Transient silencing of Plasmodium falciparum
bifunctional glucose-6-phosphate dehydrogenase)
6-phosphogluconolactonase
Almudena Crooke
1,
*, Amalia Diez
1
, Philip J. Mason
2,†
and Jose
´
M. Bautista
1
1 Department of Biochemistry and Molecular Biology IV, Universidad Complutense de Madrid, Facultad de Veterinaria, Madrid, Spain
2 Haematology Department, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London, UK
Malaria is a major health hazard in tropical and sub-
tropical areas around the world. In Africa alone, every
year over a million children under the age of 5 years
die of malaria and around 300–500 million people are
infected by the parasite [1,2]. Added to this, the
appearance of parasites resistant to antimalarial drugs
is on the increase and it is not proving easy to develop
an efficient vaccine against Plasmodium falciparum.
There is thus a need for new therapeutic targets.
The sequencing of the P. falciparum genome [3–5]
has revealed a large amount of molecular information.
This information, coupled to microarray mRNA ana-
lysis [6,7] and specific expression proteomic analysis of
the parasite’s developmental stages [8], is allowing the
molecular exploration of new strategies to fight against
malaria.

2006, accepted 10 February 2006)
doi:10.1111/j.1742-4658.2006.05174.x
The bifunctional enzyme glucose-6-phosphate dehydrogenase-6-phospho-
gluconolactonase (G6PD-6PGL) found in Plasmodium falciparum has
unique structural and functional characteristics restricted to this genus.
This study was designed to examine the effects of RNA-mediated PfG6PD-
6PGL gene silencing in cultures of P. falciparum on the expression of para-
site antioxidant defense genes at the transcription level. The highest degree
of G6PD-6PGL silencing achieved was 86% at the mRNA level, with a
recovery to almost normal levels within 24 h, indicating only transient
diminished expression of the PfG6PD-6PGL gene. PfG6PD-6PGL silencing
caused arrest of the trophozoite stage and enhanced gametocyte formation.
In addition, an immediate transcriptional response was shown by thiore-
doxin reductase suggesting that P. falciparum G6PD-6PGL plays a physio-
logical role in the specific response of the parasite to intracellullar oxidative
stress. P. falciparum transfection with an empty DNA vector also promoted
intracellular stress, as determined by mRNA up-regulation of antioxidant
genes. Collectively, our findings point to an important role for this enzyme
in the parasite’s infection cycle. The different characteristics of G6PD-
6PGL with respect to its homologue in the host make it an ideal target for
therapeutic strategies.
Abbreviations
C
T
, cycle threshold; FeSOD, iron superoxide dismutase; G6PD-6PGL, glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase; GPx,
glutathione peroxidase; GR, glutathione reductase; PPP, pentose phosphate pathway; TrxR, thioredoxin reductase.
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1537
the functions of the malaria parasite and for structural
differences with respect to their human homologues, is
a research strategy aimed at finding potential specific

infected ones, and the parasite PPP is responsible for
82% of this activity [13,18].
Plasmodium falciparum G6PD-6PGL could therefore
be a potential therapeutic target not only because of
its structural characteristics that make it different from
its human equivalent, but also because of the import-
ance of this enzyme in the parasite’s intraerythrocyte
stage [16]. The present paper describes the effects of
G6PD-6PGL silencing in P. falciparum, confirming the
key role of this enzyme in the intraerythrocyte stage of
infection.
Results
Effects of PfG6PD-6PGL gene silencing on growth
and parasite development
In a first attempt at silencing the G6PD-6PGL gene,
erythrocytes infected with ring-stage P. falciparum 3D7
(pyrimethamine-sensitive clone) were electroporated
with pHC1G6 PD-AS (expressing antisense RNA) and
the empty vector pHC1 as control. In addition, silen-
cing by dsRNA was also attempted by transfecting
ring-stage parasites with a dsRNA–G6PD duplex using
water and dsRNA–Rab5a as controls. Figure 1 shows
the parasite’s morphology in the different transfected
cultures.
After 24 h, all electroporated P. falciparum cultures
(wild-type, pHC1, pHC1G6 PD-AS, dsRNA-G6PD
and dsRNA–Rab5a) showed a 77–83% reduction in
parasitaemia, in agreement with previously reported
data [19]. As shown in Fig. 1A, control cultures elec-
troporated with water were apparently normal, with

pHC1 and pHC1G6 PD-AS electroporated cultures
subjected to pyrimethamine pressure mainly appeared
to be at the trophozoite or gametocyte stage (Fig. 1C–
D; Table 1). Although this effect is most probably
attributable to pyrimethamine acting on the nontrans-
fected parasite population [20,21], we cannot preclude
the possibility of some abnormal stage forms due to
the presence of the vector itself.
As shown in Table 2, parasitaemia levels of the
pHC1 and pHC1G6 PD-AS parasites exposed to pyri-
methamine determined at 48 h, indicated that 23–25%
of the parasites had acquired resistance to pyrimeth-
amine mediated by the transfected vectors. This resist-
ance decreased to 5–6% at 96 h without further
reduction.
In the P. falciparum cultures electroporated with
dsRNA or water (control culture), in the absence of
pyrimethamine pressure, similar parasitaemia levels
were observed in the course of one complete intra-
erythrocyte cycle (Table 3). Alterations to the cycle
were not observed in any of the dsRNA electroporated
cultures whose growth was synchronized for the entire
24 h (Table 3). In addition, as shown in Fig. 1E–F, no
morphological changes were observed in control cul-
tures electroporated with water or with the duplex
dsRNA–Rab5a. In contrast, the cultures electro-
porated with dsRNA-G6PD (Fig. 1G) showed clear
morphological changes in about 50% of the parasites,
mostly abnormal trophozoites, whereas the morphol-
ogy of the remaining 50% trophozoites was apparently

Incubation time for
pyrimethamine (h)
Parasitaemia
(%)
a
Segregation
(%)
b
pHC1 0 8.05 ± 0.62 100 ± 7.66
48 1.99 ± 0.53 25 ± 6.00
96 0.52 ± 0.16 6 ± 2.22
pHC1G6 PD-AS 0 9.73 ± 0.54 100 ± 5.59
48 2.16 ± 0.19 23 ± 8.12
96 0.47 ± 0.06 5 ± 1.33
a
To determine parasitaemia, about 10 000 erythrocytes were
examined and the number of infected erythrocytes was reported as
percentage of the total.
b
The level of parasitaemia after (48 and
96 h) and before (0 h) pyrimethamine pressure was used as a
quantitative measure of plasmid segregation (expressed as a per-
centage).
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1539
PCR (Fig. 2). Also, the effect of the presence of intra-
cellular pHC1G6 PD-AS was analyzed by quantitative
mRNA expression analysis of G6PD-6PGL and of
several key genes involved in defense against oxidative
stress after 48 or 96 h of pyrimethamine pressure:

parasite antioxidant response.
Table 3. Multiplication rate and stage-specific development of parasites transfected with dsRNA. The results of the parasitaemia, ring and
trophozoite assays are expressed as the means and standard deviations of three independent experiments. nd, not detected.
Culture Time post-transfection (h) Parasitaemia (%)
a
Rings (%) Trophozoites (%)
b
Wild-type 3 2.82 ± 1.36 96.03 ± 5.61 3.97 ± 5.61
24 3.82 ± 0.69 6.63 ± 9.38 93.37 ± 9.38
dsRNA–Rab5a 3 1.64 ± 1.55 98.35 ± 2.33 1.65 ± 2.33
24 2.50 ± 2.11 nd 100
dsRNA-G6PD 3 2.31 ± 2.06 98.54 ± 2.06 1.46 ± 2.06
24 3.34 ± 0.83 3.32 ± 4.69 96.69 ± 4.69
a
To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as
percentage of the total. Stage-specific development was assessed by counting the fractions of rings, trophozoites and schizonts. No
schizonts were detected at the indicated time points.
b
Fifty percent of trophozoites detected in the dsRNA-G6PD cultures were abnormal
(but not pyknotic).
200 bp
100 bp
200 bp
M
AB123
100 bp
M 1234
Fig. 2. High intracellular expression capacity of the pHC1G6 PD-AS vector. Total RNA from WT and pHC1G6 PD-AS parasites were RT-PCR
amplified and the products examined on ethidium bromide-stained agarose gels. (A) Expression of the PfG6PD-6PGL gene noncoding strand:
lane M, 100 basepair ladder molecular weight marker; lane 1, pHC1G6 PD-AS parasites subjected to 48 h of pyrimethamine pressure; lane

Discussion
To assess the capacity of a gene or its product to act
as an antimalaria target, its role in the biology of the
parasite needs to be well established. For this purpose,
several systems for the functional analysis of P. falci-
parum genes have been developed including gene silen-
cing by antisense RNA [23], or more recently, by
Fig. 3. Effect of pHC1G6 PD-AS on parasite mRNA. Quantifying
G6PD-6PGL, GR, TrxR, FeSOD and GPx mRNA levels by qRT-PCR
in parasites, transfected with pHC1 and pHC1G6 PD-AS vectors,
obtained at the indicated time points during the course of pyrimeth-
amine pressure. Expression level data for each gene obtained from
parasites transfected with the pHC1G6 PD-AS vector were normal-
ized to the 18S rRNA signal (internal control) and the normalized
values of control parasites (transfected with pHC1) were set at 1.
Error bars represent the standard deviations of the means obtained
in three replicate assays.
A
B
Fig. 4. Oxidative stress gene up-regulation by the presence of
pHC1 derived vectors. Gene expression analysis by real-time RT-
PCR of G6PD-6PGL, GR, TrxR, FeSOD and GPx from pHC1 and
WT water electroporated parasites at 48 and 96 h (pyrimethamine
pressure was only applied to pHC1 transfected parasites). The norm-
alized number of genome equivalents was determined using the
18 s rRNA gene as internal control. In this experiment, a control
culture under pyrimethamine pressure was included in parallel, with
no significant mRNA expression signal detected at 48 and 96 h.
Error bars represent the standard deviations of the means obtained
in three replicate assays.

used in other protozoan and mammalian cells [28–30].
In P. falciparum, antisense RNA has also been success-
fully applied to silencing the PfCLAG9 gene [23],
inhibiting PfCLAG9 mRNA translation and diminish-
ing cytoadherence of the protein to melanoma cells (a
function associated with this protein). Since our con-
struct expresses high levels of the selection marker and
the antisense RNA strand, the in vivo activity of both
promoters (P. falciparum calmodulin and Plasmodium
chabaudi dihydropholate reductase) and the stability of
their mRNAs was observed under our experimental
conditions.
Parasites transfected with the antisense RNA-G6PD-
6PGL vector showed reduced mRNA-G6PD-6PGL
expression at 48 h and there was a simultaneous reduc-
tion in TrxR, GR, GPx and FeSOD transcripts. After
96 h, G6PD-6PGL silencing persisted at a slightly
higher level, but the expression of the other four anti-
oxidant genes was restored. This could be the combined
outcome of two effects: a loss or diminished number of
copies of the vector in some parasites due to low segre-
gation competence [31,32], and stress to the parasite
caused by the vector itself. This last effect is suggested
by the up-regulation of these genes observed at 96 h in
control transfections with pHC1 (lacking an insert), as
indicated by reduced parasitaemia levels and increased
levels of mRNA for the antioxidant genes in the pHC1
transfected cultures at 96 h. The discordant effects
detected at 96 h in cultures transfected with vectors
containing or lacking an insert indicate that after 48 h,

of control cultures, while the cultures transfected with
dsRNA-G6PD showed morphological alterations in
about 50% of the trophozoites, suggesting that what
we are looking at is a genuine effect of inhibited
G6PD-6PGL expression causing cell stress. Moreover,
this effect is appreciable at the stage of highest meta-
bolic activity, the trophozoite stage. In the early
stages (3 h), dsRNA-G6PD was highly effective at
silencing, decreasing mRNA levels by up to 86%.
Nevertheless, this silencing was transient, since after
24 h, mRNA levels had almost recovered. It should
be noted that the G6PD-6PGL silencing experiment-
ally produced at the ring stage corresponds in clinical
isolates to the time at which the highest amounts of
G6PD-6PGL transcripts are shown [42]. Silencing of
parasite G6PD-6PGL in rings caused cell stress, indu-
cing the up-regulation of TrxR by sevenfold. This
induction of the thioredoxin system against oxidative
stress has been previously described in Streptomyces
coelicolor and Bacillus subtilus subjected to oxidative
stress [43,44]. An important role of thioredoxin is to
reduce ribonucleotide reductase. P. falciparum TrxR is
able to reduce thioredoxin, which together with per-
oxyredoxins, transforms peroxides and also helps to
reduce oxidized glutathione [9]. If the lack of G6PD-
6PGL produces lower reduction equivalents, increas-
ing TrxR to counteract this effect would require
Transient silencing of G6PD-6PGL A. Crooke et al.
1542 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS
NADPH from alternative sources, as has been sugges-

sette expresses the inserted antisense mRNA driven by the
P. falciparum calmodulin promoter and terminated by the
3¢-untraslated region of P. falciparum heat shock protein 86
[48]. The antisense direction of the G6PD-6PGL fragment
inserted with respect to the calmodulin promoter, was con-
firmed by plasmid DNA NdeI digestion. Parental plasmid
pHC1, lacking the G6PD-6PGL fragment was used as a
transfection control. Plasmid DNAs were purified (Plasmid
Maxi Kit, Qiagen, Chatsworth, CA, USA) from overnight
Escherichia coli cultures.
A 21 basepair dsRNA (sense: UACAUCAUGCACCAA
CGAAdTdT; antisense: UUCGUUGGUGCAUGAUGUA
dTdT) was designed for the target sequence (UACAUCA
UGCACCAACGAA) of the G6PD-6PGL gene, follow-
ing Dharmacon siDESIGN Center criteria (http://design.
dharmacon.com/). In addition, a dsRNA corresponding to
the PfRab5a gene (GenBankÔ accession number AE001399)
(target sequence: UAUGCAAGUAUUGUCCCAC; sense:
UAUGCAAGUAUUGUCCCACdTdT; antisense: GUGG
GACAAUACUUGCAUAdTdT) was also designed to use
as control. All dsRNAs were obtained from Dharmacon
Research (Lafayette, CO, USA) in annealed and lyophilized
forms and were suspended in RNase-Dnase-free water
before use.
Parasite cultures and electroporation
P. falciparum 3D7 (pyrimethamine-sensitive strain) was
grown and double synchronized using standard procedures
[49,50]. Parasites (ring stage 8–10% parasitaemia) were
transfected by electroporation with 100–150 lg of purified
plasmid DNA or 40 lg of dsRNA as described [19]. The

GTGTTCCCC-3¢;3¢Pfg6pd,5¢-GGTTGTGAAGAAAT
GGAAGAAGTAC-3¢) for further PCR amplification by
adding forward primers (5¢Tgdhfr-ts,5¢-GAAGGAGCTG
TCGTGCATCAT-3¢;5¢Pfg6pd,5¢-GATTCATACAATT
CCTCGTCTGAG-3¢). For real-time transcript quantifica-
tion by molecular beacons, cDNA was obtained using spe-
cific reverse primers and qRT-PCR was performed in an
ABI Prism 7000 Sequence Detector (Applied Biosystems).
Sequence design of molecular beacons and primers for
G6PD-6PGL, Fe-SOD, GR, TrXR, GPx and 18S-rRNA
quantitative transcription analysis was performed according
to a previously published procedure [51]; these designs are
provided in Table 4. The qRT-PCR involved 1 cycle each
of 50 °C ⁄ 2 min and 95 °C ⁄ 10 min, followed by 45 cycles of
57 °C ⁄ 1 min, 95 °C ⁄ 30 s, and 45 °C ⁄ 29 s. All analyses were
run in triplicate. An 18S-rRNA signal was used as endo-
genous control to normalize mRNA relative expression
[42,51–54]. Cycle threshold (C
T
) was defined as the frac-
tional PCR cycle number at which the fluorescent signal is
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1543
greater than the minimal detection level. Standard curves
were prepared for all targets and endogenous references,
using genomic DNA concentrations and their correspond-
ing C
T
. For each experimental sample, the amounts of
target and 18S-rRNA were calculated from the standard

Educ Program) 35–57.
3 Bowman S, Lawson D, Basham D, Brown D, Chilling-
worth T, Churcher CM, Craig A, Davies RM, Devlin
K, Feltwell T et al. (1999) The complete nucleotide
sequence of chromosome 3 of Plasmodium falciparum.
Nature 400, 532–538.
4 Gardner MJ, Tettelin H, Carucci DJ, Cummings LM,
Aravind L, Koonin EV, Shallom S, Mason T, Yu K,
Fujii C et al. (1998) Chromosome 2 sequence of the
human malaria parasite Plasmodium falciparum. Science
282, 1126–1132.
5 Gardner MJ, Hall N, Fung E, White O, Berriman M,
Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman
S et al. (2002) Genome sequence of the human malaria
parasite Plasmodium falciparum. Nature 419, 498–511.
6 Bozdech Z, Zhu J, Joachimiak MP, Cohen FE, Pulliam B
& DeRisi JL (2003) Expression profiling of the schizont
Table 4. Primers and molecular beacon probe sequences for real-time RT-PCR. All probes were labelled at the 5¢ end with 6-carboxy-fluorescein (FAM). TAMRA was used as the 3¢
quencher. RT-PCR, reverse transcription PCR.
Gene
GenBank
Ò
accession No. Forward Primer (5¢-to3¢) Reverse Primer (5¢-to3¢) Molecular Beacon (5¢-to3¢)
Pf18srRNA (M19172) TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCC
PfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG
PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG
PfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG
PfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG
PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG
Transient silencing of G6PD-6PGL A. Crooke et al.

lactonase: A novel bifunctional enzyme in malaria para-
sites. Eur J Biochem 268, 2013–2019.
14 Scopes DA, Bautista JM, Vulliamy TJ & Mason PJ
(1997) Plasmodium falciparum glucose-6-phosphate
dehydrogenase (G6PD) – the N-terminal portion is
homologous to a predicted protein encoded near to
G6PD in Haemophilus influenzae. Mol Microbiol 23,
847–848.
15 Kurdi-Haidar B & Luzzatto L (1990) Expression and
characterization of glucose-6-phosphate dehydrogenase
of Plasmodium falciparum. Mol Biochem Parasitol 41,
83–91.
16 Clarke JL, Sodeinde O & Mason PJ (2003) A unique
insertion in Plasmodium berghei glucose-6-phosphate
dehydrogenase-6-phosphogluconolactonase: evolutionary
and functional studies. Mol Biochem Parasitol 127 , 1–8.
17 Pizzi E & Frontali C (2001) Low-complexity regions in
Plasmodium falciparum proteins. Genome Res 11, 218–
229.
18 Atamna H, Pascarmona G & Ginsburg H (1994) Hex-
ose-monophosphate shunt activity in intact Plasmodium
falciparum-infected erythrocytes and in free parasites.
Mol Biochem Parasitol 67, 79–89.
19 Wu Y, Sifri CD, Lei HH, Su XZ & Wellems TE (1995)
Transfection of Plasmodium falciparum within human
red blood cells. Proc Natl Acad Sci USA 92, 973–977.
20 Waterkeyn JG, Crabb BS & Cowman AF (1999) Trans-
fection of the human malaria parasite Plasmodium falci-
parum. Int J Parasitol 29, 945–955.
21 O’Donnell RA, Freitas-Junior LH, Preiser PR, William-

28 Bracha R, Nuchamowitz Y & Mirelman D (2000)
Inhibition of gene expression in Entamoeba by the tran-
scription of antisense RNA: effect of 5¢- and 3¢-regula-
tory elements. Mol Biochem Parasitol 107, 81–90.
29 Chen DQ, Kolli BK, Yadava N, Lu HG, Gilman-Sachs
A, Peterson DA & Chang KP (2000) Episomal expres-
sion of specific sense and antisense mRNAs in Leishma-
nia amazonensis: modulation of gp63 level in
promastigotes and their infection of macrophages
in vitro. Infect Immun 68, 80–86.
30 Zhang X, Chen Z, Chen Y & Tong T (2003) Delivering
antisense telomerase RNA by a hybrid adenovirus ⁄ ade-
no-associated virus significantly suppresses the malig-
nant phenotype and enhances cell apoptosis of human
breast cancer cells. Oncogene 22 , 2405–2416.
31 van Dijk MR, Waters AP & Janse CJ (1995) Stable
transfection of malaria parasite blood stages. Science
268, 1358–1362.
32 O’Donnell R, Preiser PR, Williamson DH, Moore PW,
Cowman AF & Crabb BS (2001) An alteration in con-
catameric structure is associated with efficient segrega-
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1545
tion of plasmids in transfected Plasmodium falciparum
parasites. Nucleic Acids Res 29, 716–724.
33 Ngo H, Tschudi C, Gull K & Ullu E (1998) Double-
stranded RNA induces mRNA degradation in Trypano-
soma brucei. Proc Natl Acad Sci USA 95, 14687–14692.
34 Misquitta L & Paterson BM (1999) Targeted disrup-
tion of gene function in Drosophila by RNA interfer-

G6PD-6PGL in laboratory parasites and in patient iso-
lates in G6PD-deficient and normal Nigerian children.
Br J Haematol 122, 662–668.
43 Paget MS, Kang JG, Roe JH & Buttner MJ (1998) Sig-
maR, an RNA polymerase sigma factor that modulates
expression of the thioredoxin system in response to oxi-
dative stress in Streptomyces coelicolor A3 (2). EMBO
J 17, 5776–5782.
44 Nakano S, Kuster-Schock E, Grossman AD & Zuber P
(2003) Spx-dependent global transcriptional control is
induced by thiol-specific oxidative stress in Bacillus sub-
tilis. Proc Natl Acad Sci USA 100, 13603–13608.
45 Werner C, Stubbs MT, Krauth-Siegel RL & Klebe G
(2005) The crystal structure of Plasmodium falciparum
glutamate dehydrogenase, a putative target for novel
antimalarial drugs. J Mol Biol 349, 597–607.
46 Bozdech Z & Ginsburg H (2005) Data mining of the
transcriptome of Plasmodium falciparum: the pentose
phosphate pathway and ancillary processes. Malar J 4,
17.
47 Campanale N, Nickel C, Daubenberger CA, Wehlan
DA, Gorman JJ, Klonis N, Becker K & Tilley L (2003)
Identification and characterization of heme-interacting
proteins in the malaria parasite, Plasmodium falciparum.
J Biol Chem 278, 27354–27361.
48 Crabb BS, Triglia T, Waterkeyn JG & Cowman AF
(1997) Stable transgene expression in Plasmodium falci-
parum. Mol Biochem Parasitol 90, 131–144.
49 Trager W & Jensen JB (1976) Human malaria parasites
in continuous culture. Science 193, 673–675.