The yeast ubiquitin ligase Rsp5 downregulates the alpha
subunit of nascent polypeptide-associated complex Egd2
under stress conditions
Hiroyuki Hiraishi
1,
*, Takashi Shimada
2,
*, Iwao Ohtsu
1
, Taka-Aki Sato
2
and Hiroshi Takagi
1
1 Graduate School of Biological Sciences, Nara Institute of Science and Technology, Nara, Japan
2 Life Science Research Center, Shimadzu Co., Tokyo, Japan
Introduction
Stress induces protein denaturation, generates abnor-
mal proteins, and leads to growth inhibition or cell
death. Such abnormal proteins are ubiquitinated and
mainly degraded via the proteasome pathway, as indi-
cated by the fact that some ubiquitin-conjugating
enzyme mutants and ubiquitin ligase mutants showed
increased sensitivity to various stresses [1–3]. A few
studies have analysed the degradation system of stress-
induced ubiquitinated proteins using model substrates,
for example mis-folded proteins such as CPY*, a
mutant type of carboxypeptidase Y, or ubiquitin-fused
proteins such as ubiquitinated b-galactosidase [4,5]. It
Keywords
nascent polypeptide-associated complex;
Saccharomyces cerevisiae; stress response;

and the RING-type ubiquitin ligase Not4, respectively, indicating that
ubiquitination of Egd2 is independent of Egd1 and Not4. We also showed
that, under stress conditions, Egd2 was mainly degraded via the protea-
some pathway. These results strongly suggest that Rsp5 is involved in selec-
tive ubiquitination and degradation of stress-induced unstable proteins,
such as Egd2.
Structured digital abstract
l
MINT-7228949: EGD2 (uniprotkb:P38879) physically interacts (MI:0915) with ubiquitin
(uniprotkb:
P61864) by anti-tag co-immunoprecipitation (MI:0007)
Abbreviations
CX, cycloheximide; NAC, nascent polypeptide-associated complex.
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5287
has also been reported that short-lived or long-lived
proteins are degraded by the proteasome or vacuolar
proteolysis pathways, respectively [6], but the detailed
mechanisms underlying these pathways are poorly
understood.
Previously, we isolated a yeast (Saccharomyces cere-
visiae) mutant that is hypersensitive to various stresses,
including toxic amino acid analogues, high growth
temperature in a rich medium, ethanol, LiCl and
H
2
O
2
. This mutant carried a single amino acid change,
replacing Ala (GCA) at position 401 with Glu (GAA)
in the RSP5 allele encoding an essential HECT-type

yeast to human, where it is present as a heterodimer
composed of two subunits (aNAC and bNAC) that
are both in direct contact with nascent polypeptide
chains protruding from the ribosome to protect from
protease attack [13–15]. The yeast genome encodes one
aNAC (Egd2) and two bNAC (Egd1 and Btt1) [16–
18]. Both bNACs can form heterodimeric complexes
with aNAC, although Btt1 is significantly less abun-
dant than Egd1 [19,20]. NAC was thought to be
involved in the mitochondrial import of precursor
proteins by having a stimulatory effect on protein
targeting in vitro [14]. Moreover, the general impor-
tance of NACs is emphasized by the embryonic
lethality of NAC mutants in mice, nematodes (Caenor-
habditis elegans) and fruit flies (Drosophila melanoga-
ster), although deletion of the genes encoding NAC
results in no obvious phenotypes in yeast [21–23].
Recently, it was found that Egd2 was ubiquitinated by
the RING-type E3 ubiquitin ligase Not4 when glucose
was decreased in the growth medium [24]. However, it
remains to be elucidated how ubiquitination of this
complex could contribute to the interaction with ribo-
somes or nascent polypeptides.
To identify the targeted substrates for Rsp5 whose
ubiquitination and subsequent degradation could play
a crucial role in cell survival under severe stress condi-
tions, we performed a proteome analysis of the wild-
type and rsp5 mutant strains using comparative
2D-PAGE and MS. We show that the Egd2 protein is
ubiquitinated by Rsp5 and degraded mainly via the

accumulated to higher levels in the rsp5 mutant cells
than in the wild-type cells under high growth tempera-
ture in a rich medium (Fig. 1A and Table 1). As it is
known that the heat-shock proteins (Hsp12 and
Hsp78) and Sod1 are induced in response to various
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5288 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
stresses, we excluded these proteins from further analy-
sis as candidate substrates of Rsp5 (Fig. 1A). Thus, we
focused on the behavior of other two proteins, i.e.
Egd2 and Pda1 (Fig. 1B). Egd2 was upregulated in the
wild-type cells within 2 h after temperature upshift,
and was subsequently downregulated. However, in the
rsp5 mutant cells, Egd2 was upregulated within 4 h
after temperature upshift, and its level then remained
stable. The protein level of Pda1 in the rsp5 mutant
cells increased in a time-dependent manner compared
with wild-type cells throughout the temperature
upshift.
Identification of substrates of Rsp5 under stress
conditions
Based on the above results showing that some proteins
accumulated in the rsp5 mutant in a stress-dependent
A
B
Egd2
0246 8
(h)
024 6 8
Pda1

20
15
10
250
150
100
75
50
37
25
20
15
10
pH
pH
5.0
8.0
pH
pH
5.0
8.0
Fig. 1. Comparative proteome analysis of yeast cells. (A) Strains CKY8 (wild-type) and CHT81 (rsp5 mutant) were cultured to stationary
growth phase in YPD medium at 25 °C and subjected to a temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Cell extracts were prepared
from the cultures and subjected to 2D-PAGE. The gel patterns represent the cell extracts for each strain after shifting to 37 °C for 6 h. Pro-
teins were visualized using Coomassie brilliant blue G-250. Proteins that accumulate in the rsp5 mutant cells are indicated by arrowheads
and protein names. The positions of molecular mass standards are shown on the left. (B) Time course of the change in Egd2 and Pda1
amounts in strains CKY8 (wild-type) and CHT81 (rsp5 mutant) subjected to temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Histograms
show the protein abundance based on the intensity of bands in the 2D gels indicated by white and black bars for the wild-type and rsp5
mutant strains, respectively.
Table 1. Classification of identified gene products that accumulated in the rsp5 mutant strains under high growth temperature.

the polyubiquitin-conjugated form of Egd2 was clearly
detected in the wild-type cells. However, it seems likely
that little ubiquitination of Egd2 occurred in the rsp5
mutant cells (Fig. 2B).
As Egd2 was shown to be ubiquitinated in the wild-
type cells, but not in the rsp5 mutant cells under stress
conditions, we examined whether or not Rsp5 can
directly ubiquitinate Egd2 at high temperature by an
in vitro ubiquitination assay using Ubc4 and Egd2–HA
as the E2 enzyme and the substrate, respectively
(Fig. 3). In agreement with the results of the in vivo
ubiquitination experiment, more polyubiquitinated
Egd2 was detected in the presence of Rsp5 at 37 °C
than at 25 °C. Moreover, the monoubiquitinated form
of Rsp5 was detected at both temperatures (25 and
37 °C). Taken together, our results show that Egd2 is
ubiquitinated by Ubc4 and then polyubiquitinated in
the presence of Rsp5 under stress conditions such as
high temperature.
Ubiquitination of Egd2 is independent of Egd1
and Not4
Panasenko et al. [24] recently reported that Egd2 and
Egd1, which form a heterodimeric complex named
A
B
0124Time (h)
+CX–CX –CX +CX
25 °C 37 °C
CKE8
(Wild-type)

sera, respectively. The cytosolic Pgk1 protein used as a protein-
loading control was detected using an anti-Pgk1 serum.
Rsp5
Rsp5
Rsp5
Egd2
(Ub)n-Egd2
Egd2
Ubc4
25 °C
37 °C
Fig. 3. In vitro ubiquitination of Egd2 by Rsp5. Purified recombinant
Egd2–HA was incubated with E1, Ubc4, Ub and ATP in the pres-
ence or absence of Rsp5 at 25 or 37 °C. For the negative control,
Egd2–HA or Ubc4 were omitted. Egd2–HA and ubiquitinated
proteins were detected as described in Fig. 2B. The recombinant
His6-tagged Rsp5 proteins were detected using an anti-His serum.
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5290 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
NAC, are ubiquitinated by the RING-type ubiquitin
ligase Not4, particularly when glucose is decreased in
the growth medium. We thus investigated whether
stress-induced ubiquitination of Egd2 might depend on
the presence of Egd1 and Not4 using strains CKE8e1
(egd1D) and CKE8n4 (not4D) expressing Egd2–HA at
25 or 37 °C (Fig. 4A,B). As with wild-type strain
CKE8 cells, polyubiquitination of Egd2 was observed
in cells of both deletion mutants at 37 °C. These
results show that Rsp5-mediated ubiquitination of
Egd2 is independent of Egd1 and Not4 under stress

Conformational changes in proteins caused by post-
translational modifications, such as oxidation [26],
phosphorylation[27] and N-linked glycosylation [28],
are involved in specific recognition by ubiquitin ligase
for ubiquitination of the substrate proteins. These
observations suggest that stress-induced unfolding or
mis-folding of proteins may also be a signal for ubiqui-
tination of denatured proteins that are recognized by
the appropriate ubiquitin ligase. In human cells, block-
ing of the metabolism of mis-folded proteins leads to
the formation of intracellular aggregates, which causes
serious diseases such as neurodegenerative disorders,
B
A
Ub-Egd2
0 30 60 120 30 60 120 0 30 60 120 30 60 120
25 °C 37 °C 25 °C 37 °C
Egd2
Pgk1
CKE8e1
(egd1D)
CKE8
(Wild-type)
Time (min)
0 30 60 120 30 60 120
0 30 60 120 30 60 120
25 °C
37 °C 25 °C 37 °C
Ub-Egd2
Egd2

were cultured to logarithmic growth phase at 25 °C, and incubated
for indicated times in the presence or absence of 0.2 mgÆml
)1
CX
at 25 or 37 °C. Whole-cell extracts were prepared, and the protein
levels of Egd2–HA were examined by western blot analysis using
an anti-HA serum. The cytosolic Pgk1 protein used as a protein-
loading control was detected using an anti-Pgk1 serum.
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5291
including Alzheimer’s disease, Huntington’s disease
and amyotrophic lateral sclerosis [29,30]. These aggre-
gates are ubiquitinated by RING-type ubiquitin ligases
such as Parkin, following active sequestration into ag-
gresomes and autophagic clearance [31]. It is also
reported that U-box- and RING-type ubiquitin ligases
such as CHIP, San1 and Ubr1 are involved in ubiquiti-
nation of denatured proteins under stress conditions
[32–34]. In addition, identification of ubiquitinated
forms of mis-folded proteins by HECT-type ubiquitin
ligase under stress conditions has not been studied pre-
viously. Thus, we focused here on the function of
HECT-type ubiquitin ligase and the degradation mech-
anism of the substrates under stress conditions using
yeast cells.
We previously isolated the yeast HECT-type ubiqu-
itin ligase rsp5 mutant, which shows hypersensitivity to
various stresses that induce protein mis-folding in the
cell, probably because this mutant fails to ubiquitinate
the mis-folded abnormal proteins generated under

ence of CX, Egd2 levels were decreased in both the
wild-type and rsp5 mutant cells. This result suggests
that newly synthesized Egd2, but not already existing
Egd2, accumulates in rsp5 mutant cells. This raises the
possibility that Rsp5 is involved in regulation of the
Egd2 level by either direct or indirect ubiquitination,
regardless of the stress.
Rsp5 has been shown to play a pivotal role in the
nuclear export and modification of mRNA, rRNA and
tRNA [35,36]. Ubiquitination of some mRNA nuclear
transport factors contributes to regulation of this
transport pathway. mRNA export requires that newly
synthesized precursor mRNAs undergo several pro-
cessing steps, which include 5¢-capping, splicing, 3¢-end
cleavage and polyadenylation. The various steps lead-
ing to formation of the ribonucleoprotein complex are
linked, and are often mediated by interactions with the
RNA polymerase II transcription machinery. Recently,
Neumann et al. [37] reported that the rsp5-3 mutant
was strongly impaired in nuclear export of mRNA and
ribosomal 60S subunits after a shift from 25 to 37 ° C.
In addition, tRNA and rRNA export defects in the
rsp5-3 mutant are preceded by severe inhibition of pre-
tRNA and pre-rRNA processing. In our study, how-
ever, there were no significant differences in the levels
of EGD2 mRNA between the wild-type and rsp5 cells
under stress conditions (data not shown). Taking this
account, it appears that Rsp5 does not regulate Egd2
at the transcriptional level, but is involved in post-
translational modifications such as ubiquitination.

Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5292 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
In addition to Rsp5-regulated ubiquitination and
degradation of unstable proteins such as Egd2, the
stress-induced instability of Egd2 might cause its dys-
function, leading to mis-targeting and ⁄ or mis-folding
of mitochondrial proteins in the cell under stress con-
ditions. In addition, it is important to determine
whether or not Egd2 is correctly folded and functions
under stress conditions. Unfortunately, we could not
obtain any direct evidence of mis-folding or denaturing
of the Egd2 protein despite various functional analyses
such as a pulldown assay using glutathione S-transfer-
ase (GST) to detect denatured and inactive forms of
Egd2 under stress conditions. It may be difficult to
prove that Egd2 is inactive under stress conditions
because both Egd2 (aNAC) and Egd1 (b
1
NAC) mole-
cules have low molecular weights and each NAC
domain in the two proteins is also small [45], so that
the unfolded or mis-folded Egd2 proteins might be
folded correctly in the purification or interaction pro-
cess. In the wild-type strain, it is probable that the
ubiquitinated forms of Egd2 are degraded as part of
an adaptive response to stress rather than a conse-
quence of mis-folding in the proteasome, and yeast
cells could acquire stress resistance. In contrast, the
Egd2 proteins in the rsp5 mutant strain might accumu-
late under stress conditions, and yeast cells would

kanMX6 (supplied by K. Kitamura, Center for Gene
Science, Hiroshima University, Japan) [47] was amplified
using oligonucleotide primers EGD2-F2 and EGD2-R1
(Table 3). These PCR fragments were introduced into
strains CKY8 (wild-type) (supplied by C. Kaiser, Depart-
ment of Biology, Massachusetts Institute of Technology,
Cambridge, MA, USA) and YPH500 (wild-type) (supplied
by Yeast Genetic Resource Center, Osaka University,
Japan) or CHT81 (the Ala401Glu rsp5 mutant) [7] and
CMY765 (cim5-1 mutant) (supplied by Yeast Genetic
Resource Center), and strains into which EGD2-3HA-Kan
was integrated were selected as geneticin (G418)-resistant
transformants. The correct integration and expression of
EGD2 were confirmed by PCR, DNA sequencing and
western blot analysis.
To construct pGEX-EGD2HA, the DNA fragment of
EGD2 was amplified by PCR performed using genomic
DNA from CKY8 and oligonucleotide primers EGD2-
EcoRI (+) and EGD2HA-XhoI ()) (Table 3). The unique
amplified band of 565 bp corresponding to EGD2-HA was
Table 2. Yeast strains used in this study.
Strain Genotype References
CKY8 MATa ura3-52 leu2-3, 112 RSP5 [7]
CKE8 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan This study
CKE8e1 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan egd1::URA3 This study
CKE8n4 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan not4::URA3 This study
CHT81 MATa ura3-52 leu2-3, 112 rsp5A401E [7]
CHE81 MATa ura3-52 leu2-3, 112 rsp5A401E EGD2-3HA-Kan This study
YPH500 MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 Yeast Genetic Resource Center
YPH500E MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 EGD2-3HA-Kan This study

Escherichia coli strain JM109 (recA1 endA1 gryA96 thi-1
hsdR17 supE44 relA1 D(lac-proAB) ⁄ F’ [traD36 proAB
+
lacI
q
lacZDM15]) was used as a host for plasmid construc-
tion and the expression of Egd2–HA, Ubc4 and Rsp5.
Culture media
The media used for growth of S. cerevisiae were a nutrient
medium, YPD (2% glucose, 1% yeast extract, 2% peptone)
and a synthetic minimal medium, SD (2% glucose, 0.67%
Bacto yeast nitrogen base without amino acids; Difco
Laboratories, Detroit, MI). Where appropriate, required
supplements were added to the SD medium for auxotrophic
strains. The E. coli recombinant strains were grown in Luri-
a–Bertani complete medium (LB) containing 50 lgÆml
)1
ampicillin or M9 minimal medium plus 2% Casamino acids
(M9CA) containing 50 lgÆml
)1
ampicillin. If necessary, 2%
agar was added to solidify the medium.
Disruption of the NOT4 and EGD1 genes
Complete gene disruption of NOT4 and EGD1 were
performed by gene replacement using homologous recom-
bination [48] to construct strains CKE8n4 and CKE8e1,
respectively. Oligonucleotides used to generate the PCR
products were as follows: NOT4, NOT4disURA3 (+) and
NOT4disURA3 ()); EGD1, EGD1disURA3 (+) and
EGD1disURA3 ()) (Table 3). The correct gene disruptions

EGD1disURA3())
AGTTATTTATTCGACGTCAGCATCAAAAGTTTGACCTTCAACTAACTCTGGAATAGCTTCGTTCTGGCGAGGTATTGGAT
EGD2-EcoRI(+) CCGGAATTCATGTCTGCTATCCCAGAAA
EGD2HA-XhoI()) AATTCTCGAGTTAAGCGTAATCTGGTACGTCGTATTTAGACAAGGACATGATAGCG
UBC4-BamHI(+) CACAGGATCCAGATCCACCTACTTCATGTT
UBC4-XhoI()) CCGCTCGAGCGGGCTTCTCTTTTTCAGCTGAG
UBC4-SmaI(+) AATACCCGGGGATGTCTTCTTCTAAACGTATTGCTAAAGAACTAAGTGATCTAGAAAGAGATCCACCTACTTCATGTT
WW-Sph(+) CAATGCATGCCAGACAATACTCTTCGTTTG
HECT-Pst()) GAACTGCAGAATAATCATTCTTGACCAA
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5294 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
USA). Isoelectric focusing was performed at 5000 V for 16 h
using an isoelectric focusing cell (Bio-Rad). After equilibrat-
ing the strip gel with 2D-PAGE buffer containing 6 m urea,
2% SDS, 2% dithiothreitol, 20% glycerol and bromophenol
blue, 2D-PAGE was performed on an 10-18% gradient gel
and stained using 0.1% Coomassie brilliant blue G-250
solution. Gel images were acquired by using a GS-800
calibrated imaging densitometer (Bio-Rad), and protein spot
quantification was performed using PDQuest software
(Bio-Rad). Individual protein spot intensity was normalized
against the total intensity of detected spots.
Protein identification by MS
Protein spots were listed by quantitative variation of time-
dependent fashion. Selected spots were excised, and reduc-
tive alkylation was performed using 10 mm dithiothreitol
and 100 mm ammonium bicarbonate at 56 °C, followed by
55 mm iodoacetatamide and 100 mm ammonium bicarbon-
ate at room temperature in the dark. After washing off
residual reagent and dehydrating from gel slice, the protein

to SDS–PAGE using a 12.5% acrylamide gel, and trans-
ferred to poly(vinylidene difluoride) membrane for protein
immunoblotting [9]. Blots were visualized by enhanced
chemiluminescence and autoradiography (GE Healthcare).
The 3-phosphoglycerate kinase Pgk1 was used as an inter-
nal control.
Immunoprecipitation
At the indicated times, yeast cells were recovered and
washed, then suspended in Y-PER-S (Pierce) containing
yeast protease inhibitor cocktail, 5 mm dithiothreitol and
5mm N-ethylmaleimide. Whole-cell extracts were pre-
pared by vortexing the cells with glass beads, and diluted
using ice-cold NaCl ⁄ P
i
. The immunoprecipitation assay
was performed according to the manufacturer’s protocol
(Sigma-Aldrich, St Louis, MO, USA). Diluted whole-cell
extracts (40 lg of protein) were incubated with anti-HA
agarose (Sigma) at 4 °C overnight. The immunoprecipitated
samples were recovered after centrifugation (12 000 g,
30 s, 4 °C), and washed four times for 5 min with
NaCl ⁄ P
i
. Immunoprecipitated proteins were eluted from
agarose by incubation in 2· SDS sample buffer for 3 min
at 95–100 °C. The eluted proteins were subjected to SDS–
PAGE and analyzed by immunoblotting as described
above.
Protein purification
E. coli strain JM109 expressing GST-fused Egd2–HA or

We wish to thank Drs Y. Haitani, N. Yoshida, S.
Morigasaki, Y. Hamano and M. Takahashi of our lab-
oratory for discussions on this work. We also thank
Drs K. Kitamura (Center for Gene Science, Hiroshima
University, Japan), C. Kaiser (Department of Biology,
Massachusetts Institute of Technology, Cambridge,
MA, USA) and the Yeast Genetic Resource Center
(Osaka University, Japan) for providing plasmid and
yeast strains. This work was supported by a grant to
H.T. from the Program for Promotion of Basic
Research Activities for Innovative Biosciences (PRO-
BRAIN).
References
1 Jungmann J, Reins HA, Schobert C & Jentsch S (1993)
Resistance to cadmium mediated by ubiquitin-depen-
dent proteolysis. Nature 361, 369–371.
2 Seufert W & Jentsch S (1990) Ubiquitin-conjugating
enzymes UBC4 and UBC5 mediate selective degrada-
tion of short-lived and abnormal proteins. EMBO J 9,
543–550.
3 Fisk HA & Yaffe MP (1999) A role for ubiquitination
in mitochondrial inheritance in Saccharomyces cerevisi-
ae. J Cell Biol 145, 1199–1208.
4 Kohlmann S, Scha
¨
fer A & Wolf DH (2008) Ubiquitin
ligase Hul5 is required for fragment-specific substrate
degradation in endoplasmic reticulum-associated degra-
dation. J Biol Chem 283, 16374–16383.
5 Tu D, Li W, Ye Y & Brunger AT (2007) Structure and

the Rsp5 ubiquitin–protein ligase. Proc Natl Acad Sci
USA 94, 3656–3661.
13 Wiedmann B, Sakai H, Davis TA & Wiedmann M
(1994) A protein complex required for signal-sequence-
specific sorting and translocation. Nature 370, 434–440.
14 Fu
¨
nfschilling U & Rospert S (1999) Nascent polypep-
tide-associated complex stimulates protein import into
yeast mitochondria.
Mol Biol Cell 10, 3289–3299.
15 Rospert S, Dubaquie
´
Y & Gautschi M (2002) Nascent-
polypeptide-associated complex. Cell Mol Life Sci 59,
1632–1639.
16 Shi X, Parthun MR & Jaehning JA (1995) The yeast
EGD2 gene encodes a homologue of the aNAC subunit
of the human nascent-polypeptide-associated complex.
Gene 165, 199–202.
17 Parthun MR, Mangus DA & Jaehning JA (1992) The
EGD1 product, a yeast homolog of human BTF3, may
be involved in GAL4 DNA binding. Mol Cell Biol 12,
5683–5689.
18 Hu GZ & Ronne H (1994) Yeast BTF3 protein is
encoded by duplicated genes and inhibits the expression
of some genes in vivo. Nucleic Acids Res 22, 2740–2743.
19 Reimann B, Bradsher J, Franke J, Hartmann E,
Wiedmann M, Prehn S & Wiedmann B (1999) Initial
characterization of the nascent polypeptide-associated

O’Rourke J, Mole DR, Mukherji M, Metzen E, Wilson
MI, Dhanda A et al. (2001) C. elegans EGL-9 and
mammalian homologs define a family of dioxygenases
that regulate HIF by prolyl hydroxylation. Cell 107,
43–54.
27 Glickman MH & Ciechanover A (2002) The ubiquitin–
proteasome proteolytic pathway: destruction for the
sake of construction. Physiol Rev 82, 373–428.
28 Yoshida Y, Tokunaga F, Chiba T, Iwai K, Tanaka K
& Tai T (2003) Fbs2 is a new member of the E3 ubiqu-
itin ligase family that recognizes sugar chains. J Biol
Chem 278, 43877–43884.
29 McClellan AJ, Tam S, Kaganovich D & Frydman J
(2005) Protein quality control: chaperones culling
corrupt conformations. Nat Cell Biol 7, 736–741.
30 Kaganovich D, Kopito R & Frydman J (2008) Misfold-
ed proteins partition between two distinct quality
control compartments. Nature 454, 1088–1095.
31 Olzmann JA & Chin LS (2008) Parkin-mediated K63-
linked polyubiquitination: a signal for targeting misfold-
ed proteins to the aggresome–autophagy pathway.
Autophagy 4, 85–87.
32 Cyr DM, Ho
¨
hfeld J & Patterson C (2002) Protein
quality control: U-box-containing E3 ubiquitin ligases
join the fold. Trends Biochem Sci 27, 368–375.
33 Gardner RG, Nelson ZW & Gottschling DE (2005)
Degradation-mediated protein quality control in the
nucleus. Cell 120, 803–815.

Cell 103, 1001–1004.
41 Saeki Y, Isono E & Toh-e A (2005) Preparation of
ubiquitinated substrates by the PY motif-insertion
method for monitoring 26S proteasome activity. Meth-
ods Enzymol 399, 215–227.
42 Biederer T, Volkwein C & Sommer T (1996) Degrada-
tion of subunits of the Sec61p complex, an integral
component of the ER membrane, by the ubiquitin–pro-
teasome pathway. EMBO J 15, 2069–2076.
43 George R, Walsh P, Beddoe T & Lithgow T (2002) The
nascent polypeptide-associated complex (NAC) pro-
motes interaction of ribosomes with the mitochondrial
surface in vivo. FEBS Lett 516, 213–216.
44 Grallath S, Schwarz JP, Bo
¨
ttcher UM, Bracher A, Hartl
FU & Siegers K (2006) L25 functions as a conserved
ribosomal docking site shared by nascent chain-associ-
ated complex and signal-recognition particle. EMBO
Rep 7, 78–84.
45 Panasenko CC, David FP & Collart MA (2009) Ribo-
some association and stability of the nascent polypep-
tide-associated complex is dependent upon its own
ubiquitination. Genetics 181, 447–460.
46 Petracek ME & Longtine MS (2002) PCR-based engi-
neering of yeast genome. Methods Enzymol 350, 445–469.
47 Howson R, Huh WK, Ghaemmaghami S, Falvo JV,
Bower K, Belle A, Dephoure N, Wykoff DD, Weiss-
man JS & O’Shea EK (2005) Construction, verifica-
tion and experimental use of two epitope-tagged