Switching of the homooligomeric ATP-binding cassette
transport complex MDL1 from post-translational
mitochondrial import to endoplasmic reticulum insertion
Simone Gompf
1
, Ariane Zutz
1
, Matthias Hofacker
1
, Winfried Haase
2
, Chris van der Does
1
and Robert Tampe
´
1
1 Institute of Biochemistry, Biocenter, Johann Wolfgang Goethe-University, Frankfurt am Main, Germany
2 Max-Planck Institute of Biophysics, Structural Biology, Frankfurt am Main, Germany
ATP-binding cassette (ABC) transporters belong to a
large family of membrane proteins found in all three
kingdoms of life. The chemical energy of ATP is used
to drive uphill transport of a broad range of solutes
across membranes [1–3]. ABC transporters have a
conserved domain organization consisting of two trans-
membrane domains (TMDs) and two nucleotide-bind-
ing domains (NBDs). The TMDs form a translocation
pore, whereas the NBDs catalyze ATP hydrolysis.
The ABC half-transporter multidrug resistance like
protein 1 (MDL1), composed of a TMD followed by a
NBD, is located in the inner mitochondrial membrane
(IMM) of Saccharomyces cerevisiae. It has been sug-

doi:10.1111/j.1742-4658.2007.06052.x
The ATP-binding cassette transporter MDL1 of Saccharomyces cerevisiae
has been implicated in mitochondrial quality control, exporting degradation
products of misassembled respiratory chain complexes. In the present study,
we identified an unusually long leader sequence of 59 amino acids, which
targets MDL1 to the inner mitochondrial membrane with its nucleotide-
binding domain oriented to the matrix. By contrast, MDL1 lacking this lea-
der sequence is directed into the endoplasmic reticulum membrane with the
nucleotide-binding domain facing the cytosol. Remarkably, in both target-
ing routes, the ATP-binding cassette transporter maintains its intrinsic
properties of membrane insertion and assembly, leading to homooligomeric
complexes with similar activities in ATP hydrolysis. The physiological con-
sequences of both targeting routes were elucidated in cells lacking the mito-
chondrial ATP-binding cassette transporter ATM1, which is essential for
biogenesis of cytosolic iron-sulfur proteins. The mitochondrial MDL1 com-
plex can complement ATM1 function, whereas the endoplasmic reticulum-
targeted version, as well as MDL1 mutants deficient in ATP binding and
hydrolysis, cannot overcome the Datm1 growth phenotype.
Abbreviations
ABC, ATP-binding cassette; ATM, ABC transporter of mitochondria; ER, endoplasmic reticulum; 5-FOA, 5-fluoroorotic acid; IMM, inner
mitochondrial membrane; MDL1, multidrug resistance like protein 1; MTS, mitochondrial targeting signal; NBD, nucleotide-binding domain;
SC, synthetic complete; TIM, translocase of the inner mitochondrial membrane; TOM, translocase of the outer mitochondrial membrane;
TMD, transmembrane domain.
5298 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS
Mitochondria contain approximately 800–1500 dif-
ferent proteins [7,8]. Although they include mtDNA
and a transcription ⁄ translation machinery, the vast
majority of mitochondrial proteins are encoded by
nuclear genes and synthesized as precursor proteins on
cytosolic ribosomes [9–13]. Several pathways of mito-

matrix. There the presequence is removed by the mito-
chondrial processing peptidase. Subsequently, IMM
proteins are guided by a hydrophobic sorting sequence
that typically follows the positively charged pre-
sequence [19,20].
In the present study, we addressed the functional
role and physiological consequences of the unusual
long N-terminal leader sequence of MDL1. Full-
length MDL1 is targeted to the IMM, whereas the
leaderless ABC transporter is exclusively inserted into
endoplasmic reticulum (ER) membrane. Despite these
presequence-dependent trafficking routes, the mem-
brane insertion, the complex assembly, and the
ATPase function of MDL1 are preserved. The
physiological consequence of these two targeting
routes is addressed by in vivo complementation in
cells lacking the mitochondrial ABC transporter
ATM1, which is essential for the assembly of cyto-
solic Fe-S proteins.
Results
Targeting of MDL1 to the IMM
It has been postulated that MDL1 is involved in the
export of peptides generated (e.g. from misassembled
mitochondrially encoded respiratory chain subunits)
[4]. Unfortunately, the mechanism and transported
substrate remain largely elusive due to the intrinsic dif-
ficulties in studying mitochondrial export processes.
This is due to the fact that substrates are limited in the
matrix and their concentrations are very difficult to
control experimentally. In addition, substrates are

Post-translational maturation of MDL1
Mitochondrial ABC transporters do not exhibit signifi-
cant sequence similarities in their leader sequences. In
the case of MDL1, several algorithms for the predic-
tion of mitochondrial targeting sequences gave rather
S. Gompf et al. Membrane targeting on demand
FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5299
conflicting results. We therefore set out to examine
the post-translational modification experimentally.
After purification via a C-terminal His-tag from iso-
lated mitochondria (Fig. 2A), N-terminal sequence of
MDL1 was determined by Edman degradation. An
unusually long presequence of 59 amino acids was
identified. The N-terminus (position 2–6) of the iso-
lated, mature ABC transporter (ESDIAQ) matches
perfectly with residue S61 to Q65 (Swiss-Prot: P33310).
Surprisingly, we found that the glutamine expected at
position 60 (the newly generated N-terminus) had been
modified to a glutamate. Sequencing of the expression
construct and comparison with the protein data bank
confirmed the glutamine at position 60. We can further
exclude modifications during purification because
MDL1 was prepared from isolated mitochondria.
Taken together, we identified two post-translational
modifications of MDL1: first, cleavage after residue 59
in the mitochondrial matrix releasing a long prese-
quence and, second, an enzymatic deamidation of the
newly generated N-terminal glutamine to glutamate.
Such modification has been reported for cytosolic
proteins (N-end rule pathway) [24] and for at least two

respectively, was examined by protease protection
A
BC
Fig. 1. Localization of full-length and leader-
less MDL1 in S. cerevisiae. ER and mito-
chondrial membranes were prepared from
cells over-expressing wild-type MDL1 and
leaderless MDL1(60-695) (A) and analyzed
by SDS ⁄ PAGE (10%) and immunoblotting
using antibodies specific for MDL1, the
mitochondrial maker TIM23 and the ER mar-
ker SEC61. Immunogold labeling of sections
through cells over-expressing wild-type
MDL1 (B) and leaderless MDL1(60-695) (C).
Full-length MDL1 is localized in the mito-
chondrial cristae membranes, whereas lead-
erless MDL1 is detected in tubulo-vesicular
membranes belonging to or deriving from
the endoplasmic reticulum. M, mitochon-
dria; N, nucleus; V, vacuole.
Membrane targeting on demand S. Gompf et al.
5300 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS
assays. As expected, MDL1 targeted to the IMM was
resistant to trypsin digestion because it was shielded
by the outer mitochondrial membrane (Fig. 3A). To
determine the orientation of MDL1 in the IMM,
mitoplasts and inverted IMMs were prepared and
assayed for protease cleavage. A factor Xa cleavage
site was engineered at the C-terminus of MDL1 before
the His8-tag. Thus, if the C-terminus is accessible to

20 lgÆg
)1
wet weight of yeast in both cases (Fig. 2).
After isolation from different cellular compartments,
we investigated complex formation of MDL1 by gel fil-
tration. Each fraction was subsequently analyzed by
SDS ⁄ PAGE and immunoblotting (Fig. 4A). The mito-
chondrial as well as ER-resident MDL1 forms homo-
oligomeric complexes of similar size. The broad
distribution is rather typical for digitonin solubilized
ABC transport complexes. Notably, no protein aggre-
gates were detected at the exclusion volume. Other
detergents resulted in MDL1 complexes, which rapidly
lost their ATPase activity [28]. To demonstrate that
the broad distribution is not due to misfolding, we per-
formed an alternative approach, where we investigated
the oligomeric state of MDL1 by Blue-Native electro-
phoresis (Fig. 4B). Full-length and leaderless MDL1
solubilized from yeast membranes migrate as defined
bands at approximately 250 kDa, which corresponds
to a homodimeric complex, as resolved by single parti-
cle electron microscopy analysis [28]. In summary,
MDL1 forms a homodimeric complex independent of
its subcellular targeting.
The ATPase activity of ABC half-transporters is
critically dependent on the complex formation. We
therefore compared the ATPase activity of MDL1 tar-
geted to different cellular compartments (Fig. 5A,B).
Mitochondrial MDL1 isolated from total membranes
was active in ATP hydrolysis with a K

)1
(per
monomer). To exclude the possibility that the activity
is caused by contaminating ATPases, we expressed and
purified two MDL1 variants (E599Q and H631A),
each of which has a disrupted catalytic dyad.
MDL1(E599Q) and MDL1(H631A) show no ATPase
activity above background but are active in ATP bind-
ing [28]. We further examined whether MDL1 show
similar sensitivity towards vanadate inhibition in both
targeting routes. As shown in Fig. 5C,D, the ATPase
activity of MDL1 purified from mitochondria or ER
membranes was inhibited in a dose-dependent manner
by ortho-vanadate. Comparable to other ABC trans-
porters [29–31], the IC
50
values of 0.86 mm and
1.1 mm were determined for the mitochondrial and
ER-resident MDL1, respectively. Taken together, full-
length and leaderless MDL1 are comparable in respect
to assembly of homooligomeric complexes, ATPase
activity, and vanadate inhibition.
A
C
B
Fig. 3. Membrane orientation of mitochon-
drial and ER-resident MDL1. Mitochondrial
(A) and ER fractions (C) (30 lg each) con-
taining wild-type MDL1 and leaderless
MDL1(60-695), respectively, were incubated

immunoblotting using anti-MDL1 serum.
Apoferritin (443 kDa), b-amylase (200 kDa),
alcohol dehydrogenase (150 kDa), and
albumin (66 kDa) were used as markers.
Membrane targeting on demand S. Gompf et al.
5302 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS
Uptake assays with isolated microsomes
containing MDL1
Leaderless MDL1 is targeted to ER membranes, where
the NBDs of the homooligomeric complex are oriented
to the cytosol. In this orientation, the ATP level and
substrates can effectively be controlled. To identify the
MDL1 substrate, we screened combinatorial peptide
libraries of different length X
n
(n ¼ 5–8, 11, 17, and
23, where X represents an equimolar distribution of all
19 amino acids except cysteine). These libraries have
been instrumental in deciphering the substrate specific-
ity of several eukaryotic and prokaryotic ABC trans-
porters [21,23,32,33]. In addition, we analyzed a set of
defined peptides expected to be a putative substrate of
MDL1. These include, for example, N-formylated pep-
tides or fragments of mitochondrially encoded gene
products, which have been identified as minor antigens
[34]. Systematic uptake assays with these peptidic sub-
strates, however, showed no MDL1-specific transport
activity, suggesting that MDL1 may be not a general
peptide transporter such as TAP or TAP-like, but
most likely transports a very specific or even modified

Most mitochondrial proteins are synthesized by free
ribosomes in the cytosol. Once released into the cyto-
plasm with an N-terminal MTS, these preproteins are
imported into the mitochondria post-translationally
[39]. MTS usually consists of 20–35 residues and is
highly degenerated in primary sequence, but is rich in
basic, hydrophobic and hydroxylated residues and
Fig. 5. ATPase activity and vanadate inhibi-
tion of purified MDL1. ATPase activities
were measured as a function of ATP
concentration for 10 min at 30 °C with
0.5 l
M of purified protein. MDL1 (A) and
MDL1(60-695) (B) showed Michaelis–
Menten kinetics with a K
m ATP
of
120 ± 6 l
M and 200 ± 1 lM and a k
cat
of
74 ± 1 ATPÆmin
)1
and 77 ± 1 ATPÆmin
)1
(per MDL1 monomer), respectively.
Inhibition of ATPase activity of MDL1 (C)
and MDL1(60-695) (D) by different
concentrations of ortho-vanadate (given in
l

In the present study, we addressed the functional
role of the unusually long leader sequence of MDL1 in
its subcellular targeting and physiological conse-
quences. By contrast to the full-length protein, which
is efficiently imported into mitochondria, leaderless
MDL1 is exclusively targeted to ER membranes.
Fig. 6. Physiological function of MDL1 vari-
ants analyzed by in vivo complementation.
Datm1 ⁄ ATM1 + MDL1 cells were plated on
SCD without uracil and tryptophan and used
for replica plating. Selection plates contain-
ing 5-FOA were incubated at 30 °C for
7 days. MDL1 can complement the severe
growth defect of Datm1 cells, whereas
mutants K473A, E599Q, H631A, inactive in
ATP binding or hydrolysis, as well as
MDL1(60-695) do not show complementa-
tion of ATM1. MDL1(Cys-less) is able to
take over the function of ATM1 and do not
affect growth.
Membrane targeting on demand S. Gompf et al.
5304 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS
Protease accessibility assays demonstrated that the
NBDs of the ER-resident transporter are oriented to
the cytosol. The localization is not influenced by addi-
tional C- or N-terminal His-tags either for full-length
or leaderless MDL1.
To exclude that full-length and leaderless MDL1
have different activities, the proteins were purified to
homogeneity (Fig. 2). Remarkably, full-length and

[21,23,32,33,41]. In addition, defined peptides favored
by the homologous TAP complex, such as the peptide
RRYQKSTEL, are not transported by MDL1.
Recently, a peptidic fragment, named COXI, of a
mitochondrially encoded subunit of the cytochrome
oxidase was identified to be presented on MHC class I
molecules of murine cells [42]. It was suggested that
COXI is transported from the matrix to the cytosol,
where the peptide is funneled into the pathway of
MHC class I antigen processing [34,43]. Thus,
N-terminal 7-, 9- and 12-mer fragments of COXI were
analyzed for an MDL1-dependent transport activity.
However, no uptake was detected. Taken together,
these findings suggest that MDL1, if indeed a peptide
transporter, is highly specific for a small set of peptides
or even modified peptides largely under-represented in
the peptide libraries. These systematic studies point to
an intriguing possibility that MDL1 may require addi-
tional factors for substrate transfer. Such factors may
be absent in uptake studies or in the libraries used.
Similar ATPase activities prove that the NBDs of both
MDL1 variants are correctly folded, although it can-
not be excluded that their TMDs are influenced by the
lipid compositions of the corresponding membranes.
Based on the important role of ATM1 in the biogen-
esis of cytosolic Fe-S proteins, Datm1 cells show a
severe growth phenotype. When Datm1 ⁄ ATM1 cells
are forced to loose the plasmid-encoded ATM1 (URA3
marker) by growth on 5-fluoroorotic acid (5-FOA),
Datm1 cells are almost nonviable. Multicopy expres-

finding attests that the physiological function of the
ABC transporter MDL1 is intimately linked to its
correct targeting to the IMM.
Experimental procedures
Materials
A rabbit polyclonal antibody was generated against the
C-terminal 15 amino acids (KGGVIDLDNSVAREV) of
MDL1 from S. cerevisiae.
Cloning and expression of MDL1
The MDL1 gene from S. cerevisiae was divided into three
cassettes, separated by a newly generated silent ClaI restric-
tion site at S221 and the endogenous BamHI site at K422
S. Gompf et al. Membrane targeting on demand
FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5305
[28]. Cassette I includes the N-terminal part of the TMD
(M1 to A220), cassette II the C-terminal part of the TMD
(S221 to K422), and cassette III the NBD of MDL1 (D423
to V695). Furthermore, leaderless MDL1 (cassette IB, Q60
to A220) was generated. The different cassettes of MDL1
were amplified from genomic DNA (for sequences of the
primers, see Table 1). The corresponding PCR fragments
were cloned downstream of the GAL1-promoter in the
pYES2.1 ⁄ V5-His-TOPOÒ expression vector (Invitrogen,
Carlsbad, CA, USA) resulting in plasmids pMDL1 and
pMDL1(60-695). Using primers p1C(f) and p3(r), a similar
approach was applied to insert an N-terminal His10-tag fol-
lowed by leaderless MDL1 (60-695) resulting in pMDL1(60-
695,His). pMDL1(His), comprising four glycines, a
factor Xa cleavage site, and a His8-tag downstream of
MDL1, was generated with primers p1(f) and p3B(r).

glutardialdehyde. After 2 h, the fixative was exchanged for
cacodylate buffer containing decreasing concentrations of
sorbitol (0.5, 0.25, 0 m; three times 10-min incubation for
each concentration). Cells were treated with 1% sodium
meta-periodate, washed in water, and incubated in 0.05 m
NH
4
Cl. After 12 h, cells were washed again and enclosed in
agar-agar, which then was cut into small slices and passed
through increasing concentrations of ethanol for dehydra-
tion. Samples were stepwise infiltrated with LR White resin
Table 1. Primers used for generating MDL1 constructs. f, forward primer; r, reverse primer; mut, mutagenesis primer (exchanged bases
underlined).
Primer Sequence Site
a
p1(f) GGTACCACTAGTGCCGCCACCATGGTTGTAAGAAT KpnI, SpeI, NcoI
GATACGTCTTTGTAAAGG
p1B(f) GCCGCCACCATGCAATCAGACATTGCGCAAGGAAA
GAAGTCC
p1C(f) GCCGCCACCATGCACCATCACCATCACCATCACCAT
CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC
p1(r) GGCCACTATCGATGCATCAGATG ClaI
p2(f) CATCTGATGCATCGATAGTGGCC ClaI
p2(r) GTGTTTGGGCCGAGTGGGAT BamHI
b
p3(f) GCCATTGATTCGTCCGACTA BamHI
b
p3(r) TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT XbaI, HindIII
GTCC
p3B(r) TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG XbaI, HindIII

glycine; NaCl ⁄ Pi; NaCl ⁄ Pi containing 1% BSA, 0.1%
Tween 20, NaCl ⁄ Pi, 0.1% BSA, 0.05% Tween 20. Sections
were incubated with the anti-MDL1 serum. After removal
of unbound antibodies, sections were incubated with sec-
ondary goat anti-rabbit serum coupled to gold particles
(diameter of 10 nm). Carefully washed slices were briefly
treated with 1% glutardialdehyde in NaCl ⁄ Pi and, after
contrasting with uranyl acetate and lead citrate, prepara-
tions were analyzed by electron microscopy (EM 208S, FEI
Company, Eindhoven, the Netherlands).
Blue-Native PAGE
Total membranes (10 mgÆmL
)1
) were solubilized in digito-
nin buffer [20 mm Tris ⁄ HCl pH 7.4, 50 mm NaCl, 10%
(v ⁄ v) glycerol, 1 mm EDTA, 1 mm phenylmethanesulfonyl
fluoride, 1% (w ⁄ v) digitonin (Calbiochem, Darmstadt, Ger-
many)] for 1 h at 4 °C under gentle rotation. Loading dye
(10 mm Bis-Tris pH 7, 50 mm e-amino-n-caproic acid, 5%
(w ⁄ v) Coomassie Blue (G) was added to solubilized mate-
rial after ultracentrifugation (100 000 g, 30 min, 4 °C) [28].
Blue-Native electrophoresis (gradient 6.0–16.5%) was per-
formed as previously described [50]. Apoferritin (443 kDa),
b-amylase (200 kDa), alcohol dehydrogenase (150 kDa),
and albumin (66 kDa) were used as markers.
Limited trypsin digestion and factor Xa cleavage
To determine the membrane orientation of MDL1 in iso-
lated organelles, 15 lg of organelles were incubated for
15 min on ice with increasing concentrations of trypsin (up
to 0.1 mgÆmL

-High-Trap Chelating column
(GE Healthcare, Piscataway, NJ, USA) equilibrated with
buffer B (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl, 15%
(v ⁄ v) glycerol, 2 m m imidazole, 0.1% (w ⁄ v) digitonin).
After washing with buffer B containing 80 and 160 mm
imidazole, the protein was eluted in buffer B containing
400 mm imidazole.
Gel filtration
Full-length and leaderless MDL1 were analyzed by gel fil-
tration on a Superdexä 200 PC 3.2 (GE Healthcare) equili-
brated with SEC buffer (20 mm Tris ⁄ HCl pH 8.0, 150 mm
NaCl and 0.1% (w ⁄ v) digitonin); 60 lg of protein was
loaded at a flow rate of 50 lLÆmin
)1
.30lL fractions were
collected and analyzed by SDS ⁄ PAGE and immunoblotting
using anti-MDL1 serum. Ferritin (443 kDa), b-amylase
(200 kDa), and BSA (70 kDa) in SEC buffer without deter-
gent were used for calibration.
ATPase assays
The ATPase activity was essentially determined as described
[31]. 20 mm dithiothreitol was added to 1 lm purified
MDL1. The reaction was started by addition of ATP con-
taining buffer (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl,
20 mm MgCl
2
, 0.1% (w ⁄ v) digitonin, 10 mm ATP traced
(370 000 : 1) with [c-
32
P]ATP (specific activity 110 TBqÆ

S. Gompf et al. Membrane targeting on demand
FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5307
centrifugation at 20 000 g for 15 min, the radioactivity of the
supernatant was measured by b -counting in the presence of
2 mL scintillation fluid. Data were fitted to a dose–response
equation and the half-maximal inhibitory concentration
(IC
50
) was calculated (Eqn 1).
activity ½%¼
100%
1 þ
orthoÀvanadate ½lM
IC
50
½lM

ð1Þ
Peptide transport
Combinatorial peptide libraries and defined peptides were
generated on a robot system by solid phase chemistry using
Fmoc [N-(9-fluorenyl) methoxycarbonyl] amino acids, as
previously described [41]. Peptides and peptide libraries were
radiolabeled and peptide transport was analyzed as described
[53] with the following modifications: microsomes (75 lgof
total protein) of the yeast strain Y06425 (BY4741; Mat a;
his3D1; leu2D0; met15D0; ura3D0; YLL048c::kanMX4),
expressing MDL1(60-695), were incubated with 1 lm
125
I-labeled peptides, 3 mm ATP or 5 U apyrase in 50 lLof

sity, Institute of Microbiology, Frankfurt, Germany) for
kindly providing yeast strains. We thank Dr Peter Ko
¨
t-
ter for helpful discussions regarding yeast genetics. This
work was supported by the Deutsche Forschungsgeme-
inschaft (DFG) ) SFB472 Molecular Bioenergetics.
References
1 Holland BI, Cole S, Kuchler K & Higgens C (2002)
ABC Proteins ) From Bacteria to Man. Academic Press,
London.
2 Davidson AL & Chen J (2004) ATP-binding cassette
transporters in bacteria. Annu Rev Biochem 73, 241–268.
3 Schmitt L & Tampe
´
R (2002) Structure and mechanism
of ABC transporters. Curr Opin Struct Biol 12, 754–760.
4 Young L, Leonhard K, Tatsuta T, Trowsdale J & Lan-
ger T (2001) Role of the ABC transporter Mdl1 in pep-
tide export from mitochondria. Science 291, 2135–2138.
5 Chloupkova M, LeBard LS & Koeller DM (2003)
MDL1 is a high copy suppressor of ATM1: evidence
for a role in resistance to oxidative stress. J Mol Biol
331, 155–165.
6 Lill R & Kispal G (2000) Maturation of cellular Fe-S
proteins: an essential function of mitochondria. Trends
Biochem Sci 25, 352–356.
7 Sickmann A, Reinders J, Wagner Y, Joppich C, Zahedi
R, Meyer HE, Schonfisch B, Perschil I, Chacinska A,
Guiard B et al. (2003) The proteome of Saccharomyces

mitochondrial targeting peptides. Protein Eng 4, 33–37.
18 Hendrick JP, Hodges PE & Rosenberg LE (1989)
Survey of amino-terminal proteolytic cleavage sites in
Membrane targeting on demand S. Gompf et al.
5308 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS
mitochondrial precursor proteins: leader peptides
cleaved by two matrix proteases share a three-amino
acid motif. Proc Natl Acad Sci USA 86, 4056–4060.
19 Glick BS, Brandt A, Cunningham K, Muller S, Hall-
berg RL & Schatz G (1992) Cytochromes c1 and b2 are
sorted to the intermembrane space of yeast mitochon-
dria by a stop-transfer mechanism. Cell 69, 809–822.
20 Stuart R (2002) Insertion of proteins into the inner
membrane of mitochondria: the role of the Oxa1 com-
plex. Biochim Biophys Acta 1592, 79–87.
21 Uebel S, Kraas W, Kienle S, Wiesmu
¨
ller KH, Jung G &
Tampe
´
R (1997) Recognition principle of the TAP
transporter disclosed by combinatorial peptide libraries.
Proc Natl Acad Sci USA 94, 8976–8981.
22 Urlinger S, Kuchler K, Meyer TH, Uebel S & Tampe
´
R
(1997) Intracellular location, complex formation, and
function of the transporter associated with antigen pro-
cessing in yeast. Eur J Biochem 245, 266–272.
23 Wolters JC, Abele R & Tampe

Both P-glycoprotein nucleotide-binding sites are catalyt-
ically active. J Biol Chem 270, 26956–26961.
30 Urbatsch IL, Sankaran B, Weber J & Senior AE (1995)
P-glycoprotein is stably inhibited by vanadate-induced
trapping of nucleotide at a single catalytic site. J Biol
Chem 270, 19383–19390.
31 Gorbulev S, Abele R & Tampe
´
R (2001) Allosteric cross-
talk between peptide-binding, transport, and ATP
hydrolysis of the ABC transporter TAP. Proc Natl Acad
Sci USA 98, 3732–3737.
32 Detmers FJ, Lanfermeijer FC, Abele R, Jack RW,
Tampe
´
R, Konings WN & Poolman B (2000) Combina-
torial peptide libraries reveal the ligand-binding mecha-
nism of the oligopeptide receptor OppA of Lactococcus
lactis. Proc Natl Acad Sci USA 97, 12487–12492.
33 Doeven MK, Abele R, Tampe
´
R & Poolman B (2004)
The binding specificity of OppA determines the selectiv-
ity of the oligopeptide ATP-binding cassette transporter.
J Biol Chem 279 , 32301–32307.
34 Fischer Lindahl K, Hermel E, Loveland BE & Wang
CR (1991) Maternally transmitted antigen of mice: a
model transplantation antigen. Annu Rev Immunol 9,
351–372.
35 Smith PC, Karpowich N, Millen L, Moody JE, Rosen J,

Wiesmu
¨
ller KH & Tampe
´
R (1995) Requirements for
peptide binding to the human transporter associated
with antigen processing revealed by peptide scans and
complex peptide libraries. J Biol Chem 270, 18512–
18516.
42 Morse MC, Bleau G, Dabhi VM, Hetu F, Drobetsky
EA, Lindahl KF & Perreault C (1996) The COI mito-
chondrial gene encodes a minor histocompatibility anti-
gen presented by H2-M3. J Immunol 156, 3301–3307.
43 Herget M & Tampe
´
R (2007) Intracellular peptide
transporters in human ) compartmentalization of the
‘peptidome’. Pflugers Arch 453, 591–600.
44 Brachmann CB, Davies A, Cost GJ, Caputo E, Li J,
Hieter P & Boeke JD (1998) Designer deletion strains
derived from Saccharomyces cerevisiae S288C: a useful
S. Gompf et al. Membrane targeting on demand
FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5309
set of strains and plasmids for PCR-mediated gene dis-
ruption and other applications. Yeast 14, 115–132.
45 Sherman F (1991) Getting started with yeast. Methods
Enzymol 194, 3–21.
46 Palsdottir H & Hunte C (2003) Purification of cyto-
chrome bc1 complex from yeast. In Membrane Protein
Purification and Crystallization: A Practical Guide

R (2003) Peptides induce
ATP hydrolysis at both subunits of the transporter asso-
ciated with antigen processing. J Biol Chem 278, 29686–
29692.
54 Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987)
5-Fluoroorotic acid as a selective agent in yeast mole-
cular genetics. Methods Enzymol 154 , 164–175.
Membrane targeting on demand S. Gompf et al.
5310 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS