Purified RPE65 shows isomerohydrolase activity after
reassociation with a phospholipid membrane
Olga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing Ma
Departments of Cell Biology and Medicine Endocrinology, Harold Hamm Oklahoma Diabetes Center, University of Oklahoma Health
Sciences Center, OK, USA
In vertebrates, both rod and cone visual pigments
require 11-cis-retinal as a chromophore [1]. Upon
absorption of photon, 11-cis-retinal is photoisomerized
to all-trans-retinal, which triggers the conformational
change of opsin and subsequently activates the G-pro-
tein transducin and initiates vision [2,3]. The process
of recycling 11-cis-retinal, termed the visual cycle
(Fig. 1), is essential for the regeneration of visual
pigments [4,5]. All-trans-retinal generated by photo-
activation is dissociated from opsin and converted to
all-trans-retinol by retinol dehydrogenase [6]. The
all-trans-retinol is then exported from photoreceptors
to the retinal pigment epithelium (RPE), and all-trans-
retinol is esterified by lecithin:retinol acyltransferase
(LRAT) to all-trans-retinyl esters [7]. The key enzyme
of the visual cycle, isomerohydrolase (EC 5.2.1.7),
processes all-trans-retinyl esters into 11-cis-retinol [8].
It has been proposed that the free energy generated
from ester hydrolysis is probably used by the enzyme
to drive a thermodynamically uphill trans–cis isomeri-
zation of the retinoid double bond [9]. The chemical
nature of the isomerohydrolase has been undetermined
thus far.
RPE65 is a membrane-associated protein expressed
predominantly in the RPE [10]. The molecular mass of
bovine RPE65 as determined by MS is 61 961 Da; this

However, previous attempts to detect the enzymatic activity of purified
RPE65 were unsuccessful, and thus its enzymatic function remains contro-
versial. Here, we developed a novel liposome-based assay for isomerohy-
drolase activity. The results showed that purified recombinant chicken
RPE65 had a high affinity for all-trans-retinyl palmitate-containing lipo-
somes and demonstrated a robust isomerohydrolase activity. Furthermore,
we found that all-trans-retinyl ester must be incorporated into the phos-
pholipid membrane to serve as a substrate for isomerohydrolase. This assay
system using purified RPE65 enabled us to measure kinetic parameters for
the enzymatic reaction catalyzed by RPE65. These results provide
conclusive evidence that RPE65 is the isomerohydrolase of the visual cycle.
Abbreviations
Ad-RPE65, adenovirus expressing RPE65; LRAT, lecithin:retinol acyltransferase; MOI, multiplicity of infection; PC, phosphatidylcholine; RPE,
retinal pigment epithelium.
3020 FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS
visual pigment regeneration in vivo [13]. Mutations in
the RPE65 gene have been linked to Leber’s congenital
amaurosis, which is an inherited disease characterized
by blindness at birth [14,15]. Recently, we and two
other groups reported that isomerohydrolase activity
was detected in cultured cells that coexpress both
RPE65 and LRAT, suggesting that RPE65 is the isom-
erohydrolase [16–18]. However, as isomerohydrolase
activity has never been shown using purified RPE65,
there is skepticism about whether RPE65 is indeed the
isomerohydrolase [19]. Two groups have reported inde-
pendently that purified RPE65 is a retinyl ester-binding
protein [20,21]. These studies led to speculation that
RPE65 is not the isomerohydrolase itself, but rather
that it is required to present the insoluble retinyl ester

determine the optimal amount for solubilizing RPE65.
As shown by western blot analysis, Chaps at concentra-
tions of 0.1–0.5% solubilized significant amounts of
recombinant RPE65 in the cells, whereas lower concen-
trations of the detergent did not adequately solubilize
RPE65 from the membrane (Fig. 2C).
We also determined the effect of increasing Chaps
concentrations on the enzymatic activity of RPE65.
For these measurements, a novel enzymatic activity
Fig. 1. Scheme of retinoid visual cycle.
O. Nikolaeva et al. Isomerohydrolase activity of purified RPE65
FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS 3021
assay with liposomes containing all-trans-retinyl ester
was developed (see Experimental procedures). In the
absence of Chaps, incubation of the total cell homoge-
nate expressing RPE65 with all-trans-retinyl palmitate
incorporated into liposomes generated a significant
amount of 11-cis-retinol (Fig. 2D). The addition of
0.5% Chaps to the assay system almost completely
abolished the 11-cis-retinol formation (Fig. 2E).
To define the Chaps concentration that sufficiently
solubilizes RPE65 while preserving its enzymatic activ-
ity, we measured the dependence of isomerohydrolase
activity on Chaps concentration, both for total 293A-
LRAT cell homogenates expressing RPE65 and for
Chaps-solubilized fractions (Fig. 2F). For total cell
lysates, the production of 11-cis-retinol gradually
decreased with increasing Chaps concentrations. When
the Chaps-soluble fractions were used for the isomero-
hydrolase assay, an initial plateau of enzymatic activity

11-cis retinol (pmol)
600
500
400
300
200
100
0
00.50.1 0.60.40.30.2
CHAPS (%)
0% CHAPS
0.5% CHAPS
0
5
25
50
100
150
200
300
500
BMF
Total cell lysate
AD
BE
CF
RPE65
β-actin
MOI
CHAPS soluble fraction

60
50
40
kDa
kDa
kDa
Fig. 2. Optimization of expression and solubilization of recombinant RPE65. (A, B) The 293A-LRAT cells were infected with Ad-RPE65 with
increasing MOI, and harvested at 24 h after infection. Equal amounts (20 lg) of proteins from total cell lysates (A) and the Chaps (0.1%)-sol-
ubilized supernatant after ultracentrifugation (B) were analyzed by western blot analysis using an antibody specific for RPE65, and normalized
by b-actin levels. Proteins of the bovine RPE microsomal fraction (1 lg) were included as a control. (C) To determine the effects of Chaps
concentration on RPE65 solubility, the cells were infected with Ad-RPE65 at MOI 100, and harvested 24 h after infection. The cell lysates
were incubated with increasing concentrations of Chaps for 1 h at 4 °C, and then centrifuged at 200 000 g for 30 min. Equal amounts (2 lg)
of total proteins from the supernatant fractions were blotted with antibody against RPE65. (D, E) The effect of Chaps concentration on the
isomerohydrolase activity of RPE65 was evaluated using in vitro isomerohydrolase assays. Liposomes preloaded with the all-trans-retinyl
ester (50 l
M lipids, 0.66 lM all-trans-retinyl palmitate) were incubated with 500 lg of total proteins from the cells expressing RPE65 in the
presence of 0% (D) or 0.5% (E) Chaps for 2 h. The generated retinoids were analyzed by HPLC, and peaks were identified as follows: 1, ret-
inyl esters; 2, all-trans-retinal; and 3, 11-cis-retinol. (F) Dependence of the isomerohydrolase activity on Chaps concentration was measured
for total cell lysates (4) and Chaps-soluble fractions (
) and plotted. The activity was calculated from the peak areas of the generated
11-cis-retinol in HPLC profiles (mean ± standard deviation, n = 3).
Isomerohydrolase activity of purified RPE65 O. Nikolaeva et al.
3022 FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS
for the following RPE65 purification and enzymatic
assays.
Purification of recombinant RPE65
To facilitate the purification of recombinant chicken
RPE65, a histidine-hexamer tag (6 · His) was fused to
the N-terminus of RPE65 and expressed using
Ad-RPE65 at MOI 500. The recombinant RPE65 was

Purified RPE65 showed isomerohydrolase
activity that was dependent upon association
with liposomes
Although all-trans-retinyl ester has been established as
the substrate of the isomerohydrolase [24], the poor
solubility of hydrophobic all-trans-retinyl ester has his-
torically hindered its use as a substrate for assays of
isomerohydrolase activity. In this study, a novel isom-
erohydrolase activity assay was developed in which all-
trans-retinyl ester was incorporated into liposomes,
and all-trans-retinyl ester-containing liposomes were
then used as the substrate for measuring the isomero-
hydrolase activity of purified RPE65. As shown in
Fig. 5A, incubation of purified RPE65 with the lipo-
somes containing all-trans-retinyl palmitate generated a
1
A
B
C
234 5
1
2
3
4
5
1234 5
RPE65
250
75
37

–nitrilotriacetic acid affinity chromatography. (A) SDS ⁄ PAGE
with Coomassie Brilliant Blue staining. (B) Western blot analysis
with antibody specific for RPE65. (C) Western blot analysis with
antibody specific for the His-tag. Lane 1: total cell lysate. Lane 2:
Chaps-solubilized supernatant after centrifugation at 200 000 g for
1 h. Lane 3: flow-through fraction not bound to the Ni
2+
–nitrilotri-
acetic acid column. Lane 4: purified recombinant chicken RPE65.
Lane 5: bovine RPE microsomal proteins. The amounts of protein
used for SDS ⁄ PAGE were 20 lg for lanes 1, 2, 3, and 5, and 5 lg
for lane 4. For western blot analysis, the amount of protein was
500 ng for each lane.
O. Nikolaeva et al. Isomerohydrolase activity of purified RPE65
FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS 3023
A

1 2 3 4 5 6 P
80
60
kDa
B
D
123456P
80
60
kDa
C
E
Fig. 4. Interaction of purified RPE65 with

densitometry and averaged from three inde-
pendent experiments (mean ± standard
deviation, n = 3).
0
0.5
1.0
1.5
2.0
280 300 320 340 360 380
Absorbance
(1 × 10
–3

AU)
Wavelength (nm)
0255101520
Time (min)
AD
BE
CF
2.5
0
2.0
1.5
1.0
0.5
A320 (1 × 10
–2

AU)

1.2
0.8
1.0
0255101520
Time (min)
0255101520
Time (min)
0
A320 (1 × 10
–2

AU)
1
2
3
4
5
1
2
5
1
2
5
0.6
0.2
1.0
1.0
6
4
2

3024 FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS
significant amount of 11-cis-retinol (Fig. 5A). The
identity of the 11-cis-retinol peak was validated by
recording the UV spectrum during chromatography
(k
max
= 319 nm) (Fig. 5B) and also confirmed by coe-
lution with the 11-cis-retinol standard (data not
shown). As a control, no 11-cis-retinol was generated
when the purified RPE65 was incubated alone in the
absence of the added liposomes (Fig. 5C), suggesting
that the purified recombinant protein did not contain
endogenous all-trans-retinyl ester. To exclude the pos-
sibility that trace amounts of LRAT were copurified
with RPE65, all-trans-retinol was examined as a
substrate. Neither retinyl ester nor 11-cis-retinol was
produced after incubation of all-trans-retinol with the
purified RPE65 (Fig. 5D), confirming that LRAT
activity was absent from the system. This result also
provides further evidence confirming that all-trans-reti-
nol is not an intrinsic substrate for RPE65.
When the liposomes containing all-trans-retinyl
palmitate were incubated in the absence of RPE65, no
11-cis-retinol was generated (Fig. 5E), verifying that
nonspecific thermal isomerization did not occur. Inter-
estingly, in the absence of liposomes, RPE65 did not
generate 11- cis-retinol from nonincorporated all-trans-
retinyl palmitate (Fig. 5F). These results indicate that
association of RPE65 with liposomes containing
the retinyl ester substrate is essential for the efficient

Michaelis constant (K
m
) was 3.7 lm and the turnover
number (k
cat
) was 1.45 · 10
)4
s
)1
for purified RPE65
(Fig. 6C).
11-cis retinol (pmol)
500
600
300
400
100
200
0
0
20 40 60 80 100 120 140
Time (min)
A
B
C
11-cis retinol production
rate (pmol·h
–1
)
250

M lipids, 3.3 lM all-trans-
retinyl ester) were incubated with purified RPE65 (25 lg) for the
indicated time intervals, and the generated 11-cis-retinol was quan-
tified by HPLC. (B) Dependence of isomerohydrolase activity on
RPE65 protein concentration. Various amounts of purified RPE65,
as indicated, were incubated with liposomes (250 l
M lipids, 3.3 lM
all-trans-retinyl palmitate) for 2 h. The 11-cis-retinol generated from
the reaction was calculated from the area of the 11-cis-retinol peak
(mean ± standard deviation, n = 3). (C) Lineweaver–Burk plot of
11-cis-retinol generation by RPE65. Liposomes with increasing
concentrations (S) of all-trans-retinyl palmitate were incubated with
equal amounts of purified RPE65 (25 lg). Initial rates (V)of
11-cis-retinol generation were calculated according to 11-cis-retinol
production recorded by HPLC.
O. Nikolaeva et al. Isomerohydrolase activity of purified RPE65
FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS 3025
Discussion
A key step of the retinoid visual cycle is the conversion
of all-trans-retinyl ester to 11-cis-retinol, which is cata-
lyzed by isomerohydrolase. Although the isomerohy-
drolase activity was first reported over 20 years ago
[25], the enzyme has eluded definite identification until
now. Recently, we and others [16–18] have shown that
cell lysates coexpressing RPE65 and LRAT can gener-
ate 11-cis-retinol from all-trans-retinol, assuming that
the long-sought isomerohydrolase in the visual cycle is
RPE65. As the isomerohydrolase activity has never
been demonstrated in purified RPE65, some research-
ers in this field are still not convinced that RPE65 is

not been purified as a full-length protein. To overcome
this difficulty, the present study established a novel
assay with which to characterize the enzymatic activity
of purified RPE65 by embedding the highly hydropho-
bic substrate – all-trans-retinyl palmitate – into lipo-
somes that serve as a carrier of the substrate to the
enzyme. Our results showed that utilization of liposomes
dramatically enhanced the magnitude of RPE65 iso-
merohydrolase activity.
Solubilization of membrane-associated proteins is
the critical first step in their purification. Although the
amounts of solubilized RPE65 increase with increasing
concentrations of Chaps, higher concentrations of
Chaps also abolished the enzymatic activity of RPE65.
By careful titration, we found that Chaps at a concen-
tration of 0.1% was optimal for solubilizing RPE65
while preserving its catalytic activity. Interestingly,
several previous studies reported that RPE65 efficiently
binds retinyl ester substrate even at 1% Chaps [20,21].
It is likely that high concentrations of Chaps (e.g.
0.5%) may partially disturb the RPE65 conformation,
abolishing its catalytic activity, while leaving its sub-
strate-binding ability intact. In this case, the all-trans-
retinyl ester is probably bound nonproductively and
cannot be converted to 11-cis-retinol. Nonproductive
binding has been previously reported in other enzymes
[28]. Retinyl ester is a hydrophobic substance and does
not freely exchange between membranes [29]. In RPE
cells, retinyl esters are confined either to microsomal
membranes or lipid droplets [30]. It is unlikely that the

could be explained by the presence of lipid-containing
microsomes, which not only served to contain RPE65
Isomerohydrolase activity of purified RPE65 O. Nikolaeva et al.
3026 FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS
in its membrane-bound, active conformation, but
could also allow a small proportion of retinyl ester to
be incorporated into the lipids of the microsomal
membrane to serve as a substrate for RPE65. In con-
trast, the present study was performed using purified
RPE65 in a membrane-free environment. Therefore,
this disparity can be ascribed to the lack of micro-
somal membranes in the present study.
Interestingly, previous attempts to reconstitute
RPE65 in proteoliposomes have been unsuccessful;
that is, isomerohydrolase activity has not been restored
[20]. It is possible that retinyl palmitate incorporated
into liposomes can promote the formation of the
catalytically active conformation of RPE65 upon its
reassociation with liposomes.
The data presented in this article suggest that interac-
tion of RPE65 with lipid membrane is essential for its
isomerohydrolase activity. Previously, it has been pro-
posed that light can regulate RPE65 function, switching
it between inactive soluble and active membrane-associ-
ated forms using a palmitoylation mechanism [32]. At
that time, the authors interpreted RPE65 as a retinyl
ester-binding protein that presents its substrate to an
unknown isomerohydrolase [32]. We assume that the
membrane association is probably essential for extract-
ing highly hydrophobic retinyl ester substrate from the

cat
and K
m
values for the purified RPE65 were determined and
compared with those of the other enzymes that process
retinoids and carotenoids enzymes. The k
cat
value was
calculated to be 1.45 · 10
–4
s
)1
. Although this value
seems low, it is still higher than the k
cat
for the purified
truncated form of LRAT (4.8 · 10
–5
s
)1
) [36]. The k
cat
for full-length LRAT has not been determined, as it
has never been purified. The k
cat
for human b-carotene
oxygenase was reported to be 0.011 s
)1
, which is
75-fold higher than that of RPE65 [37]. However, it

purified RPE65 possesses intrinsic isomerohydrolase
activity, and provides conclusive biochemical evidence
that RPE65 is the isomerohydrolase of the visual cycle.
It also reveals that retinyl ester must be incorporated
into the phospholipid membrane to serve as a sub-
strate for RPE65 isomerohydrolase. This finding opens
new opportunities to study the specificity of RPE65
for modified retinyl esters and to elucidate the chemi-
cal mechanism of the isomerohydrolase reaction.
Experimental procedures
Construction of Ad-RPE65 with a His-tag
The chicken RPE65 cDNA was cloned as described previ-
ously [22]. A DNA sequence encoding a histidine-hexamer
O. Nikolaeva et al. Isomerohydrolase activity of purified RPE65
FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS 3027
(6 · His) was inserted at the N-terminus of the chicken
RPE65 cDNA by PCR, using the following primers: for-
ward primer, 5¢-
GCGGCCGCCACCATGCATCATCACCA
TCACCATTACAGCCAGGTGGAGC-3¢ containing a NotI
site (underlined) and the Kozak sequence (bold); and
reverse primer, 5¢-
AAGCTTCATGCTCTTTTGAAGAGTC
CATGG-3¢, containing a HindIII site (underlined). Prepara-
tion, amplification and titration of the recombinant adeno-
virus (Ad-RPE65) were performed as described previously
[17].
Evaluation of the effect of Chaps concentration
on the efficiency of RPE65 solubilization
Recombinant RPE65 was expressed as described previously

phate, pH 8.0, 100 mm NaCl, 10% glycerol, 0.1% Chaps).
The concentration of the purified RPE65 was determined
by Bradford assay [38].
Western blot analysis
The same amount of total protein (20 lg) was blotted with
antibody against RPE65 (1 : 1000 dilution) or antibody
against His-tag (Sigma-Aldrich, St Louis, MO, USA) as
previously described [24]. The membrane was briefly
washed with the stripping buffer (Pierce, Rockford, IL,
USA) and reblotted with a monoclonal antibody for b-actin
(Abcam, Cambridge, MA, USA) where it was specified
(1 : 2500 dilution). Western blot images were captured with
the imager Chemi-Genius2 (Syngene, Frederick, MD,
USA).
Liposome preparation
All phospholipids used in this study were purchased from
Avanti Polar Lipids (Alabaster, AL, USA). Chloroform
stocks of 1,2-dioleoyl-sn-glycero-3-phosphocholine and
1,2-dilauroyl-sn-glycero-3-phosphocholine were mixed at
85 : 15 (mol ⁄ mol) and supplemented with all-trans-retinyl
palmitate to produce a 75 : 1 lipid ⁄ retinyl ester ratio. l-a-1-
Palmitoyl-2-arachidonyl-phophatidylcholine ([
14
C]PC) was
used to label liposomes in proportions of 0.1 lCiÆmL
)1
.
The organic solvent was removed by argon flow under dim
red light, and the dried lipids ⁄ all-trans-retinyl palmitate film
was dispersed in Buffer R by vortexing. This mixture was

to 200 lL of Buffer R containing 0.5% BSA and 25 lm
Isomerohydrolase activity of purified RPE65 O. Nikolaeva et al.
3028 FEBS Journal 276 (2009) 3020–3030 ª 2009 The Authors Journal compilation ª 2009 FEBS
cellular retinaldehyde-binding protein. After 2 h of incuba-
tion at 37 °C in the dark, the generated retinoids were
extracted with 300 lL of methanol and 300 lL of hexane
and analyzed by normal-phase HPLC as described previ-
ously [24].
Acknowledgements
This study was supported by NIH grants EY012231
and ET015650, grant P20RR024215 from the National
Center for Research Resources, a research award from
JDRF, a grant from ADA, and a research grant from
OCAST HR07-067.
References
1 Baylor D (1996) How photons start vision. Proc Natl
Acad Sci USA 93, 560–565.
2 McBee JK, Palczewski K, Baehr W & Pepperberg DR
(2001) Confronting complexity: the interlink of photo-
transduction and retinoid metabolism in the vertebrate
retina. Prog Retin Eye Res 20, 469–529.
3 Lamb TD & Pugh EN Jr (2004) Dark adaptation and
the retinoid cycle of vision. Prog Retin Eye Res 23,
307–380.
4 Saari JC (2000) Biochemistry of visual pigment regener-
ation: the Friedenwald lecture. Invest Ophthalmol Vis
Sci 41, 337–348.
5 Rando RR (2001) The biochemistry of the visual cycle.
Chem Rev 101, 1881–1896.
6 Rattner A, Smallwood PM & Nathans J (2000) Identifi-

N, Goletz P, Ma JX, Crouch RK & Pfeifer K (1998)
Rpe65 is necessary for production of 11-cis-vitamin A in
the retinal visual cycle. Nat Genet 20, 344–351.
14 Thompson DA & Gal A (2003) Genetic defects in vita-
min A metabolism of the retinal pigment epithelium.
Dev Ophthalmol 37, 141–154.
15 Thompson DA, Gyurus P, Fleischer LL, Bingham EL,
McHenry CL, Apfelstedt-Sylla E, Zrenner E, Lorenz B,
Richards JE, Jacobson SG et al. (2000) Genetics and
phenotypes of RPE65 mutations in inherited retinal
degeneration. Invest Ophthalmol Vis Sci 41
, 4293–4299.
16 Jin M, Li S, Moghrabi WN, Sun H & Travis GH
(2005) Rpe65 is the retinoid isomerase in bovine retinal
pigment epithelium. Cell 122, 449–459.
17 Moiseyev G, Chen Y, Takahashi Y, Wu BX & Ma JX
(2005) RPE65 is the isomerohydrolase in the retinoid
visual cycle. Proc Natl Acad Sci USA 102, 12413–
12418.
18 Redmond TM, Poliakov E, Yu S, Tsai JY, Lu Z & Gen-
tleman S (2005) Mutation of key residues of RPE65 abol-
ishes its enzymatic role as isomerohydrolase in the visual
cycle. Proc Natl Acad Sci USA 102, 13658–13663.
19 Xue L, Jahng WJ, Gollapalli D & Rando RR (2006)
Palmitoyl transferase activity of lecithin retinol acyl
transferase. Biochemistry 45, 10710–10718.
20 Mata NL, Moghrabi WN, Lee JS, Bui TV, Radu RA,
Horwitz J & Travis GH (2004) Rpe65 is a retinyl ester
binding protein that presents insoluble substrate to the
isomerase in retinal pigment epithelial cells. J Biol Chem

pigment epithelial cells: dependence on the specificity of
retinoid-binding proteins. Biochemistry 39, 11370–
11380.
28 Huang WC, Westlake AC, Marechal JD, Joyce MG,
Moody PC & Roberts GC (2007) Filling a hole in cyto-
chrome P450 BM3 improves substrate binding and cata-
lytic efficiency. J Mol Biol 373, 633–651.
29 Ho MT, Pownall HJ & Hollyfield JG (1989) Spontane-
ous transfer of retinoic acid, retinyl acetate, and retinyl
palmitate between single unilamellar vesicles. J Biol
Chem 264, 17759–17763.
30 Imanishi Y, Batten ML, Piston DW, Baehr W &
Palczewski K (2004) Noninvasive two-photon imaging
reveals retinyl ester storage structures in the eye. J Cell
Biol 164, 373–383.
31 Tsilou E, Hamel CP, Yu S & Redmond TM (1997)
RPE65, the major retinal pigment epithelium micro-
somal membrane protein, associates with phospholipid
liposomes. Arch Biochem Biophys 346, 21–27.
32 Xue L, Gollapalli DR, Maiti P, Jahng WJ & Rando
RR (2004) A palmitoylation switch mechanism in the
regulation of the visual cycle. Cell 117, 761–771.
33 Trudel E, Beaufils S, Renault A, Breton R & Salesse C
(2006) Binding of RPE65 fragments to lipid monolayers
and identification of its partners by glutathione S-trans-
ferase pull-down assays. Biochemistry 45, 3337–3347.
34 Jin M, Yuan Q, Li S & Travis GH (2007) Role of
LRAT on the retinoid isomerase activity and membrane
association of Rpe65. J Biol Chem 282, 20915–20924.
35 Takahashi Y, Moiseyev G, Chen Y & Ma JX (2005)