RESEARCH Open Access
The impact of Metastasis Suppressor-1, MTSS1,
on oesophageal squamous cell carcinoma and its
clinical significance
Fei Xie
1,2
, Lin Ye
1
, Jinfeng Chen
2
, Nan Wu
2
, Zhiqian Zhang
2
, Yue Yang
2
, Lijian Zhang
2*
and Wen G Jiang
1*
Abstract
Background: Metastasis suppressor-1 (MTSS1) has been proposed to function as a cytoskeletal protein with a role
in cancer metastasis. Recent studies have demonstrated the clinical significance of MTSS1 in certain type of
cancers, yet the clinical relevance of MTSS1 in oesophageal squamous cell carcinoma (ESCC) has not been
reported.
Methods: In this study, we assessed the expression levels of MTSS1 in tumours and its matched adjacent non-
tumour tissues obtained from 105 ESCC patients. We also used ESCC cells with differing MTSS1 expression and
assessed the influence of MTSS1 on ESCC cells.
Results: Down-regulation of MTSS1 expression was observed both in oeso phageal tumour tissues and ESCC cancer
cell lines. We also reported that MTSS1 expression was associated with tumour grade (p = 0.024), lymph node
metastasis (p = 0.010) and overall survival (p = 0.035). Patients with high levels of MTSS1 transcripts had a favorable
suppressor functions by acting as a scaffold protein that
interacts with actin-associated proteins to regulate
lamellipodia formation [4-6]. Biochemical study revealed
* Correspondence: ;
1
Metastasis and Angiogenesis Research Group, Cardiff University School of
Medicine, Cardiff, CF14 4XN, UK
2
Key Laboratory of Carcinogenesis and Translational Research (Ministry of
Education), Department of Thoracic Surgery, Peking University School of
Oncology and Beijing Cancer Hospital, Beijing, 100142, China
Full list of author information is available at the end of the article
Xie et al . Journal of Translational Medicine 2011, 9:95
/>© 2011 Xie et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License ( which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
that MTSS1 binds monomeric actin through its C-term-
inal WH2 domain for polymerization and deforms phos-
phoinositide-rich membranes through its N-terminal I-
BAR domain [6,7]. MTSS1 has also been identified as a
sonic hedgehog inducible protein that potentiates Gli
transcription in the developing hair follicle and basal
cell carcinomas of the skin [8]. To date, the role and
biochemical mechanisms for MTSS1 in tumourigenesis
and metastasis remain largely unknown. This is due
partly to t he fact th at the s tudies of MTSS1 have been
restricted to a limited number of cancer types, with little
support from the clinical aspect.
Until now, there has been no research reporting the
role of MTSS1 in oesophageal squamous cell carcinom a
sues were collected immediately after surgical resection
at the Beijing Cancer Hospital and were stored in the
Tissue Bank of Peking University Oncology School.
Clinico-pathologic factors, including age, sex, histologi-
cal types of tumours, TNM stage, and lymph node
metastasis were recorded and stored in the patients’
database. Patients were followed up from the day o f
operation to December 2009 as the end of the follow-up
for the present study. The follow-up intervals were cal-
culated as survival intervals after surgery.
RNA isolation and reverse transcription polymerase chain
reaction
Total RNA was isolated from the homogenized oesopha-
geal tissues and cell lines using Total RNA Isolation
Reagent (ABgene™). Reverse transcription was done
using the Reverse Transcription kit (Primer design), fol-
lowed by PCR using a REDTaq™ ReadyMix PCR reac-
tion mix (Sigma-Aldrich, Inc.). RNA concentration was
determined through spectrophotometric measurement
(WPA UV 1101, Biotech Photometer, Cambridge, UK).
1 μg RNA was used to generate cDNA with a RT kit
(AbGene Laboratories, Essex, England). The quality of
DNA was verified using GAPDH primers (sense: 5’ -
ATGATATCGCCGCGCTCGTC-3’ ;antisense:5’ -
CGCTCGGTGAGGATCTTCA-3’ ). MTSS1 mRNA
levels were assessed using MTSS1 primers (sense: 5’ -
TCAAGAACAGATGGAAGAATGG-3’ ;Antisense:5’-
TGCGGTAGCGGTAATGTG-3’,exon5-10).PCRwas
performed in a GeneAmp PCR system 2400 thermocy-
cler (Perkin-Elmer, Norwalk CT, USA). Cycling condi-
Quantitative real time PCR
Real time quantitative PCR (QPCR) was performed on
the Icycler IQ5 system (Bio-Rad, Hammel Hemstead,
UK) to quantify the level of MTSS1 transcripts in the
oesophageal squamous cell carcinoma specimens (shown
as copies/μl from internal standard). Oesophageal cDNA
samples were then examined for MTSS1 transcript
expression, along with a set of standards and negative
controls [9]. The QPCR technique utilized the Ampli-
fluor system™ (Intergen Inc., England) [10] and QPCR
master mix (BioRad). Pairs of primers as follow were
designed using Beacon Design software (PREMIER Bio-
soft, Palo Alto, CA): MTSS1 QPCR primers as follow:
sense: 5’-ATATCCCAGGATGCCTTC-3’;antisense:5’ -
ACTGAACCTGACCGTACACGGTTCTCGCTTCTC
TTT-3’ , exon 10-12). The underlined sequence in the
reverse primers was the additional Z sequence, which is
complementary to the universal Z probe (TCS Bio logi-
cals Ltd., Oxford, UK). Real-time QPCR conditions were
95°Cfor15min,followedby60cyclesat95°Cfor20s,
55°C for 30 s and 72°C for 20 s. QP CR for GAPDH was
also performed on the same samples to n ormalize for
any residual differences in the initial level of RNA in the
specimens, using a GAPDH quantitation kit from Per-
kin-Elmers (Perkin-Elmer, Surrey, England, UK).
Immunohistochemical staining of MTSS1
Paraffin sections of oesophageal squamous cell carci-
noma tumours (n = 35) and matched background tis-
sues (n = 35) were cut at a thickness of 6 μm. The
sections were first dewaxed using a series of zylene
5’-ATGGAGGCTGTGATTGAG-3’; antisense: 5’-CTAA-
GAAAAGCGAGGGG-3’ . Correctly amplified product
was then cloned into pEF6/V5-His-TOPO vector (Invi-
trogen, Paisley, UK). Multiple c lones of E. coli were
screened and plasmids from the clones were sequenced.
Detailed procedure was adapted from the reports
described previously [12]. Purified plasmids were then
electroporated into the KYSE150 oesophageal cancer
cell line. Blasticidin (5 μg/ml final concentration) was
used to select stably transfected strains. The KYSE150
cell s stably expressing MTSS1 were termed in the study
as KYSE150-MTSS1-Exp. The control group of cells
contained the same plasmid vector (minus the MTSS1
sequence) and was termed KYSE150-PEF-control.
Anti-MTSS1 ribozyme tra nsgenes were employed to
knockdown the expression of MTSS1 in the KYSE510
oesophageal cancer cell line, and were generated using
the methods previously described [12] . Briefly, the anti-
MTSS1 hammerhead ribozyme targeting was designed
based on the secondary structure generated using
Zuker’s RNA mFold program. Then the ribozymes that
specifically target MTSS1 were generated using touch-
down PCR with the appropriate primers (sense: 5’ -
CTGCAGAGGCTTTTTAGATCTTCCGACTGATGA
GTCCGTGAGGA-3’; antisense: 5’-ACTAGTTAACCCA
CCTTCAGACCATTTCGTCCTCACGGACT -3’ ). Cor-
rectly amplified inserts w ere purified a nd cloned into
the pEF6/V5-His-TOPO vector, before transfecting the
KYSE510 oesophageal cancer cell line by way of electro-
poration. The same procedure as described above was
UVITech imager (UVITech, Inc.).
In vitro cell growth assay
Cells were plated into 96-well plated at 2,000 cells/well
after a period of incubation. Cells were fixed in 10% for-
maldehyde after 1, 3 and 5 days. 0.5% crystal violet (w/
v) was used to stain cells. Following washing, the stained
crystal violet was dissolved with 10% (v/v) acetic acid
and the absorbance was determined at a wavelength of
540 nm using a spectrophotometer (Bio-Tek, ELx800).
Cell matrix adhesion assay
The cell matrix adhesion assay was done as previously
described [13]. 96-well plate was precoated with 5 μgof
Matrigel and allowed to dry. Following rehydration,
30,000 cells were added to each well. After 40 min of
incubation non-adherent cells were washed off using
BSS buffer. The remaining cells were fixed with 4% for-
malin and stained with 0.5% crystal violet. The number
of adherent cells was then counted under microscopy.
Wounding/migration assay
The wounding assay was performed as previously
described [14]. The cells were seeded at a density of
40,000 per well into a 24-well plate and allowed to
reach confluence. The monolayer of cells was then
scraped with a fine gauge needle to create a wound of
approximately 200 μm. The movement o f cells to close
the wound was recorded as described previously using a
time-lapsed video system. Images were captured from
the videotape at the equivalent of 15 min intervals in
real-time and stored as a series of gray scale bitmap
images. The movement of single cells within a colony
MTSS1 transcript expression was examined in th e oeso-
phageal specimens of 105 oesophageal squamous cell
carcinoma patients using real-time quantitative PCR
(expressed as mean MTSS1 transcript copies/μlofRNA
from 50 ng total RNA and standardized with GAPDH).
The cohort comprised 87 men (82.86%) and 18 women
(17.14%). The average age of all patients was 58.75
years. Lower mRNA expression level of MTSS1 was
observed in tumour tissues (27.42 ± 7.32) when com-
pared to t he normal background tissues (57.38 ± 13.61),
although the difference was only marginally statistically
significant (p = 0.054)(Figure 1A).
MTSS1 expression correlates with tumour grade or TNM
staging
The relation of MTSS1 expression against pathological
status was also assessed in the present study throug h
quantitative analysis of MTSS1 transcript. Since the
tumour grade and TNM staging information of 4 cases
in the cohort was missing, the tissues used for t he ana-
lysis of tumour grade, T status, N status were 101.
MTSS1 levels were first assessed in relation to oeso pha-
geal tumour grade (grade 1 , n = 6; grade 2, n = 46;
grade 3, n = 41; grade 4, n = 7). Tumour grade (well or
moderat ely differentiated (grade 1/2) vs. poorly differen-
tiated or undifferentiated (grade 3/4)) outcomes are
shown in Figure 1B. Grade 3/4 tumours (13.82 ± 5.13)
had significant reduced levels of MTSS1 compared to
grade 1/2 tumours (48.19 ± 16.07) (p = 0.024).
Xie et al . Journal of Translational Medicine 2011, 9:95
/>Page 4 of 10
patients, none was lost to follow-up. The median obser-
vation period was 20 months (0-86 months). Kaplan-
Meier analysis demonstrated that patients with high
levels of MTSS1 expression in their tumours showed a
longer overa ll surv ival time (30.00 ± 3.70 months), com-
pared with lower expression levels group (18.00 ± 2.78
months) (p = 0.035, Figure 1E). We further characterize
the patients into three groups according to MTSS1
expression levels: high, moderate or low levels. Most
remarkably, patients with high MTSS1 levels had the
longest survival time (47.70 ± 6.32 months), compared
with those with moderate (38.22 ± 5.41 months) or low
MTSS1 levels (24.64 ± 3.61 months) (p = 0.015, Figure
1F). In stratified survival analysis according to the node
status, node negative patients with high MTSS1 levels
had a significan t longer survival (53.41 ± 6.82 months) in
comparison with low levels group (34.51 ± 4.79 months)
(p = 0.045, Figure 1G). In the node positive patients, no
significant association was found between MTSS1
expression and survival (p > 0.05, Figure 1H). Finally,
multivariate analysis using gender, age, grade, TNM,
nodal status and MTSS1 expression levels as variants has
shown that nodal status (p = 0.015), TNM (p = 0.006),
grade (p = 0.026), age (p = 0.020) and MTSS1 (p = 0.037)
are independent factors for the overall survival.
Immunohistochemical staining of human oesophageal
specimens
To assess the expression pattern of MTSS1 at the pro-
tein le vel, we performed immunohistochemical analysis
of MTSS1 in the human oesophageal squamous cell car-
type and control KYSE510 cells was reduced in the
KYSE510-MTSS1-Rib cells. These experiments were
replicated at the protein level through Wester n blot-
ting (Figure 3C). These new MTSS1-modified cell
lines w ere ready for the analysis through a series of in
vitro studies.
Regulation of MTSS1 expression had an impact on
oesophageal squamous cell carcinoma cell aggressiveness
Effects of MTSS1 over-expression or knockdown on in vitro
cell growth
We first determined the effect of MTSS1 over-expres-
sion on in vitro cell growth (Figure 4A). The results sug-
gest an i nhibitory effect on cell growth by MTSS1 over-
expression in oesphag eal cancer cells. KYSE150-MTSS1-
Exp oesophageal cancer cells had a minor yet
Figure 2 Immunohistochemical staining of MTSS1 in human
oesophageal tissues. Top panel: the MTSS1 protein was found to
be stained in the normal oesophageal epithelial cells (indicated by
black arrows); Bottom panel: staining of oesophageal cancer cells for
MTSS1 was found to be negative in the oesophageal tumour
tissues.
Xie et al . Journal of Translational Medicine 2011, 9:95
/>Page 6 of 10
significantly reduced rate of growth (p = 0.013) com-
pared to the control group. This was consistent with
observations in KYSE510-MTSS1-Rib cells, i n which
MTSS1 expression had been knocked down. The
increased rate of growth (p = 0.009) compared to the
control group was seen in KYSE510-MTSS1-Rib cells.
Effects of MTSS1 over-expression or knockdown on in vitro
cells were significantly more invasive than the control
cells which expressed MTSS1 (p < 0.0001).
Discussion
Since t he study of MTSS1 has been restricted to a lim-
ited number of cancer types and available data seem to
be controversial, whether or not MTSS1 serves as a
metastasis suppressor has not been clearly defined to
date. Several lines of evidence have indicated that the
expression of MTSS1 could be down-regulated in solid
tumours [2,12,15,16], whereas up-regulation of MTSS1
expression has also been observed in one other tumour
type [3]. Thus. the role of MTSS1 in cancer and cancer
metastasis remains somewhat open. To our best knowl-
edge, the current study is the first report of down- regu-
lation of MTSS1 in oesophageal squamous cell
carcinoma. Our study has shown a reduced or absent
levels of MTSS1 both in oesophageal squamous cell car-
cinoma tumour tissues and cancer cell line. We also
reported that the expression of MTSS1 was associated
with the clinical pathology and prognosis of the patients
with oesophageal squamous cell carcinoma. Cellular
function tests further demonstrated that the presence of
MTSS1 is related to the inhibition of the oesophageal
squamous cell carcinoma cell aggressiveness.
MTSS1 has been found to be transcriptionally
expressed at lower levels or absent in a limited number
of tumour cells. In the present study, the expression
levels of MTSS1 were examined in several oesophageal
cancer cell lines with different aggressiveness (from well
or moderate to poorly differentiated). It is evident from
study is the relationship between MTSS1 expression and
oesophageal squamous cell carcinoma patient clinical
data in a cohort of human oesophageal squamous cell
carcinoma specimens by using quantitative PCR and
immunohistochemical analysis. Our data demonstrated a
reduced level of MTSS1 expression in oesophageal squa-
mous cell carcinoma tumours compared to the normal
tissues. This in contrary to the results obtained in hepa-
tocellular carcinoma, but clearly in line with the studies
in other types of cancer to date. A highly significant link
was also seen between MTSS1 expression and nodal sta-
tus, tumour grade and overall survival. Our findings
clearly indicate therefore that MTSS1 may serve as a
potential prognostic indicator for patients with oesopha-
geal squamous cell carcinoma, as we s how that patients
expressing high levels of MTSS1 have a favorable prog-
nosis in contrast to those patients with reduced levels of
MTSS1 and a poo r prognosis. Consistent with our find-
ings, high levels of MTSS1 expression was also found in
breast cancer or hepatocellular carcinoma patients with
a favorable prognosis in the previous reports . This indi-
cates that MTSS1 serves as a potential prognostic indi-
cator in human cancer.
Our functional studies have demonstrated that the
MTSS1 over-expression resulted in a dramatic reduction
in tumour cell migration, invasion and growth, and an
increase in cell adhesion. The loss of MTSS1 by way of
hammerhead ribozyme transgenes resulted in enhanced
invasiveness, migration, growth and decreased adhesive
ability, in comparison with control cells, which further
tests further demonstrated that the presence of MTSS1
is related to the inhibition of the oesophageal squamous
cell carcinoma cell aggressiveness. This study showed
that MTSS1 could be of value as a potential prognostic
indicat or in human ESCC and may be an impo rtant tar-
get for cancer therapy.
Acknowledgements
The authors would like to thank Cancer Research Wales and the Albert
Hung Foundation for their support. The authors also thank Sevier Medical
Art for their kind permission to produce some of present figures using their
prepared images. Dr Fei Xie is a recipient of the China Medical Scholarship
of Cardiff University and Peking University School of Oncology.
Author details
1
Metastasis and Angiogenesis Research Group, Cardiff University School of
Medicine, Cardiff, CF14 4XN, UK.
2
Key Laboratory of Carcinogenesis and
Translational Research (Ministry of Education), Department of Thoracic
Surgery, Peking University School of Oncology and Beijing Cancer Hospital,
Beijing, 100142, China.
Authors’ contributions
FX carried out the Quantitative PCR, western blotting, cell function test, and
drafted the manuscript. YL carried out the RNA extraction, reverse
transcription PCR, immunoassays and performed the statistical analysis. LY
carried out the construction of MTSS1 expressing and ribozyme transgenes.
JC participated in the collection of tissue samples and investigated the
clinical features. NW participated in collection of the tissue samples. ZZ
helped to draft the manuscript. YY participated in the design of the study.
LZ participated in the design of the study. WJ conceived of the study, and
Cell Biol 2007, 176:953-964.
8. Callahan CA, Ofstad T, Horng L, Wang JK, Zhen HH, Coulombe PA, Oro AE:
MIM/BEG4, a Sonic hedgehog-responsive gene that potentiates Gli-
dependent transcription. Genes Dev 2004, 18:2724-2729.
9. Nazarenko IA, Bhatnagar SK, Hohman RJ: A closed tube format for
amplification and detection of DNA based on energy transfer. Nucleic
Acids Res 1997, 25:2516-2521.
10. Jiang WG, Douglas-Jones A, Mansel RE: Level of expression of
lipoxygenase-5, 12, and 15 and cyclooxygenase in human breast cancer.
Prostaglaindins Leukotr Ess Fatty Acids 2003, 69:275-281.
11. Jiang WG, Grimshaw D, Lane J, Martin TA, Abounader R, Laterra J,
Mansel RE: A hammerhead ribozyme suppresses expression of
hepatocyte growth factor/scatter factor receptor c-MET and reduces
migration and invasiveness of breast cancer cells. Clin Cancer Res 2001,
7:2555-62.
12. Parr C, Jiang WG: Metastasis suppressor 1 (MTSS1) demonstrates
prognostic value and anti-metastatic properties in breast cancer. Eur J
Cancer 2009, 45:1673-1683.
13. Jiang WG, Hiscox S, Hallett MB, Scott C, Horrobin DF, Puntis MC: Inhibition
of hepatocyte growth factor-induced motility and in vitro invasion of
human colon cancer cells by gamma-linolenic acid. Br J Cancer 1995,
71:744.
14. Jiang WG, Hiscox SE, Parr C, Martin TA, Matsumoto K, Nakamura T, et al:
Antagonistic effect of NK4, a novel hepatocyte growth factor variant, on
in vitro angiogenesis of human vascular endothelial cells. Clin Cancer Res
1999, 5:3695.
15. Nixdorf S, Grimm M, Loberg R, Marreiros A, Russell RJ, Pienta KJ, Jackson P:
Expression and regulation of MIM (missing in metastasis), a novel
putative metastasis suppressor gene, and MIM-B, in bladder cancer cell
lines. Cancer Lett 2004, 215:209-220.
epithelia. J Cell Sci 2011, 124:1245-1255.
25. Mustafa N, Martin TA, Jiang WG: Metastasis tumour suppresor-1, MTSS-1
and the aggressiveness of prostate cancer cells. Exp Therapeut Med 2011,
2:157-162.
doi:10.1186/1479-5876-9-95
Cite this article as: Xie et al.: The impact of Metastasis Suppressor-1,
MTSS1, on oesophageal squamous cell carcinoma and its clinical
significance. Journal of Translational Medicine 2011 9:95.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Xie et al . Journal of Translational Medicine 2011, 9:95
/>Page 10 of 10