TbPDE1, a novel class I phosphodiesterase of
Trypanosoma brucei
Stefan Kunz
1
, Thomas Kloeckner
2
, Lars-Oliver Essen
3,
*, Thomas Seebeck
1
and Michael Boshart
2
1
Institute of Cell Biology, University of Bern, Switzerland;
2
Department of Biology I, University of Munich, Germany;
3
Max Planck Institute for Biochemistry, Martinsried, Germany
Cyclic nucleotide specific phosphodiesterases (PDEs) are
important components of all cAMP signalling networks.
In humans, 11 different PDE families have been identified to
date, all of which belong to the class I PDEs. Pharmaco-
logically, they have become of great interest as targets for the
development of drugs for a large variety of clinical condi-
tions. PDEs in parasitic protozoa have not yet been exten-
sively investigated, despite their potential as antiparasitic
drug targets. The current study presents the identification
and characterization of a novel class I PDE from the para-
sitic protozoon Trypanosoma brucei, the causative agent of
human sleeping sickness. This enzyme, TbPDE1, is encoded
by a single-copy gene located on chromosome 10, and it

In mammals, 11 distinct class I PDE families have been
identified, based on DNA sequence analysis and on the
pharmacological profiles of the enzymes [10,11]. At the
amino acid level, family members exhibit > 50% sequence
identity within a conserved catalytic core of about 250
amino acids. Between families, the sequence identity drops
to 30–40% in the same region [12], and no significant
similarity is found outside the catalytic domain.
Considering the importance of the PDEs for signal
transduction, it is not unexpected that mutations in PDE
genes have been recognized as the underlying cause of
several genetic diseases [13–15]. In clinical pharmacology,
the PDEs have also become highly attractive targets for
drug development, and a large number of highly family-
specific inhibitors have been developed. PDE inhibitors are
under exploration, or already in clinical use, for ailments as
diverse as autoimmune diseases, arthritis, asthma, impo-
tency and as anti-inflammatory agents (reviewed in
[16–18]).
In view of the spectacular success of PDE inhibitors as
chemotherapeutics, it is surprising how little effort has been
made so far to explore the PDEs of parasites as potential
targets for antiparasitic drugs. The African trypanosome
Trypanosoma brucei is the protozoon that causes the fatal
human sleeping sickness, as well as Nagana, a devastating
disease of domestic animals in large parts of sub-Saharan
Africa. While many aspects of trypanosome cell biology
have been extensively studied, very little is still known about
cAMP signalling [19–22]. Early work has shown that the
steady-state concentration of cAMP varies during the life

with these sequence data, TbPDE1 is also pharmacologi-
cally quite distinct from its mammalian counterparts, as
judged from its sensitivity to a number of established PDE
inhibitors. Finally, TbPDE1 is a nonessential enzyme under
culture conditions or during the midgut infection of tsetse
flies, as was demonstrated earlier with deletion mutants for
this gene [29].
Materials and methods
Materials
5-Fluoroorotic acid monohydrate was from American
Bioorganics. SuperTaq polymerase was from Anglia Bio-
tech. Benzamidine, antipain, leupeptin, phenylmethane-
sulfonyl fluoride, and Ba(OH)
2
solution (Cat. number
14-3) were from Sigma. Adenosine-3,5¢-cyclic monophos-
phate and adenosine-5¢-monophosphate were from Roche
Molecular. The radiochemicals [2,8-
3
H]adenosine-3¢5¢-cyclic
monophosphate (25–40 · 10
10
BqÆmmol
)1
)and[
3
H]adeno-
sine-5¢-monophosphate (15–30 · 10
10
BqÆmmol

2l plasmid with the repressible MET25 promotor and the
URA3 selection marker. The cloning site of this plasmid
was derived from pBS SK(–) (Stratagene). The cDNA
library was inserted via the XhoIandEcoRI sites, and the
MET25 promotor (381 bp) was introduced between the
XbaIandtheSacI sites. Yeast transformation was carried
out exactly as described [36]. Transformants were grown
for 3 days on selective medium lacking methionine and
uracil (SC–met–ura) to maintain the plasmid and to
derepress the expression of the cDNA. In order to select
for complementation, the transformants were replica-plated
onto plates prewarmed to 55 °C and incubated at this
temperature for 15 min. Plates were then cooled and
incubated at 30 °C for 3 days. Heat-shock resistant colon-
ies were rescreened for heat-shock sensitivity. Patches were
replica-plated onto YPD plates prewarmed to 55 °C, and
the heat shock was continued for 15 min. After cooling the
plates to room temperature, they were incubated for
2–3 days at 30 °C. Candidate clones were subjected to
segregation analysis, and positive plasmids were finally used
to retransform PP5-12 in order to confirm the phenotype
carried by the plasmid.
Direct PCR screening of plasmids
Screening of large numbers of yeast colonies for the
presence of a plasmid insert was done by a rapid PCR
procedure. Colonies were picked and grown at 30 °Cin
5 mL selective medium to high density (18–24 h). Cell
culture (1.5 mL) was pelleted and resuspended in 100 lL
H
2

for reverse transcription (RT), and a mini-exon primer M4
(5¢-GGGAATTCCGCTATTATTAGAACAGTTTCT-3¢,
added EcoRI site shown in bold) together with the
TbPDE1-specific antisense primer 16-SP14 (5¢-AGC
AGTTTGAAGCATTG-3¢) for amplification. The prod-
ucts were cloned via the EcoRI site in the M4 primer and
an internal XbaI site, and they were analysed by
sequencing.
638 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004
Expression of TbPDE1 in
S. cerevisiae
The ORF of TbPDE1 was cloned into the pLT1 expression
vector. This vector was derived from p425CYC1 by
replacing the CYC1 promotor by the much stronger
TEF2 promotor [35] followed by the original Kozak
sequence 5¢-CTAAAC-3¢ and a start codon. The complete
TbPDE1 ORF was expressed either containing a His
6
tag
at its N terminus, or a His
6
tagfollowedbyahaemag-
glutinin tag to facilitate detection of the recombinant
protein. Transformants were selected on synthetic minimal
medium containing 0.67% (w/v) yeast nitrogen base
without amino acids (DIFCO) and 2% (w/v) glucose,
supplemented with an amino acid mixture lacking leucine
(SC–leu).
For the preparation of lysates from cells expressing
TbPDE1, yeast cells grown to mid- to end-log phase in

Thr620) was amplified from of T. brucei 927 genomic DNA
(kindly provided by S. Melville, Cambridge University)
using Takara Taq polymerase (BioWhittaker) and 30 cycles
of 30 s at 94 °C, 2 min at 58 °C and 5 min at 72 °C. For
amplification, the primer pairs 5¢-GGGAATTCCATA
TGCTTGAGGCTTTGCGAAAGTGCCCGACCATGT
TTG-3¢ (NdeI site in bold) and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ (XhoI
site in bold) were used. The resulting 1.86-kbp fragment was
subsequently cloned into the NdeI/XhoI-cut expression
vector pET28a (Novagen; kanamycin-resistance marker),
resulting in plasmid pET-PDE1. Two gene fragments
coding for N-terminally truncated fragments of TbPDE1
were also amplified using the same protocol and pET-PDE1
as template. PDE1(Arg189–Thr620) was amplified using the
primer pairs 5¢-GGGAATTCCATATGAGAGACAATA
TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and
PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG
AATTCCATATGAAGAATGATCAATCTGGCTGCG
GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG
TTCCCTGTCCAGTGTTACC-3¢. The resulting DNA
fragments (1.29 and 0.90 kbp) were digested with NdeI
and XhoI and cloned into pET-28a. The constructs pET-
PDE1, pET-PDE1(R189–T620) and pET-PDE1(K321–
T620) were verified by DNA sequencing.
Expression and purification of full-length
and truncated PDE1/His
6
-fusion proteins

M
isopropyl thio-b-
D
-galactoside and
were shaken at 25 °C for a further 4 h. Cells were
harvested by centrifugation and washed once in NaCl/P
i
.
The washed cell pellet was frozen in liquid nitrogen and
stored at )70 °C. For protein purification, the frozen cell
pellet was suspended in 1/40–1/30 of culture volume in
extraction buffer [50 m
M
Na/phosphate buffer, pH 7.0,
300 m
M
NaCl, 5 m
M
MgCl
2
, 0.1% (v/v) Tween-20]
containing a protease inhibitor cocktail (CompleteÒ,
Roche Molecular Biochemicals). Cells were lysed by
sonication (four pulses of 15 s with intermittant cooling
in an ice/water bath). The lysate was clarified by
centrifugation at 16 000 g for 20 min at 4 °C. Of the
supernatant, 1.2 mL were added to a tube containing
250 lLbedvolumeofTalonÒ resin (Clontech) preequili-
brated with extraction buffer. The tube was rotated for
30 min on a rotary shaker at 4 °C. The resin was then

M
and were then pooled. Finally, the purified protein
was mixed with an equal volume of 50% (v/v) glycerol,
0.2% (v/v) Tween-20, 5 m
M
MgCl
2
, and aliquots were
shock-frozen in liquid nitrogen and stored at )70 °C.
Protein concentrations were determined using the Brad-
ford reagent (Bio-Rad) and BSA as a standard.
Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 639
PDE assays
PDE activity was assayed by a modification of the
procedure of Schilling et al. [37] as described [26]. All assays
were performed at 30 °Cin25m
M
Tris/HCl, pH 7.4,
0.5 m
M
EDTA, 0.5 m
M
EGTA, 10 m
M
MgCl
2
and using
1 l
M
[

 a
cAMP
Þ
=ða
cAMP
ðq
AMP
À q
cAMP
ÞÞ
where C
cAMP
is the cAMP substrate concentration, a
cAMP
is
the total activity used in the enymatic reaction, a
probe
is the
total radioactivity on the filter, and q
cAMP
and q
AMP
are the
precipitation efficiencies of cAMP and AMP, respectively.
In all experiments, < 20% of the substrate was hydrolysed,
and all data points were taken in triplicate or quadruplicate.
For inhibitor studies, the test compounds were dissolved in
H
2
O or dimethylsulfoxide. The dimethylsulfoxide concen-

such mutants were isolated and analysed for their genetic
stability. The clone with the lowest reversion frequency,
PP5-12, was used for further experiments.
PP5-12 was transformed with the cDNA library, and
% 24 000 transformants were recovered after Ura
+
selec-
tion. Transformants were replica-plated onto SC–met–ura
plates preheated to 55 °C and were incubated at 55 °Cfor
15 min. Plates were then cooled and incubated at 30 °Cfor
3 days. An exploratory screen had revealed a high frequency
(0.5%) of spontaneous heat-shock resistant revertants. The
120 heat-shock resistant colonies were thus individually
retested, and 109 of them that still proved heat-resistant
were analysed further. Segregation analysis and retransfor-
mation of individual plasmids into PP5-12 resulted in a
single plasmid, pBa46, which confered heat-shock resistance
upon back-transformation into PP5-12. pBa46 was found
to contain a cDNA fragment representing most of the ORF
(amino acids Met159 through the stop codon after Thr620)
and 210 bp of the 3¢-untranslated region of a novel PDE
gene of T. brucei, TbPDE1.
Cloning and genomic organization of TbPDE1
While the complementation screen was ongoing, a DNA
fragment coding for a protein kinase A-related gene
(TbPKAC3) was isolated from a genomic phage library of
T. brucei (N. Wild and M. Boshart, unpublished results).
Upon sequencing beyond the 3¢-untranslated region of
TbPKAC3, an ORF of 620 amino acids (TbPDE1)was
identified that encompassed the cDNA sequence contained

of T. brucei (see Materials and methods) and because an
allelic polymorphism in the TbPDE1 locus was also detected
by BamHI restriction enzyme analysis (Fig. 1).
The trans-splicing site at the 5¢-end of the TbPDE1
transcript was mapped by RT-PCR using two nested gene-
specific primers and a primer directed to the conserved mini-
exon sequence present at the 5¢-end of all trypanosomal
mRNAs. Seven out of eight such cDNA clones contained
the mini-exon splice site at position )159 relative to the
translational start, and one clone at position )155. Both
sites were preceded by an AG dinucleotide and a long
polypyrimidine stretch immediately upstream (Fig. 2A).
These results demonstrated that the intergenic region
between TbPKAC3 and TbPDE1 is only 117–135 bp long,
as the 3¢-end of theTbPKAC3-transcript had previously
been mapped by RT/PCR (T. Kloeckner, unpublished
results). The oligo-A stretch at the 3¢-end of cDNA clone
pBa46 most likely represents the beginning of the polyA tail
of the TbPDE1 mRNA since no corresponding oligoA
stretch is found in the genomic sequence, and since poly
pyrimidine-rich stretches which are typically located
upstream from the polyadenylation sites of other trypano-
somal mRNAs [38] were found upstream of this site
(Fig. 2B).
TbPDE1 mRNA is expressed in the bloodstream
and in the procyclic life cycles stages
According to the mapped transcript ends, TbPDE1 should
give rise to an mRNA of approximately 2.5 kb. This was
detected in Northern blots using RNA from three different
life cycle stages of T. brucei, long-slender and short-stumpy

ORF is underlined and shown in bold type. (B) 3¢-Untranslated region
of TbPDE1. The end of the ORF is underlined and shown in bold type.
A polypyrimidine tract upstream of the poly(A) addition site is indi-
cated by black dots. The poly(A) addition site is marked with an
asterisk. The complete DNA sequence of the TbPDE1 locus was
submitted to GenBank under the accession number AF253418.
(C) Northern blot hybridized with a TbPDE1-specific riboprobe using
10 lg total RNA per lane. LS, Long-slender forms purified from
rodent blood; SS, short-stumpy forms; PC, procyclic culture forms
derived from short-stumpy forms by in vitro differentiation. RNA size
markersinareindicatedontheleft(kb).
Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 641
regA gene of Dictyostelium or the trypanosomal TbPDE2
family (Fig. 5). The lowest degree of sequence identity was
found with the mammalian PDEs 2 and 6 (< 30% identity),
while the highest degree of sequence identity was found with
the PDEs 1, 3 and 4 (> 40% identity). Using the standard
sequence homology criteria to define PDE families [12],
TbPDE1 clearly represents a new family of the class I of
PDEs. The status of a new family is also supported by the
observation that no sequence similarity with other PDEs is
detected outside the catalytic domain, either with mamma-
lian PDEs or with the trypanosomal TbPDE2 family.
Outside of the catalytic domain, sequence similarity decrea-
ses, within 10–40 amino acids at the N-terminal side of the
domain, and within 15 amino acids at its C-terminal side.
Expression of TbPDE1 in
S. cerevisiae
The successful complementation screening in yeast indicated
that recombinant TbPDE1 is enzymatically active. In

642 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004
PDE deletion strain PP5, and its Ura
–
derivative PP5-12,
exhibit extensive clumping when grown in SC medium
(Fig. 6B). When complemented by a heterologous PDE
(TbPDE1 or human PDE4A), clumping was significantly
reduced (Fig. 6B). The overall experience with expressing
different fragments of several different PDEs (TbPDE1, the
TbPDE2 family [26], and human PDE4A) suggested that
the extent of clumping of the S. cerevisiae PP5 strain
correlates inversely with the extent of recombinant PDE
activity (unpublished results).
Despite the functional complementation observed in
intact yeast cells, no significant PDE catalytic activity could
be detected in yeast cell extracts. In contrast, control lysates
from yeast cells that expressed either human PDE4A or
trypanosomal TbPDE2A [26] from the same yeast vector
plasmid pLT1 showed high levels of PDE catalytic activity.
To determine if the very low level of TbPDE1 activity might
be due to instability of the recombinant protein, a full-size
TbPDE1 construct was expressed which contained a
haemagglutinin-tag at its N terminus. This tagged protein
fully rescued the heat-shock phenotype, was detectable by
immunoblotting and was stable throughout cell breakage
and PDE assay. Nevertheless, no enzyme activity could
be detected. These observations indicate that TbPDE1 is
expressed in S. cerevisiae at levels that are sufficient to
produce a clear phenotype (heat-shock resistance, growth as
a smooth suspension), but that are too low to be detectable

length TbPDE1 containing an N-terminal His
6
tag; pLTBoris, amino
acids Arg189–Thr620 of TbPDE1, containing an N-terminal His
6
tag; pHisPDEcat1, catalytic core (Phe347–Phe578) containing an
N-terminal His
6
tag; pLT1, empty expression vector pLT1; pLC-h6.1,
full length human PDE4. (B) Clumping of the PDE-deletion strain
PP5-12 and suppression of clumping by the expression of a PDE.
Yeast cultures were grown for 24 h at 30 °C on a rotary wheel and
were photographed immediately after removal from the wheel. 1, His
6
taggedfull-lengthTbPDE1;2,pLTBoris;3,pBa46;4,pHisPDEcat1;
5, empty expression vector pLT1; 6, pLC-h6.1 (full-length human
PDE4A4B). All cultures grew to approximately the same cell density.
(C) Map of TbPDE1 regions expressed by the various constructs.
Numbers indicate first and last amino acid expressed by each con-
struct. Grey box: catalytic core region of TbPDE1.
Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 643
Thr620) produced an inactive protein which was found in
inclusion bodies exclusively. This was not unexpected since
this construct most likely lacks a considerable part of the
catalytic domain and thus may be unable to fold correctly.
In the initial experiments, the specific activity of recom-
binant TbPDE1 (Arg189–Thr620) was consistently very
low, and the enzyme was highly unstable. While the net yield
of soluble enzyme could be considerably improved by
growing the cells in TB medium instead of Luria–Bertani

ions, but enzyme preparations inactivated by the prior
removal of Mg
2+
could not be reactivated by either cation
(see above). Although Mn
2+
stimulated the activity
more strongly, 10 m
M
Mg
2+
wasusedasthecationin
all subsequent experiments. The recombinant enzyme
(Arg189–Thr620) displayed standard Michaelis–Menten
kinetics, as observed for other PDEs (Fig. 8A). An unex-
pected finding was the high K
m
of TbPDE1 for its substrate
cAMP (Fig. 8A). An exact K
m
value was difficult to
determine as the assay procedure became unreliable at
substrate concentrations beyond 1 m
M
, and thus did not
allow measurement at substrate concentrations far beyond
K
m
. Nevertheless, the combined results of many independ-
ent determinations place the K

, i.e., far below K
m
,
so that the 50% inhibitory concentrations (IC
50
) approxi-
mate K
i
. Most of the inhibitors tested showed essentially no
effect on the activity of TbPDE1 (Table 1 and Fig. 9). The
few that exhibited significant potency were sildenafil, a
highly specific inhibitor of human PDE5, trequinsin, an
inhibitor of human PDE3, ethaverine and dipyridamole.
However, their IC
50
values were rather high (1 and 2.5 l
M
for sildenafil and trequinsin, respectively) when compared
with the IC
50
values against their specific targets (human
PDE5 for sildenafil, 0.0039 l
M
; human PDE3 for trequin-
Fig. 7. Mg
2+
dependence of TbPDE1 stability. Aliquots of purified
TbPDE1 were incubated for 60 min at 30 °C. At different times during
this preincubation, EDTA was added to 10 m
M

the four most potent inhibitors, sildenafil, trequinsin,
ethaverine and dipyridamole, is very similar to that
determined for TbPDE2A [26], and it is entirely different
from that of mammalian PDEs. No correlation was
observed between the selectivity and potency of inhibitors
for their respective human target PDE family, and their
potency against TbPDE1. Interestingly, the broad-spectrum
PDE inhibitor IBMX, which is widely used in cell biological
experimentation, is essentially inactive on TbPDE1, with an
IC
50
value of > 1 m
M
.
Discussion
This study reports the identification and characterization of
a novel cyclic-nucleotide-specific PDE, TbPDE1, from
T. brucei. TbPDE1 is a member of the class I PDEs and
represents a new family within this class. The amino acid
sequence of its catalytic domain is approximately equidis-
tant from those of all mammalian class I PDEs, the class I
PDEs dunce of D. melanogaster,regAofD. discoideum and
PDE2 of S. cerevisiae,aswellasfromanotherclassIPDE
of T. brucei, TbPDE2A. TbPDE1 is camp specific, its
activity is not modulated by cGMP, and it exhibits an
unusually high K
m
for its substrate cAMP (> 600 l
M
). It

mined using 1 l
M
cAMP as a substrate. n.d., Not determined.
Inhibitor
Specificity
for human
PDE family
IC
50
(l
M
)
for human
PDE family
IC
50
(l
M
) for
TbPDE1
Sildenafil 5 0.0039 1
Trequinsin 3 0.0003 2.5
Ethaverine n.d. n.d. 8
Dipyridamole 5, 6 0.38 13
Etazolate 4 2 25
Papaverine Nonselective 5–25 30
Rolipram 4 2 280
IBMX Nonselective > 1000
8-Methoxymethyl-IBMX 1 4 > 100
Vinpocetine 1 20 > 100

the enzymatic reaction, but also for stabilizing the enzyme
structure. This is in agreement with structural work on
human PDE4B2B [41,42] that had demonstrated the
presence of two divalent cations in the active centre. In
addition to the continuous presence of Mg
2+
, inclusion of
low concentrations of detergent, 0.1% (v/v) of Tween-20,
further activated the enzyme about fourfold and improved
the preservation of activity upon freezing. Current data do
not allow us to determine if the N-terminal moiety of
TbPDE1 is involved in maintaining the stability of the
enzyme, or if it modulates the activity of the catalytic
domain. Similar experiments with another trypanosomal
PDE, TbPDE2A, have demonstrated that the N-terminal
domain exerts no direct effect on either stability or activity
of the catalytic domain [26].
The recombinant TbPDE1 Arg189–Thr620 represents a
cAMP-specific PDE. cGMP neither competes as a substrate
nor does it modulate enzyme activity. This specificity is in
good agreement with the conservation of Asp378 and
Gln575 that are predicted to confer cAMP-specificity to
human PDE4 [41,42]. In contrast to all other members of
the class I PDEs, the K
m
of TbPDE1 Arg189–Thr620 for
cAMP is very high (> 600 l
M
). Available data cannot
formally exclude that this high K

We thank Ralph Schwarz, University of Marburg for his cDNA
library, John Colicelli and Peter Engel for their PP5 and YMS5 strains,
respectively, Miles Houslay for providing a human PDE4 clone, Sara
Melville for a gift 927 genomic DNA, and Boris Bieger for providing
some of the constructs. We are indebted to Miriam van der Bogaard
and Markus Linder for expert technical assistance, and to Min Ku for
converting our text into palatable English. We gratefully acknowledge
the generosity of Glaxo-Wellcome, Smith Kline Beecham and Pfizer for
providing samples of PDE inhibitors. This work was supported by
grants 31-058927.99 and 3100-067225/1 of the Swiss National Science
Foundation, grant C98.0060 of COST program B9 of the European
Union, and by the UNDP/World Bank/WHO Special Programme for
Research and Training in Tropical Diseases (to T.S.), the Max-Planck
Gesellschaft, grant BEO21/0316211A from the German Federal
Ministry for Science and Technology (BMFT), and by grant Bo1100
of the Deutsche Forschungsgemeinschaft (to M.B.).
References
1. Botsford, J.L. & Harman, J.G. (1992) Cyclic AMP in prokaryotes.
Microbiol. Rev. 56, 100–122.
2. D’Souza, C.A. & Heitman, J. (2001) Conserved cAMP signaling
cascades regulate fungal development and virulence. FEMS
Microbiol. Rev. 25, 349–364.
3. Meili, R. & Firtel, R.A. (2003) Follow the leader. Dev. Cell 4,
291–293.
4. Zufall, F. & Munger, S.D. (2001) From odor and pheromone
transduction to the organization of the sense of smell. Trends
Neurosci. 24, 191–193.
5. Wainger, B.J., DeGennaro, M., Santoro, B., Siegelbaum, S.A. &
Tibbs, G.R. (2001) Molecular mechanism of cAMP modulation of
HCN pacemaker channels. Nature 411, 805–810.

USA 97, 11020–11025.
15. Secchiero, P., Zella, D., Curreli, S., Mirandola, P., Capitani, S.,
Gallo, R.C. & Zauli, G. (2000) Pivotal role of cyclic nucleotide
phosphodiesterase 4 in Tat-mediated CD4
+
T cell hyperactivation
and HIV type I replication. Proc. Natl Acad. Sci. USA 97, 14620–
14625.
16. Dean, S.M. (2002) Pharmacologic treatment for intermittent
claudication. Vasc. Med. 7, 301–309.
646 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004
17. Spina, D. (2003) Theophylline and PDE4 inhibitors in asthma.
Curr. Op. Pulm. Med. 9, 57–64.
18. Gresser, U. & Gleiter, C.H. (2002) Erectile dysfunction. compar-
ison of efficacy and side effects of the PDE5 inhibitors sildenafil,
vardenafil and taladafil – a review of the literature. Eur. J. Med.
Res. 7, 435–446.
19. Naula, C. & Seebeck, T. (2000) Cyclic AMP signaling in trypa-
nosomatids. Parasitol. Today 16, 35–38.
20. Pays, E., Rolin, S. & Magez, S. (1997) Cell signalling in trypa-
nosomatids. In Trypanosomiasis and Leishmaniasis (Hide, G.,
Mottram, J.C., Coombs, G.H. & Holmes, P.H., eds), pp 199–225.
CAB International, Cambridge University Press, UK.
21. Seebeck, T., Gong, K.W., Kunz, A., Schaub, R., Shalaby, T. &
Zoraghi. R. (2001) cAMP signalling in Trypanosoma brucei. Int.
J. Parasitol. 31, 491–498.
22. Seebeck, T., Schaub, R. & Johner, A. (2004) cAMP signalling in
the kinetoplastid protozoa. Curr. Mol. Med. in press.
23. Mancini, P.E. & Patton, C.L. (1981) Cyclic-3¢,5¢-adenosine
monophosphate levels during the developmental cycle of Try-

cloning of procyclic culture forms of Trypanosoma brucei in a
semi-defined medium. Acta Tropica 36, 289–292.
31. LeRay, D., Barry, J.D., Easton, C. & Vickerman, K. (1977) First
tsetse fly transmission of the ÔAnTatÕ serodeme of Trypanosoma
brucei. Ann. Soc. Belge Me
´
d. Trop. 57, 369–381.
32. Hesse, F., Selzer, P.M., Mu
¨
hlstadt, K. & Duszenko, M. (1995) A
novel cultivation technique for long-term maintenance of blood-
stream form trypanosomes in vitro. Mol. Biochem. Parasitol. 70,
157–166.
33. Pillai, R., Kytle, K., Reyes, A. & Colicelli, J. (1993) Use of a yeast
expression system for the isolation and analysis of drug-resistant
mutants of a mammalian phosphodiesterase. Proc. Natl Acad. Sci.
USA 90, 11970–11974.
34. Boeke, J.D., Trueheart, J., Natsoulis, G. & Fink, G.R. (1987)
5-Fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol. 154, 164–175.
35. Sullivan, M., Egerton, M., Shakur, Y., Marquardsen, A. &
Houslay, M.D. (1994) Molecular cloning and expression, in both
COS-1 cells and S. cerevisiae, of a human cytosolic type-IVA,
cyclic AMP specific phosphodiesterase (hPDE-IVA-h6.1). Cell
Signal. 6, 793–812.
36. Mumberg, D., Muller, R. & Funk, M. (1995) Yeast vectors for the
controlled expression of heterologous proteins in different genetic
backgrounds. Gene 156, 119–122.
37. Atienza, J.M. & Colicelli, J. (1998) Yeast model system for study
of mammalian phosphodiesterases. Methods 14, 35–42.

cyclic AMP specific phosphodiesterase (hPDE-IVA-h6.1). Cell
Signal. 6, 793–812.
45. Lee, M.E., Markowitz, J., Lee, J.O. & Lee, H. (2002) Crystal
structure of phosphodiesterase 4D and inhibitor complex. FEBS
Lett. 530, 53–58.
46. Ma, P., Wera, S., Van Dijk, P. & Thevelein, J.M. (1999) The
PDE1-encoded low-affinity phosphodiesterase in the yeast Sac-
charomyces cerevisiae has a specific function in controlling agonist-
induced cAMP signaling. Mol. Biol. Cell 10, 91–104.
Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 647