence of mutations, the insert was subcloned into the
yeast s huttle vector pYeDP60, yielding the plasmid
AtLCAT3-pYeD P60. AtLCAT3 was deposited in
GenBank and assigned the accession number AF421148.
The FLAG-tagged A. thaliana LCAT3 (FLAG-
AtLCAT3) was made by PCR so that the C-terminal
FLAG epitope (*KDDDDKYD) was fused to the LCAT3
protein. To this purpose the reverse primer 359 containing
the FLAG sequence was opp osed to the direct primer 358
(Table 1) in the presence of AtLCAT3 (20 ng) as template.
The PCR product was checked for the absence of mutations
and subcloned into pYeDP60 as shown above.
To clone Nicotiana tabacum L CAT3 (NtLCAT3),an
orthologue of AtLCAT3 in tobacco, we took advantage of
the presence in databases of an mRNA sequence of tobacco
(clone q8 487, accession number L31415) described a s a
plant activating s equence e ncoding a positively charged

and named NtLCAT3 (GenBank accession number
AF468223).
For Mesembryanthemum crystallinum LCAT3
(McLCAT3) a search in TIGR databases allowed us to
find several orthologues of AtLCAT3 in the ice plant
(Me sembryanthemum crystallinum). These clones originated
from an ic e plant k Uni-Zap XR expression library prepared
48 h after NaCl treatment (J. C. Cushman, Department of
Biochemistry, University of Nevada, Reno, NV). One of
Table 1. Synthetic oligonucleotide primer sequences (5¢fi
fi
3¢) used for gene cloning an d site- directed m utagen esis. Bold characters correspond to
restriction sites. Codons for th e changed amino acids are u nderlined. Nucleotides represented in bold characters i ndicate the p oint mutations
produced. For each mutation two oligonucleotides were synthesized: the one shown below and that w ith the complementary sequence.
Number
Gene cloning
ATATATGGATCCATGTCTCTATTACTGG AAGAGATC 337
TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338
ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC 353
AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG
CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA
AGAATTCAAAGTCTGAAATTCGGGTTTG
TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354
ATATATGGATCCATGGGCTGGATTCCGTGTC 358
TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA 359
ATCAACTACTTTGTGAG
TCCATGATATGATTGATATGC 362
GTGGCAATGGTAATCCAC 363
Site-directed mutagenesis
GCGTAGGAGTTTCGGGTAGC

M
, AV549462 (20 ng) as template,
and High Fidelity PCR Master DNA polymerase (Boeh-
ringer; 25 lL). The PCR was perfo rmed using 29 cycles
(30 s 9 4°,30s50°,2min72°). This resulted in the
amplification of a product of 1608 bp which was cloned
into pYeDP60 previously opened by BamHI and KpnI. The
ORF was called AtLCAT4 and was registered in GenBank
under a ccession num ber A F421149. AtLCAT4 was derived
from At4g19860.
For Lycopersicum esculentum L CAT4 (LeLCAT4),after
sequencing t he EST clone BG125533 ( Clemson University
Genomics Institute, USA), a cDNA of 1853 bp (Gen Bank
accession number A F465780) presenting strong homology
with AtLCAT4 was identified. This cDNA encoded a
polypeptide of 535 amino acids having 66% identity with
AtLCAT4.
For Medicago truncatula LCAT4 ( MtLCAT4),twenty-
eight EST cDNA clones s howing strong homology with
AtLCAT4 and coming f rom the same gene have been
reported in TIGR databases. A nucleotide sequence
(TC86247) originating from the superimposition of these
clones h as also been given. After c onceptual translation, a
polypeptide sequence o f 539 amino a cids showing 64%
identity with AtLCAT4 has been deduced.
For Glycine max LCAT4 (GmLCAT4),twenty-
seven EST cDNA clones showing strong ho mology with
AtLCAT4 and coming f rom the same gene have been
reported in TIGR databases. A nucleotide sequence
(TC192038) originating from the superimposition of these

formed using High Fidelity PCR Master DNA polyme rase
(Boehringer) in a final v olume o f 5 0 lL. Amplification was
5minat92°C, followed by 29 cycles of 30 s at 95 °C, 30 s
at 52 °C, 2 min at 72 °C,andthena10minelongation
at 72 °C.
Nucleotide sequence d etermination was performed as
described previously [30].
Transformation of yeast
Transformation was performed according to [30] with some
modifications. After the heat shock at 4 2 °C the cells were
centrifuged, resuspended in 2% (w/v) glucose (100 lL) and
plated on minimum medium containing suitable supple-
ments (50 lgÆmL
)1
each).
Lipid analysis
Steryl esters (SEs), free sterols (FSs) and TAGs (for
colorimetric quantification) were extracted from freeze-dried
yeast cells and analyse d as d escribed previously [30]. T he
complete lipid analysis of control and transformed yeast was
performed as described previously [34] except that the
chloroform extracts of the fresh cell pellets were shared for
separate TLCs of neutral lipids in hexane/diethylether/acetic
acid (70 : 30 : 1 , v /v/v) a nd polar lipids i n c hloroform/
methanol/acetic acid/water (85 : 15 : 10 : 3.5, v/v/v/v).
Subcellular fractionation
Yeasts were grown for 3 d ays in 100 mL glucose minimum
medium followed b y 16 h in 200 mL galacto se complete
medium (see above). The harvested cells were then disrupted
in 0.1

ded either [ 4-
14
C]cholesterol or di-[1-
14
C]oleylPC under
various conditions [36–38].
Phospholipid diacylglycerol acyltransferase (PDAT).
Assays were performed according to [34].
PLA1 assay. PLA1 activity was fi rst observed when
performing LCAT or PDAT assays. The conditions were
then adjusted so that the phospholipase a c tivity was
proportional t o protein concentration and time and opti-
mized with respect to the s ubstrate and detergent c oncen-
trations, while the reaction yield was k ept below 20%: the
microsomal preparation (0.125 m g proteinÆmL
)1
)wasincu-
bated with [1-
14
C]acyl-labelled PC (250 l
M
and usually
15 nCi) and Triton X -100 (0.15%) in 0.1
M
Tris/HCl pH 7
(final volume, 100 lL) usually for 30 min at 30 °C. The
reaction was stopped by adding a mixture of methylene
chloride (400 lL) and m ethanol (100 lL) containing oleic
or palmitic acid, soybean PC and e gg lysoPC (50 lgeach)
as car riers. After further addition of 0.03 N H Cl (100 lL)

according to their relative retention time and peak area
to the internal standard heptadecanoic acid m ethylester.
The GLC temperature program was from 60 °Cto
120 °C, 20 °CÆmin
)1
, from 120 °C t o 200 °C, 2 °CÆmin
)1
and f rom 2 00 °Cto280°C, 20 °CÆmin
)1
. I dentification
of FAMEs was confirmed by their mass spectra.
AcylCoA synthase. The AcylCoA synthase assay was
carried out according to [41].
Glycerol-3-phosphate acyltransferase. The glycerol-3-
phosphate acyltransferase (G3PAT) assay was carried out
as described previously [42] but 0.1
M
Tris/HCl, pH 7 , was
used instead of 0.25
M
HEPES, pH 8.
Lysophosphatidic acid acyltransferase. The lysophospha-
tidic acid acyltransferase (LPAAT) assay was d erive d
from Bourgis et al. [43] with the following modifications:
the [1-
14
C]oleylCoA concentration was 100 l
M
instead of
10 l

cloned and shown to encode indeed a PDAT [46,47]. These
EST cDNA clones allowed the isolation and se quencing of
cDNAs corresponding to AtLCAT1, 2, 3 and 4.Allthese
cDNAs encompassed the coding region.
A more extensive search of orthologues of the
A. thaliana LCAT genes in various plants has been possible
through use of TIG R (The Institute for Genomic
Research, http://www.tigr.org) d atabases (Lactuca sativa
LCAT1, Glycine max LCAT3 and LCAT4, Medicago
truncatula LCAT2 an d LCAT4 ) a nd thanks to cloning
work performed in our laboratory (Medicago truncatula
LCAT1, Nicotiana tabacum and Mesembryanthemum
crystallinum LCAT3, Lycopersicum esculentum LCAT4).
A phylogenetic tree was constructed for several p lant,
animal, fungal and b acterial LCAT-like proteins w hich
was rooted with the bacterial Bacillus licheniformis
esterase as outgroup (Fig. 1).
According to this tree the so-named plant LCATs are
clearly divided into five subfamilies. The L CAT1 subfamily
is the closest to mammalian and avian authentic LCATs. It
is worthy of interest that very close t o the mammalian
LCATs, one can find proteins such as Bos taurus
phospholipid ceramide acyltransferas e (PLCAT) or Homo
sapiens LCAT-like l ysophospholipase (LLPL) which h ave
both b een shown recently t o possess phospholipase A2
activity and to catalyse in vitro the transfer o f a FA group
from position 2 of a phospholipid to ceramide [48]. The
LCAT3 and LCAT4 form two cle arly distinc t subfamilies
which are more distant f rom the mammalian L CATs than
the LCAT1 subfamily, but which are closer to the

The neutral lipid content of the transformed yeast was
compared to the control (void plasmid-transformed) yeast.
Surprisingly the expression of AtLCAT3 resulted in the
doubling o f the yeast TAG (Fig. 3) a nd FS contents
whereas t he SE content r emained unchanged (data not
shown).
Incubation of di-[1-
14
C]oleyl PC with microsomes from
AtLCAT3- or void plasmid-transformed are1are2,inthe
presence of cholesterol or dioleylglycerol, did not show any
measurable acyltransferase activity but resulted in a high
hydrolysis of PC into lysoPC (LPC) a nd FAs for micro-
somes f rom the transformed yeast, whereas the c ontrol
microsomes produced only a low hydrolysis of PC.
Considering the increase in TAG content of are1are2
when transformed with AtLCAT3, we wondered whether
AtLCAT3 might be involved in plant TAG synthesis.
Because TAG synthesis in y east is performed by several
enzymes, mainly by diacylglycerol : acylCoA acyltrans-
ferase (DGAT), partly by PDAT a nd a litt le by ARE1
and ARE2 [ 51–53], we transformed t he corresponding
mutants dga1 and lro1 and the wild-type strain with
AtLCAT3. Whereas AtLCAT3 -transformed wild-type and
lro1 strainsaswellasare1are2 had a doubled TAG content
compared to that of the c orresponding control strain,
transformation of the dga1 mutant did n ot produce any
change (Fig. 3). These results clearly show that the y east
DGAT is involved i n the observed T AG increase and
consequently that AtLCAT3 is not directly implicated.

(A. thaliana AY160110, comes from At5g13640); MtPDAT1
(M. truncatula AY210981); ScPDAT (Saccharomyces cerevisiae
phospholipid diacylglycerol acyltransferase P40345); SpPDAT
(Schizoaccharomyces pombe phospholipid diacylglycerol acyltrans-
ferase O94680). Accession numbers beginning by AF and AY corres-
pond to products which have been cloned and/or characterized in our
laboratory. The phylogenetic tree has been rooted with BlESTER as the
outgroup. Num be rs a t the nodes of the phylogenetic tree arebootstraps,
indicating the frequencies of occurre nce of partitions found in the tree.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3757
Expression of
AtLCAT3
in wild-type yeast: lipid analysis
For a complete study of the effects of AtLCAT3 tra nsfor-
mation on the yeast lipid conte nt, the neutral and polar lipid
contents of AtLCAT3-transformed wild-type y east were
compared to those of t he control yeast by mean of GLC
analysis of the FAMEs generated from these fractions
(Fig. 4 ). The PC, phosphatidylethanolamine ( PE) and
phosphatidylserine (PS) contents of the AtLCAT3-trans-
formed yeast were found to be half those of the control yeast
while LPC, lysophosphatidylethanolamine (LPE) and free
FA were strongly increased. The increase in TAG that we
first measured by colorimetry (Fig. 3) was c learly con-
firmed, although to a lesser e xtent, by this GLC analysis.
Finally the total FA content was slightly (by 16%) but
significantly increased i n the AtLC AT3-transformed yeast
and t he amount of overproduced total FA (24 nmÆmg dry
weight
)1

C]oleyl PC was incubated with m icro-
somes from AtLCAT3-transformed yeast, the free FA and
LPC fractions were labelled equally (Table 3). To study the
positional specificity of AtLCAT3 toward s the two a cyl
groups of PC, th ese microsomes were incubated with sn-1-
or sn-2-specifically labelled dioleylPC or 1-palmitoyl, 2-oleyl
Fig. 2. Alignment of the deduced aminoacid sequences of LCAT-like cDNAs. Five highly conserved regions are shown. T he conserved amino acids
are boxed. The Ser177, Asp384 and His409 residues of AtLCAT3 corresponding to the catalytic triad of HsLCAT are indicated by a triangle, as
well as two other residues (Tyr346 and Thr352) of AtLCAT3 which have been mutated.
Fig. 3. TAG conten t of var ious control and AtLCAT3-transformed
yeast strains. TAGs were extracted from f reez e-dried cells (at least two
clones per strain), purified by TLC and quantified threefold by t he
colorimetric assay d escribed in the exp erimental section. Deviation
from the mean was less than 12.5%. White bars, void- plasmid-trans-
formed strains; black bars, AtLCAT3-transformed strains.
3758 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
PC (Table 3). The distribution of radioactivity between the
free FA and the LPC fractions indicates for AtLCAT3 a
selectivity for the sn-1 position of a bout 90% with dioleylPC
and 85% with 1-palmitoyl, 2-oleyl PC. The sn-1 specificity
of AtLCAT3 was also st udied by GLC analysis o f the FA
and LPC released during t he incubation of 1-myristoyl,
2-oleyl PC ( Fig. 5): myristic acid a ccumulated almost
exclusively i n the free FA fraction and oleic acid in the
LPC fraction. Therefore w ith 1-myristoyl, 2-oleyl PC, the
selectivity of AtLCAT3 for the sn-1 position is almost 100%.
Dioleyl phosphatidylethano lamine a nd dioleyl phos-
phatidic acid as well as 1-oleyl LPC were compared to
dioleyl PC as s ubstrates. GLC determination of the released
oleic a cid showed that phosphatidylethan olamine, phos-

M
Ca
2+
, under our assay conditions.
The distribution of AtLCAT3 between the microsomal
and 100 000 g supernatant subfractions fr om the trans-
formed yeast was determined by comparing t heir total
activities. They were in a ratio of 84 : 16 indicating that
most of this protein is associated with the microsomal
Table 2. Hydrolase a ctivity t owards various lipids of m icrosomes from
control and AtLCAT3-transformed wild-type yeast. Microsomal prep -
arations from AtLCAT3-transformed and control wild-type yeast
(0.125 mgÆmL
)1
) were incub ated with variou s lipids (250 l
M
)inthe
presence of 0.15% (v/v)Triton X-100 for 30 min. Lipids were extracted
and separated by TLC. The radioactivity of the products was meas-
ured by liquid scintillation. Values are the mean of duplicates a nd
experiments were repeated at least twice.
Substrates
Percentage of substrate
hydrolysis with microsomes
from
Void plasmid-
transformed
WT yeast
AtLCAT3-
transformed

acid fraction
LPC
fraction
1,2-Di[1-
14
C]oleyl PC 52 48
1-[1-
14
C]Oleyl,2-oleyl PC 91 9
1-Oleyl,2-[1-
14
C]oleyl PC 11 89
1-[1-
14
C]Palmitoyl,2-oleyl PC 86 14
1-Palmitoyl,2-[1-
14
C]oleyl PC 16 84
Fig. 4. Complete lipid analysis of c ontrol and AtLCAT3-transformed
wild-type yeast. F AMEs from ind ividual and total lipids were analysed
by GLC. The cultures and analyses were carried out in triplicate.
Standard deviation was less than 2% in analyses of total fatty acids
(TFA) content and less than 15% in analyses of individual lipid classes.
FA, free fatty acids.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3759
membranes, in agreement with a Western blot analysis using
microsomes and supernatant from the FLAG-AtLCAT3-
transformed yeast (data not shown).
Finally the involvement of Ser177, Asp384 and His409 in
the c atalysis, by analogy with the conserved catalytic triad

blank incubated wi thout exogenous substrate were deduced. Results
arefromduplicateexperiments.
Fig. 7. Expression of several FLAG-tagged alleles of At LCAT3 in wild-
type yeast. Control, void plasmid-transformed yeast; F -Asp384Ala,
F-Tyr346Phe, F-His409Leu, F-Ser177Ala, F-Thr352Ala, yeast strains
transformed with FLAG-tagged and m utated alleles of AtLCAT3.
AtLCAT3 and F-AtLCAT3, non tagged and FL AG-tagged
AtLCAT3-transforme d yeast. (A) Western analysis. Microsomes
(50 lg protein) w ere resolved by S DS/PAGE and proteins were
immunoblotted with a n anti-FLAG serum. The mass of 46 kDa cor-
responds to the expected mass for AtLCAT3. (B) Microsomal PLA1
activity and (C) TAG c ontent (colorimetric determination) of these
strains relative to those from AtLCAT3. Analyses were performed in
duplicate on two clones pe r strain. Deviation from the mean was less
than 12.5%.
Fig. 5. Phospholipid acylhydrolase activity of AtLCAT3 towards
1-myristoyl, 2-oleyl PC. After incubation of this PC (250 l
M
)with
AtLCAT3-transformed wild -type yeast mic rosomes (0.125 mgÆmL
)1
)
in 1 mL for the indicated times, the amounts of myristic and oleic acids
in the free FA (FFA) and lysoPC (LPC) fractions were determined by
GLC analysis of their FAMEs. T he values found for the corres-
ponding blanks incub ated without exogenou s substrate were deduced.
Results are from duplicate experiments.
3760 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
phospholipids was increased by a factor of three-to-four.
The lab elling of phospholipids was similarly increased

yeast, followed by various in vitro studies, clearly demon-
strated that AtLCAT3 encodes a PLA1 (Tables 2 and 3,
Figs 3–6). Subcellular fractionation indicated that
AtLCAT3 is mainly associated with the microsomal frac-
tion. This result is puz zling as the amino acid sequenc e o f
AtLCAT3 does not contain any membrane-spanning
domain. However no a ttempts were m ade to wash the
microsomes: the protein m ight be only adsorbed or weakly
bound to the microsomal membranes.
The comparison o f the lipid content of AtLCAT3 -
transformed y east and that of the void plasmid-transformed
yeast showed a decrease (by a factor 2 ) of t he PC, PE and PS
contents and a strong increase of the free FAs, LPC and LPE
levels (Fig. 4 ), in accordance with the phospholipid acyl-
hydrolase activity shown for AtLCAT3. The decrease in PS
suggests that this phospholipid would be another substrate
for AtLCAT3, together with PC and PE, whereas phospha-
tidylinositol, the level of which was not significantly altered,
would not be substrate. Interestingly, the FA composition of
the PC and PE from the AtLCAT3-transformed yeast
diverge significantly from those of the control yeast (Fig. 4),
suggesting for AtLCAT3 a preference for unsatured FAs. If
such a selectivity for unsatured FAs at the sn-1 position was
confirmed in vitro for A tLCAT3, it could indicate a role in
phospholipid remodelling for this novel PLA1.
Moreover, the lipid analyses showed an increase of the
total FA c ontent in the AtLCAT3-transformed yeast
together w ith an increase of the T AG content of the yeast
(Fig. 4 ). This last result confirms the role of yeast TAGs in
FA storage [54]. I t is noteworthy that the reverse situation

Another gene from A. t haliana was recently shown to
encode a PLA1 [4]. Starting from the mutant dad1 defective
in anther dehiscence, pollen maturation and flower opening,
these authors isolated the corresponding DAD1 gene, studied
the function of the DAD1 protein by expression in E. coli,
showed its targeting to the chloroplast and its restricted
expression in stamen filaments. T hey su ggest that DAD1
might catalyse the initial step of j asmonic acid biosynthesis
in the filaments thus regulating the water transport in
stamens a nd petals [4]. As the amino acid sequence of
AtLCAT3 is not related at all to that of DAD1, it constitutes
a new family of plant PLA1, together with its orthologues
McLCAT3, GmLCAT3 and NtLCAT3 ( Fig. 1).
The present work has allowed the characterization of
AtLCAT3 by heterologous expression in yeast. Its current
expression in planta should allow d isclosure of the physio-
logical r ole of the encoded protein. As most of the plant
glycerolipid acylhydrolases cloned a nd characterized so far
(small PLA2s, patatin-like g lycerolipid acylhydrolases and
the PLA1 DAD1) are involved i n s ignal transduction, the
spatio-temporal expression pattern of AtLCAT3 under
normal and stress conditions will be studied.
Acknowledgements
We are especially indebted to the following scientists who kindly sent
us EST clones: Dr Erika Asamizu and N obumi K usuhara (Kazusa
DNA Research Institute, Chiba, Japan), Dr Joe A. Clouse (The
Samuel Roberts Noble Fou ndation, Inc., Ardmore, USA), Dr
Doreen Ware (ABRC, The Ohio State University, Co lumbus, USA),
Dr John C. Cushman (Departmen t of Biochemistry, University of
Nevada, Reno, U SA), Dr M aryvonne Rosseneu (Department o f

611.
6. Holk, A., R ietz, S., Zahn, M., Quader, H. & Scherer,
G.F.E. (2002) Molecular identification of cytosolic, patatin-
related phospholipases A from Arabidopsis with potential
functions in p lan t signal transduction. Plant Physiol. 13 0,90–
101.
7. Lee, H.Y., B ahn, S.C., Kang, Y M., Lee, K.H., Kim, H.J., Noh,
E.K., Palta, J.P., Shin, J.S. & R yu, S .B. (2003) Secretory l ow
molecular weight phospholipase A2 plays important roles in cell
elongation and shoot gravitrop ism in A rabidopsis. Plant Cell 15,
1990–2002.
8. Chandra, S., H einstein, P.F. & Low, P.S. (1996) Activation o f
phospholipase A by plant defense elicitors. Plant Physiol. 110,
979–986.
9. Viehweger, K., Dordschbal, B. & Roos, W. (2002) Elicit or-acti-
vated phospholipase A(2) generates lysophosphatidylcholines
that mobilize the vacuolar H
+
pool for pH signaling via the
activation of Na
+
-dependent proton fluxe s. Plant Cell 14, 1509–
1525.
10. Dhondt,S.,Gouzerh,G.,Muller,A.,Legrand,M.&Heitz,T.
(2002) Spatio-temporal expre ssion of patatin-like lipid acyl
hydrolases and accumulation of jasmonates in elicitor-treated
tobacco leaves are not affected by endogenous levels of salicylic
acid. Plant J. 32, 749–762.
11. Narvaez-Vasquez, J., Florin-Christensen, J. & Ryan, C.A. (1999)
Positional specificity of a phospholipase A a ct ivity induced by

(1998) cDNA cloning of t he 43-kDa latex allergen Hev b 7 with
sequence similarity to patatins and its expression in th e yeast
Pichia pastoris. Eur. J. Biochem. 25 5 , 213–219.
20. Matos,A.R.,d’Arcy-Lameta,A.,Franca,M.,Petres,S.,Edel-
man, L., Kader, J., Zuily-Fodil, Y. & Pham-Thi, A.T. (2001) A
novel patatin-like g en e stimulated b y drought stress enco des a
galactolipid acyl hydrolase. FEBS Lett. 491, 188–192.
21. Andrews, D.L., B eames, B., Su mmers, M.D. & Park, W.D.
(1988) Characterization of the lipid acyl hydrolase activity of the
major po tato (Solanum tuberosum) tuber p rotein, patatin, by
cloning and abundant expression in a b aculovirus v ector. Bio-
chem. J. 252, 199–206.
22. Senda,K.,Yoshioka,H.,Doke,N.&Kawakita,K.(1996)A
cytosolic phospholipase A2 f rom p o tato tissues ap pears to be
patatin. Plant Cell Physiol. 37, 347–353.
23. Hirschberg, H.J., S im ons, J.W., Dekker, N. & Egmond , M.R.
(2001) Cloning, expression, purification and characterization of
patatin, a novel phospholipase A. Eur. J. Biochem. 268, 5037–
5044.
24. Rydel, T.J., Williams, J .M., Krieger, E., Moshiri, F., Stal lings,
W.C., Brown, S.M., Pershing, J.C., Purcell, J.P. & Alibhai, M.F.
(2003) The crystal structure, mutagenesis, and activity studies
reveal that patatin is a lipid acyl hydrolase with a Ser-Asp cata-
lytic dyad. B i och em ist ry 42, 6696–6708.
25. Brady, L., Brzozowski, A.M., Derewenda, Z.S., Dodson, E.,
Dodson, G., Tolley. S., Turkenburg, J.P., Christiansen, L., Huge-
Jensen,B.,Norskov,L.,Thim,L.&Menge,U.(1990)Aserine
protease triad forms the catalytic centre of a triacylglycerol lipase.
Nature 343, 767–770.
26. Winkler, F.K., D ’Arcy, A. & Hunziker, W. (1990) Structure of

33. Maillot-Vernier, P ., Gondet, L., Sc haller, H., Benveniste, P. &
Belliard, G. (1991) Genetic s tudy and f urther biochemical char-
acterization of a tobacco mutant that overproduce s sterols. Mol.
Gen. Genet. 231, 33–40.
34. Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Lee, M.,
Sandager, L., Ronne, H. & S tymne, S. (2000) Phospholip id:
diacylglycerol acyltransferase: an enzyme that catalyzes the acyl-
CoA-independent formation of triacylglycerol in yeast and
plants. Proc. Natl Acad. Sci. USA 97, 6487–6492.
35. Pompon, D., Louerat, B., Bronine, A. & Urban, P. (1996) Yeast
expression of an imal and plant P450s in optimized redox
environments. Methods Enzymol. 272, 51–64.
36. Bouvier-Nave
´
, P. & Benveniste, P. (1995) Sterol acyl transferase
and steryl ester hydrolase a ctivit ies in a tobacco mutant which
overproduces sterols. Plant Sci. 110, 11–19.
37. Aron, L ., Jones, S. & Fielding, C.J. (1978) Human p lasma
lecithin-cholesterol acyltransferase. Characterization of cofactor-
dependent phospholipase activity. J. Biol. Chem. 253, 7220–
7226.
38. Buckley, J.T. (1982) Substrate specificity of bacterial glycero-
phospholipid: cholesterol acyltransferase. Biochemistry 21, 6699–
6703.
39. Morrison, W.R. & S mith, L.M. (1964) Fatty acid methyl esters
preparation. J. Lip id Res. 5, 600–608.
40. Christie, W .W. ( 1993) Preparation of e ster derivatives of fatty
acids for chromatographic analysis. In Advances in Lipid
Methodology – II (Christie, W.W., ed.), pp. 69–111. Oily Press,
Dundee.

functional characterization of a phospholipid: diacylglycerol
acyltransferase from Ar abidops is. Plant Physiol. 135, 1324 –
1335.
48. Hiraoka, M., Abe, A. & Shayman, J.A. (2002) Cloning and
characterization o f a lysosomal phospholipase A 2, 1-O-acylcer-
amide synthase. J. Biol. Chem. 277, 10090–10099.
48a. Banas, A., Carlsson, A., Huang, B., Noiriel, A., Benveniste, P.,
Schaller, H., Bouvier-Nave
´
, P. & Stym ne, S. (2004) Enzymatic
properties o f an A. thalia na phospholipid: sterol acyltransferase
(pp. 70). 16th International Plant Lipid Symposium, Budapest,
Hungary, 1–4 June 2004. Abstract book at http://www.mete.
mtesz.hu/pls/
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3763
48b . No iriel, A., Benveniste, P., Schaller, H., Bouvier-Nave
´
,P.,Banas,
A.,Carlsson,A.,Huang,B.&Stymne,S.(2004)Functional
study of an A. thaliana LCAT-like cDNA e ncoding a phospho-
lipid: sterol a cyltransferase:sterylesterprofilesofA. thaliana
overexpressers and T-DNA insertion m utants (pp. 105). 16th
International Plant Lipid Sympo sium, Budapest, Hu ngary, 1–4
June 2004. A bstract book at http://www.mete.mtesz.hu/pls/
49. Yang,H.,Bard,M.,Bruner,D.A., Gleeson, A., Deckelbaum,
R.J., Aljinovic, G., P ohl, T .M., Rothstein, R. & Sturley, S.L.
(1996) Sterol esterification in yeast: a two-gene process. Science
272, 1353–1356.
50. Yang, H., Cromley, D., Wang, H., B illheimer, J.T. & Sturley,
S.L. (1 997) Functional expression of a cDNA to human ac yl-