Functional interaction between RNA helicase II⁄Gua and
ribosomal protein L4
Hushan Yang, Dale Henning and Benigno C. Valdez
Department of Pharmacology, Baylor College of Medicine, Houston, Texas, USA
Ribosome biogenesis is a complicated cellular process
which occurs in the nucleolus [1]. The entire scenario
begins at the end of mitosis and includes ribosomal
DNA transcription, pre-ribosomal RNA (pre-rRNA)
modifications and processing as well as assembly of
rRNAs and ribosomal proteins into preribosome sub-
units which are then exported to the cytoplasm to
form the mature ribosomes [2]. Errors in this process
are reported to be associated with several diseases
[3–8]. The availability of genetic manipulations makes
ribosome biogenesis much better studied in yeast than
in higher eukaryotes such as mammalian and frog sys-
tems, resulting in the identification of more than 80
yeast ribosomal proteins and numerous trans-acting
elements including small nucleolar RNAs (snoRNAs)
as well as nonribosomal proteins. However, in mam-
malian systems, ribosome biogenesis is far from being
thoroughly understood due to the increased complex-
ity. To date, only a few nucleolus-localized nonribo-
somal proteins have been implicated in pre-rRNA
processing in mammalian cells and include B23 ⁄
NO38 ⁄ NPM [9], C23 ⁄ nucleolin [3], fibrillarin [10,11],
p120 [12], EBP1 [13], Bop1 [14] and p19
Arf
[15]. No
bona fide RNA helicase has been implicated in this
process in higher eukaryotes except RNA helicase

Downregulation of Gua using small interfering RNA (siRNA) in HeLa
cells resulted in 80% inhibition of both 18S and 28S rRNA production.
The mechanisms underlying this effect remain unclear. Here we show that
in mammalian cells, Gua physically interacts with ribosomal protein L4
(RPL4), a component of 60S ribosome large subunit. The ATPase activity
of Gua is important for this interaction and is also necessary for the func-
tion of Gua in the production of both 18S and 28S rRNAs. Knocking
down RPL4 expression using siRNA in mouse LAP3 cells inhibits the pro-
duction of 47 ⁄ 45S, 32S, 28S, and 18S rRNAs. This inhibition is reversed
by exogenous expression of wild-type human RPL4 protein but not the
mutant form lacking Gua-interacting motif. These observations have sug-
gested that the function of Gua in rRNA processing is at least partially
dependent on its ability to interact with RPL4.
Abbreviations
aa, amino acid; GST, glutathione S-transferase; Gua, RNA helicase II ⁄ Gua; HA, hemagglutinin; IPTG, isopropylthio-b-
D-galactoside; NLS,
nuclear localization signal; NoLS, nucleolar localization signal; RPL4, Ribosomal Protein L4; rDNA, ribosomal DNA; rRNA, ribosomal RNA;
RNP, ribonucleoprotein; siRNA, small interfering RNA; snRNA, small nuclear RNA; snoRNA, small nucleolar RNA.
3788 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
c-Jun-mediated gene expressions [21] and in vitro clea-
vage by PIAS1 [22]. It is unclear whether the effect of
Gua on cell proliferation is due to its involvement
in ribosomal RNA production, c-Jun-mediated gene
expression or, as yet, other undiscovered mechanisms.
RNA helicases are believed to function through
regulation of RNA structure rearrangement and RNA-
RNA, RNA-protein or protein–protein interactions
[23,24]. To date, at least 18 putative ATP-dependent
RNA helicases have been suggested to contribute to
ribosome production in yeast S. cerevisiae [25]. It is

lane which were of greater abundance than those in
the control lane (Fig. 1A). We did not sequence these
bands, but we suspect they represent other ribosomal
proteins and ⁄ or trans-acting factors of a large nucleolar
complex essential for ribosome biogenesis.
The yeast two-hybrid system was used to prove the
direct interaction between Gua and RPL4. We sub-
cloned human Gua and RPL4 into pGBKT7 and
pGADT7 yeast expression vectors, respectively. The
growth of yeast cells containing both Gua and RPL4
in a triple drop-out medium that lacks tryptophan,
leucine, and histidine indicates interaction of the two
proteins (Fig. 1B, right). The specificity of Gua–RPL4
interaction is shown by the inability of the yeast clones
that harbor RPL4 and p68, a DEAD-box helicase
implicated in RNA splicing and export [29], or RPL4
and p53, to grow in a triple drop-out medium
(Fig. 1B, right). The growth of yeast cells containing
the above expression constructs in a double drop-out
medium that lacks tryptophan and leucine indicates
that these constructs were expressed (Fig. 1B, left).
Because protein–protein interactions shown by yeast
two-hybrid system are not always direct, we performed
an in vitro pull down assay using bacterially expressed
GST-RPL4 and untagged Gua mixed together and
pulled down with GSH-resin. Gua was pulled down
with GST-RPL4, which further supported the direct
interaction between Gua and RPL4 (Fig. 1C).
The in vivo association of Gua with RPL4 was
shown in both human HeLa cells and mouse LAP3

H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production
FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3789
mediated reorganization of RNA ⁄ protein structure
[23]. We previously showed that the DEVD motif of
Gua is important to 18S and 28S rRNA production
[17]. Since we surmised that Gua–RPL4 interaction is
necessary for Gua to function in pre-rRNA processing,
we sought to determine if the DEVD motif is also
important to the Gua–RPL4 interaction. DEVD was
mutated to ASVD with reported abolishment of both
ATPase and helicase activities [16]. An SAT mutant, in
which the SAT motif was mutated to LET, was used
as a control. This mutant still retains ATPase activity
but not RNA helicase activity [19]. We cotransfected
FLAG-tagged human RPL4 with hemagglutinin (HA)-
tagged wild-type, DEVD mutant or SAT mutant form
of human Gua into HeLa cells and did immunopreci-
pitation with anti-FLAG resin. Figure 2A shows that
FLAG-RPL4 was pulled-down efficiently in all three
precipitates. However, only wild-type Gua was also
present in the precipitate, suggesting the relevance of
the DEVD and SAT motifs in its association with
F
D
C
A
B
E
FLAG-vector
FLAG-Guα

Other
proteins
Double drop-out
(No Trp, No Leu)
Triple drop-out
(No Trp, No Leu, No His)
RPL4 Guα
IgG-H
Fig. 1. Gua interacts with RPL4. (A) Stable LAP3 clones were induced with 2 mM IPTG for 48 h to express FLAG-tagged mouse Gua. RNase
A-treated lysates were used in immunoprecipitation using anti-FLAG resin. Silver staining shows the precipitation of  50-kDa protein (RPL4)
in cells expressing mouse Gua but not in cells expressing vector alone. (B) Yeast two-hybrid analysis showing the interaction of human
RPL4 with human Gua and Gub. Yeast clones were grown on selection media. Growth in the absence of tryptophan and leucine would indi-
cate presence of the appropriate vectors used to clone RPL4 and its candidate partner. Presence of colonies in the triple drop-out medium
(no tryptophan, no leucine, no histidine) would indicate interaction between RPL4 and the other protein. (C) In vitro interaction of RPL4 with
Gua. Purified GST, GST-RPL4 or blank control was mixed with purified untagged Gua in a binding buffer prior to addition of GSH-resin. Cen-
trifugation separated the supernatant from the resin. Both the supernatant and resin were analyzed by western blot analysis using anti-Gua
Ig. (D) Overexpressed Gua interacts with both endogenous and overexpressed RPL4. Extracts from HeLa cells cotransfected with FLAG-
tagged Gua and protein A-tagged RPL4 were immunoprecipitated using anti-FLAG resin and probed with the indicated antibodies. (E) Over-
expressed RPL4 interacts with both endogenous and overexpressed Gua in HeLa cells. Extracts from HeLa cells cotransfected with
FLAG-tagged RPL4 and protein A-tagged Gua were immunoprecipitated with anti-FLAG resin and probed with indicated antibodies. (F) HeLa
cells transfected with FLAG-tagged human RPL4 were stained by indirect immunofluorescence using anti-FLAG Ig. Anti-mouse IgG coupled
to rhodamine was used as secondary antibody. GFP-tagged human Gua was cotransfected and visualized directly under microscope, as a
control showing the position of nucleoli.
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.
3790 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
RPL4. This experiment further proved the specificity
of Gua–RPL4 interaction since B23, an abundant
nucleolar phosphoprotein which is also implicated in
ribosomal RNA processing [31], was not pulled-down
by RPL4 (Fig. 2A, bottom).

ing the importance of the DEVD motif to the function
of Gua in both 18S and 28S rRNA production in
Xenopus. In the mammalian system, we were able to
demonstrate that an SAT mutant, which lacks helicase
activity, can restore 28S but not 18S rRNA production
in mouse LAP3 cells [17], which suggests that the SAT
motif is important in 18S but not 28S rRNA produc-
tion. Because the helicase activity is dependent on the
presence of the ATPase activity of Gua [18,19], it is
reasonable to expect that mutation of the DEVD motif
would consequently result in defects of 18S matur-
ation. However, whether or not the DEVD motif is
necessary for 28S production in mammalian cells is
unknown. Here, a rescue experiment was performed
exactly as described [17] to address this issue. Briefly, a
stable LAP3 clone was induced with IPTG to over-
express a DEVD mutant form of the human Gua,
after which the cells were treated with si935, an effect-
ive siRNA that specifically targets mouse Gua mRNA
but not human Gua mRNA. Figure 3 shows that treat-
ment of the cells with si935 effectively inhibited the
production of both 18S and 28S rRNAs (lane 3, com-
pared with lanes 1 and 2), which conforms to our pre-
vious results [17]. However, in this experiment the
expression of a DEVD mutant form of human Gua
protein did not restore 18S nor 28S rRNA (Fig. 3. lane
4) as the wild-type did [17]. Thus, we conclude that the
DEVD motif is indispensable for the function of
human Gua in both 18S and 28S rRNA production,
consistent with our results in the Xenopus oocyte [16].

WB: anti-HA
WB: anti-B23
WB: anti-FLAG
WB: anti-Xpress
WB: anti-B23
FLAG-Guα
Xpress-RPL4
Xpress-RPL4
FLAG-Guα (WT)
Xpress-RPL4
FLAG-Guα (SAT-M)
Xpress-RPL4
FLAG-Gu (DEVD-M)
B23
FLAG-RPL4
HA-Guα
B23
Fig. 2. The DEVD motif of Gua is important to Gua–RPL4 interac-
tion. (A) HeLa cells were cotransfected with FLAG-tagged human-
RPL4 and plasmids encoding HA-tagged wild-type (WT), SAT
mutant (SAT-M) or DEVD mutant (DEVD-M) form of human Gua.
Whole cell extracts were immunoprecipitated using anti-FLAG resin
and probed with anti-FLAG, anti-HA or anti-B23 Ig. (B) LAP3 cells
were transfected with Xpress-tagged mouse RPL4 and induced
with 2 m
M IPTG for 48 h to express FLAG-tagged wild-type, SAT
mutant or DEVD mutant of mouse Gua. Whole cell extracts were
immunoprecipitated using anti-FLAG resin and probed with anti-
FLAG, anti-Xpress or anti-B23 Ig.
H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production

ting the region of amino acids 131–264 probably con-
tains both the nuclear (NLS) and nucleolar (NoLS)
localization signals while amino acids 264–428 may
harbor another NLS but no NoLS.
Figure 4C reveals that RPL4 C1 and C2 mutants,
but not its N1 mutant form, coimmunoprecipitate with
Gua, suggesting the Gua-interacting domain resides in
amino acids 264–428 of RPL4. We speculated that if
Gua–RPL4 interaction is important to cellular func-
tions, then the chance should be high that the Gua-
interacting domain in RPL4 would be in a conserved
region. As the region of amino acids 333–428 is not
highly conserved among different species, we focused
on amino acids 264–333 as a possible Gua-interacting
motif in RPL4. This hypothesis was proved to be cor-
rect by coimmunoprecipitation of three mutants har-
boring amino acids 264–333 (Fig. 4F, M3, M5, M6).
The other three RPL4 mutants that lack amino acids
264–333 did not coimmunoprecipitate with Gua
(Fig. 4F, M1, M2, M4). We observed that two bands
are recognized by the anti-FLAG Ig in mutant M1.
The lower band should be the correct deletion mutant
expression product according to its expected molecular
size. The identity of the upper band remains to be
determined.
Localizations of M2 (amino acids 131–264) and M3
(amino acids 131–333) mutants to the nucleolus are in
accordance with the finding that both NLS and NoLS
are within amino acids 131–264. Mutant M1 (amino
acids 131–196) is dispersed within the whole cell but

+
Fig. 3. The DEVD motif of Gua is important to both 18S and 28S
rRNA production. LAP3 cells were induced with 2 m
M IPTG to
express DEVD mutant of human Gua. Cells were then treated with
si935 for 48 h followed by pulse-labeling with [
32
P]orthophosphate
for 1.5 h and a chase for 3 h with normal growth medium. Total
RNAs were extracted, resolved on a 1.2% agarose-formaldehyde
gel and blotted onto a membrane for phosphorimager analysis.
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.
3792 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
weak NLS may be within amino acids 196–264. Com-
bined with the NoLS, this weak NLS is capable to
cause most RPL4 molecules to enter the nucleolus. It
is not uncommon to have more than one nuclear local-
ization signal within a protein [35,36].
Downregulation of RPL4 inhibits rRNA production
in mouse LAP3 cell line
RPL4 is a component of the 60S ribosome large sub-
unit. To date, there is no report showing a direct
involvement of RPL4 in pre-rRNA processing. Ribo-
somal proteins are always produced in the cytoplasm,
and then imported into the nucleoli to participate in
preribosome assembly. The ribosomes are then expor-
ted back into the cytoplasm where they direct protein
production [37]. As we hypothesize the interaction
between RPL4 and Gua is important to the function of
Gua in rRNA production, it will aid to our hypothesis

FLAG-C1
FLAG-N1
FLAG-C2
HA-Guα
FLAG-M3
FLAG-M5
FLAG-M2
FLAG-M6
FLAG-M4
FLAG-M1
HA-Guα
WB: anti-HA
WB: anti-FLAG
WB: anti-HA
IP: anti-FLAG
Hoechst
Phase
anti-FLAG
Hoechst
Phase
N1 C1 C2
N1 C1 C2
M1 M2 M3 M4 M5 M6
M1 M2 M3 M4 M5 M6
264
333
428
131
131
131

Nucleoplasm
N1
C1
C2
M1
M2
M3
M6
M5
M4
Constructs
Guα-binding Localization
Fig. 4. Mapping of Gua-binding domain in human RPL4. (A) Schematic representation of wild-type and mutant forms of human RPL4. The
open bar represents regions conserved between human and mouse RPL4. The shaded bar represents nonconserved regions. (B) Cellular
localization of human RPL4 mutants. HeLa cells transfected with FLAG-tagged human RPL4 and various mutants were stained by indirect
immunofluorescence using anti-FLAG Ig. Anti-mouse IgG coupled to FITC was used as secondary antibody. Nuclei were visualized by Hoe-
chst stain. The phase images show dark phase nucleoli. (C) Whole cell extracts from HeLa cells cotransfected with HA-tagged human Gua
and FLAG-tagged human RPL4 deletion mutants were immunoprecipitated using anti-FLAG resin and blotted as indicated. (D) Schematic rep-
resentations of human RPL4 mutants M1 to M6 and their (E) cellular localization. (F) Whole cell extracts from HeLa cells cotransfected with
HA-tagged human Gua and FLAG-tagged human RPL4 deletion mutant shown in (D) were immunoprecipitated using anti-FLAG resin and
blotted as indicated.
H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production
FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3793
Lacking an antibody against mouse RPL4 protein,
we instead used an indirect way to determine the effect
of si-L4-M1 on the protein level of mouse RPL4. We
cotransfected HeLa cells with si-L4-M1 and an
Xpress-tagged mouse RPL4 construct. In this experi-
ment, the remaining exogenously expressed mouse
RPL4 protein level after si-L4-M1 treatment could be

is shown to indicate equal loading of the RNA.
Wild-type RPL4 but not its mutant form which
lacks the Gua-interacting domain reverses
inhibition of rRNA production
We constructed a deletion mutant of human RPL4,
D264-333, which lacks the Gua-interacting domain
amino acids 264–333 and another mutant D204-264 as
a control (Fig. 6A). We had already localized the
NoLS of RPL4 to amino acids 196–204, which was
supported by the nucleolar localization of both
mutants (Fig. 6B). The immunoprecipitation experi-
ment shows their Gua-binding activity (Fig. 6C), and
supports our earlier findings (Fig. 4F). Because the
region including amino acids 264–333 seems to be the
RPL4-Gua-interacting domain, the D204-264 mutant,
A
B
C
D
Human 1120
Mouse 1129
si934Scr
mRPL4
mU1C
Relative mRPL4
Relative mL4
si-L4-M1
47S/45S
si934Scr
si-L4-M1

parallel experiment was done to analyze changes in the protein levels of mouse RPL4, human RPL4 and human B23 after si-L4-M1 treat-
ment. (D) LAP3 cells were treated with 100 n
M si-L4-M1 for 48 h. Total
32
P-labeled RNA was analyzed as described in the legend to Fig. 3.
Ethidium bromide staining of both 18S and 28S rRNA is shown at the bottom.
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.
3794 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
but not the D264-333 mutant form, coimmunoprecipi-
tated with Gua (Fig. 6C).
To determine the significance of Gua–RPL4 inter-
action in rRNA biogenesis, we first used si-L4-M1 to
downregulate endogenous mouse RPL4 expression and
then exogenously expressed the human orthologue and
looked for reversal of inhibition of rRNA production.
Figure 6(D) (lanes 1 and 2) shows that si-L4-M1
effectively inhibited production of all four species of
rRNAs, which is consistent with the results in
Fig. 5(D). This effect was reversed by the exogenous
expression of human wild-type RPL4, suggesting that
the human orthologue can functionally replace mouse
RPL4 (Fig. 6D, lane 3). However, the expression of
mutant human RPL4 lacking the Gua-interacting
domain could not reverse the aberrant rRNA process-
ing pattern as effectively as the wild-type while the
mutant lacking amino acids 204–264 had a similar
effect to that of the wild-type, indicating that the
Gua–RPL4 interaction is important to the function of
Gua in rRNA processing (Fig. 6D, lanes 4 and 5).
Human RPL4 associates with 28S but not 18S

(WT)
FLAG-RPL4
(∆204-264)
FLAG-RPL4
(∆264-333)
si-L4-M1 si-L4-M1 si-L4-M1 si-L4-M1
2
nd
transfection
18S
28S
18S
28S
32S
47S/45S
28S± SE 49±4
54±5
84±10
84±10
73±6
83±5
42±7
47±6
1 234 5
100
100
Total± SE
WB: anti-HA
204 264
428

RNA-Total
28S probe
28S rRNA
18S rRNA
18S probe
12 34 65
RNA-IP-
FLAG-vector
RNA-IP-
FLAG-RPL4
Fig. 7. Human RPL4 associates with 28S but not 18S rRNA. HeLa
cells were transfected with either FLAG-vector only or FLAG-
tagged human RPL4. After 48 h, cells were collected and RNA-
RPL4 complexes were immunoprecipitated from nucleolar extracts
using anti-FLAG resin as described under Experimental procedures.
RNA components were isolated and resolved in a 1.2% agarose-
formaldehyde gel and blotted onto a nitrocellulose membrane,
which was subjected to northern blot analysis as described under
Experimental procedures.
H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production
FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3795
overexpressed RPL4 pulled-down 28S but not 18S
rRNA in a dose-dependent manner (lanes 5 and 6).
We did not observe any signal from 47 ⁄ 45S, 36S and
32S pre-rRNAs, the precursors of 28S rRNA. Based
on our previous experience [16], a single oligodeoxy-
nucleotide probe we used to detect 28S could not
detect higher molecular weight pre-rRNAs under our
hybridization conditions for unknown reasons. As we
used nucleolar extract as the starting material for

of RNase A (200 lgÆmL
)1
), which was used in previ-
ous reports to isolate specific target-associated proteins
[31,44], suggests that these additional interactions
might not be RNA-mediated. The Gua–RPL4 inter-
action was further confirmed by immunoprecipitation
from HeLa cells (Fig. 1D,E), yeast two-hybrid analysis
(Fig. 1B) and in vitro binding assay (Fig. 1C). It is
noteworthy that Gub also interacts with RPL4 as
shown by the two-hybrid analysis (Fig. 1B, lower
right). As a paralogue of Gua,Gub also possesses
in vitro ATPase and helicase activities, but no RNA
foldase activity [45]. The current data suggest that
both paralogues arose through gene duplication but
the resulting genes are differentially regulated and
might possess different functions [46]. Overexpression
of Gub in mouse LAP3 cells leads to inhibition of
total rRNA production, suggesting contrasting roles
for Gub and Gua [17]. It would be valuable to deter-
mine whether the inhibitory effect of Gub on rRNA
biogenesis is through its competitive interaction with
RPL4. Indirect immunofluorescence showed a predom-
inant localization of newly produced FLAG-tagged
RPL4 protein to the nucleolus (Fig. 1F) which is con-
sistent with the published report that most newly
formed ribosomal proteins are highly concentrated in
the nucleolus [47]. Burial of FLAG epitope within the
highly structured mature ribosome subunit might
account for the absence of strong fluorescent signal in

Through a series of deletion mutants of RPL4 used
in the immunoprecipitation and indirect immunofluo-
rescence experiments, we identified the NLS and NoLS
as well as the Gua-interacting domains in RPL4
(Figs 4 and 5). However, it is worth mentioning
that the use of deletion mutants may not accurately
reflect the exact functional states of protein inter-
actions since the possibility exists that the shortened
proteins may be unfolded and thus nonfunctional.
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.
3796 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
Subtle point mutations in the identified Gua-interacting
domain might lend more support to our conclusions.
Downregulation of RPL4 via si-L4-M1 resulted in the
inhibition of production of all four rRNA species
(Figs 5D and 6D lane 2), strongly suggesting a general
mechanism whereby RPL4 modulates rRNA biogen-
esis through rDNA transcription, rRNA turn over,
ribosome production rate, ribosome stability or rRNA
degradation. It is possible that the amount of RPL4 in
the cell correlates with the assembly or stabilization of
pre-rRNA processing machineries or preribosomal par-
ticles. Perhaps RPL4 is actually a component of the
pre-rRNA processing machinery. If so, a dramatic
change in the amount of RPL4 protein level might
lead to disassembly of the specific machineries or parti-
cles, which would send feedback signals to RNA
polymerase I to advance more slowly or even to rRNA-
degrading complexes to degrade the unincorporated
mature rRNA [17]. This hypothesis might help to

action in 28S production than a possible general mechan-
ism, although it is likely that both mechanisms coexist.
It is not uncommon for a nucleolar protein to function
in different pathways. For example, the function of
C23 in ribosome biogenesis is reflected in almost all
steps of the process including rDNA transcription,
pre-rRNA processing, preribosome assembly and
nucleocytoplasmic transport [39].
What then could be a mechanism whereby the Gua–
RPL4 interaction facilitates 28S rRNA biogenesis? The
fact that Gua and RPL4 have been identified in ribo-
nucleoprotein (RNP) particles [31,49] indicates that
their interaction might cause them to be localized into
pre-rRNA processing machineries essential for pre60S
ribosome particles. It is known that interruption of
early assembly steps results in disassembly of the parti-
cles and destabilization of pre-rRNAs [43]. Moreover,
we did observe several other bands in the immunopre-
cipitation assay (Fig. 1A) coimmunoprecipitating with
Gua, which may represent other proteins in the same
processing machinery as Gua. Once Gua has been
incorporated into the RNP particle, it might function
in early rRNA processing steps such as regulating
interactions between guide snoRNAs and pre-rRNAs,
helping the endo- and exo-nucleases in removing inter-
nal or external transcribed spacer sequences as well as
modulating the numerous trans-acting factors and
ribosomal proteins in the pre60S particles through
regulation of RNA-RNA, RNA–protein and protein–
protein interactions [43]. In yeast S. cerevisiae, involve-

FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3797
In summary, the data in this report suggest that
RPL4 functions in a general manner in rRNA biogen-
esis whereas the Gua–RPL4 interaction is more direct
in the production of 28S rRNA and maturation of
pre60S particles. More questions arise such as whether
RPL4 recruits Gua or vise versa, what is the exact
mechanism of Gua ⁄ RPL4 involvement in rRNA pro-
cessing, which specific step requires Gua–RPL4 inter-
action and what other cis-ortrans-acting factors are
in the RNP particle containing Gua and RPL4. Ribo-
some biogenesis in yeast has been shown to be a highly
intricate cellular process with the involvement of about
80 ribosomal proteins and numerous trans-acting fac-
tors [43]. It is believed that the process is more com-
plex in higher eukaryotes [43]. Yeast S. cerevisiae has
been shown to be an effective model to defining this
field due to the availability of genetic screens. How-
ever, the yeast orthologue for Gua remains to be
identified. Further studies aimed at isolation and
investigation of Gua orthologue in yeast, and the
large-scale proteomics study combined with molecular
analysis of specific factors involved should provide a
clearer understanding of the function of the Gua–
RPL4 interaction and its significance in a more inclu-
sive picture of the ribosome biogenesis in higher
eukaryotes.
Experimental procedures
Cell culture and transfection
HeLa cells were grown in Dulbecco’s modified Eagle’s med-

tration of 200 lgÆmL
)1
. After incubation on ice for 10 min
followed by another centrifugation at 10 000 g at 4 ° C for
10 min, the supernatant was separated, mixed with anti-
FLAG-M2 resin (Sigma), and tumbled at 4 °C for 4 h. The
mixture was then centrifuged at 1500 g at 4 °C for 2 min.
The pellet was washed five times with wash buffer (50 mm
Tris ⁄ HCl, pH 7.5, 150 mm NaCl, 0.5% NP-40) and subjec-
ted to further analysis. For identification of Gua-associated
proteins, the immunoprecipitate was resolved on a sodium
dodecyl sulfate–polyacrylamide (10%) gel followed by silver
staining. The protein bands showing only in the Gua-
expressed samples were excised and analyzed by mass
spectrometry.
Yeast two-hybrid analysis
The cDNAs for human Gua and human RPL4 were
subcloned into pGBKT7 and pGADT7 yeast expression
vectors, respectively. Protein–protein interaction was deter-
mined in yeast exactly as previously described [62].
In vitro binding assay
Recombinant proteins were expressed in Escherichia coli.
Purified GST or GST-RPL4 protein was mixed with puri-
fied untagged Gua [18] in NETN buffer [63] and tumbled
for 2 h at 4 °C. GSH-resin was then added and tumbled
for additional 1 h. Followed by centrifugation, the resin
was washed in NETN buffer and boiled in Laemmli buffer.
The supernatant was also boiled in Laemmli buffer. Sam-
ples were analyzed on immunoblots using anti-Gua Ig.
Immunoprecipitation to confirm the interaction

)1
[
32
P]ortho-
phosphate (Amersham Pharmacia Biosciences, Piscataway,
NJ), incubated for 1.5 h and chased with the regular
growth medium for 3 h.
32
P-labeled RNA was isolated and
analyzed as described [17].
RNA immunoprecipitation and northern blot
analysis
HeLa cells were transfected with either FLAG vector alone
or FLAG-tagged human RPL4. After 48 h, cells were har-
vested by centrifugation at 3000 g for 5 min and washed
three times with 1· NaCl ⁄ P
i
. Cell pellets were resuspended
in resuspension buffer (RSB) (10 mm Tris ⁄ HCl pH 7.4,
10 mm NaCl, 1.5 m m magnesium acetate). After incubation
on ice for 30 min followed by a centrifugation at 1000 g
for 8 min, cell pellets were resuspended in RSB buffer
with 0.5% NP-40. Cells were homogenized with a Dounce
homogenizer until the nuclei were released (which were
visualized under microscope). After another centrifugation
at 1000 g for 8 min, cell pellets were resuspended in 0.88 m
sucrose, 5 mm magnesium acetate and centrifuged at 1500 g
for 20 min. The supernatant was discarded and the nuclear
pellet was suspended by gentle Dounce homogenization in
0.34 m sucrose, 0.5 m m magnesium acetate and sonicated

3, 236–241.
3 Tuteja R & Tuteja N (1998) Nucleolin: a multifunc-
tional major nucleolar phosphoprotein. Crit Rev Bio-
chem Mol Biol 33, 407–436.
4 Derenzini M, Ceccarelli C, Santini D, Taffurelli M
& Trere D (2004) The prognostic value of the
AgNOR parameter in human breast cancer depends
on the pRb and p53 status. J Clin Pathol 57, 755–
761.
5 Xue D, Shi H, Smith JD, Chen X, Noe DA, Cedervall
T, Yang DD, Eynon E, Brash DE, Kashgarian M et al.
(2003) A lupus–like syndrome develops in mice lacking
the Ro 60-kDa protein, a major lupus autoantigen. Proc
Natl Acad Sci USA 100, 7503–7508.
Table 1. Primers used for RT-PCR and probes used for northern blot analysis.
Name 5¢ to 3¢ sequence Gene
U1C5¢ GCAACATGCCCAAGTTTTATTGTG RT-PCR primer, human U1C, sense
U1C3¢ TATCCTTATCTGTCTGGTCGAGTC RT-PCR primer, human U1C, antisense
BV974 AGCATCATGCCCAAGTTTTATTGTGA RT-PCR primer, mouse U1C, sense
BV976 TTTCTCCCTCCAAAAATATTCAGTTA RT-PCR primer, mouse U1C, antisense
YH34 TCTCCTCTCCTCGAGATGGCGTGTGCTCGCCCACTG RT-PCR primer, human and mouse L4, sense
YH47 ACCGCCGCCTTCTCATCTGA RT-PCR primer, human L4, antisense
YH48 TTCTCTGGAACAACCTTCTCG RT-PCR primer, mouse L4, antisense
YH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern blot analysis probe, for 18S rRNA
YH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNA
H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production
FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3799
6 Stefanovsky VY, Pelletier G, Hannan R, Gagnon-
Kugler T, Rothblum LI & Moss T (2001) An immediate
response of ribosomal transcription to growth factor

cell cycle progression. J Biol Chem 277, 29617–29625.
15 Sugimoto M, Kuo ML, Roussel MF & Sherr CJ (2003)
Nucleolar Arf tumor suppressor inhibits ribosomal
RNA processing. Mol Cell 11, 415–424.
16 Yang H, Zhou J, Ochs RL, Henning D, Jin R & Valdez
BC (2003) Downregulation of RNA helicase II ⁄ Gu
results in the depletion of 18 and 28 S rRNAs in Xeno-
pus oocyte. J Biol Chem 278, 38847–38859.
17 Henning D, So RB, Jin R, Lau LF & Valdez BC (2003)
Silencing of RNA helicase II ⁄ Gualpha inhibits mamma-
lian ribosomal RNA production. J Biol Chem 278,
52307–52314.
18 Valdez BC, Henning D, Busch RK, Woods K, Flores-
Rozas H, Hurwitz J, Perlaky L & Busch H (1996) A
nucleolar RNA helicase recognized by autoimmune anti-
bodies from a patient with watermelon stomach disease.
Nucleic Acids Res 24, 1220–1224.
19 Valdez BC, Henning D, Perumal K & Busch H (1997)
RNA-unwinding and RNA-folding activities of RNA
helicase II ⁄ Gu: Two activities in separate domains of
the same protein. Eur J Biochem 250, 800–807.
20 Ou Y, Fritzler MJ, Valdez BC & Rattner JB (1999)
Mapping and characterization of the functional domains
of the nucleolar protein RNA helicase II ⁄ Gu. Exp Cell
Res 247, 389–398.
21 Westermarck J, Weiss C, Saffrich R, Kast J, Musti AM,
Wessely M, Ansorge W, Seraphin B, Wilm M, Valdez
BC et al. (2002) The DEXD ⁄ H-box RNA helicase
RHII ⁄ Gu is a co-factor for c-Jun-activated transcrip-
tion. EMBO J 21, 451–460.

JC, Wardrop J, Gregory DJ, Lane DP, Perkins ND &
Fuller-Pace FV (2005) The DEAD box protein p68: a
novel transcriptional coactivator of the p53 tumour
suppressor. EMBO J 24, 543–553.
30 Jin A, Itahana K, O’Keefe K & Zhang Y (2004) Inhibi-
tion of HDM2 and activation of p53 by ribosomal pro-
tein L23. Mol Cell Biol 24, 7669–7680.
31 Bertwistle D, Sugimoto M & Sherr CJ (2004) Physical
and functional interactions of the Arf tumor suppressor
protein with nucleophosmin ⁄ B23. Mol Cell Biol 24,
985–996.
32 Bagni C, Mariottini P, Annesi F & Amaldi F (1993)
Human ribosomal protein L4: cloning and sequencing
of the cDNA and primary structure of the protein.
Biochim Biophys Acta 1216, 475–478.
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.
3800 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
33 Ueno M, Nakayama H, Kajikawa S, Katayama K,
Suzuki K & Doi K (2002) Expression of ribosomal pro-
tein L4 (rpL4) during neurogenesis and 5-azacytidine
(5AzC)-induced apoptotic process in the rat. Histol
Histopathol 17, 789–798.
34 Lucioli A, Presutti C, Ciafre S, Caffarelli E, Fragapane
P & Bozzoni I (1988) Gene dosage alteration of L2
ribosomal protein genes in Saccharomyces cerevisiae:
effects on ribosome synthesis. Mol Cell Biol 8, 4792–
4798.
35 Heiss NS, Girod A, Salowsky R, Wiemann S, Pepper-
kok R & Poustka A (1999) Dyskerin localizes to the
nucleolus and its mislocalization is unlikely to play a

Kobayashi R & Zhang Y (2003) Tumor suppressor
ARF degrades B23, a nucleolar protein involved in
ribosome biogenesis and cell proliferation. Mol Cell 12,
1151–1164.
45 Valdez BC, Perlaky L & Henning D (2002) Expression,
cellular localization, and enzymatic activities of RNA
helicase II ⁄ Gub. Exp Cell Res 276, 249–263.
46 Valdez BC, Yang H, Hong E & Sequitin AM (2002)
Genomic structure of newly identified paralogue of
RNA helicase II ⁄ Gu: detection of pseudogenes and
multiple alternatively spliced mRNAs. Gene 284, 53–
61.
47 Warner JR (1979) Distribution of newly formed ribo-
somal proteins in HeLa cell fractions. J Cell Biol 80,
767–772.
48 Venema J & Tollervey D (1999) Ribosome synthesis
in Saccharomyces cerevisiae. Annu Rev Genet 33, 261–
311.
49 Fujiyama S, Yanagida M, Hayano T, Miura Y, Isobe
T, Fujimori F, Uchida T & Takahashi N (2002) Isola-
tion and proteomic characterization of human parvulin-
associating preribosomal ribonucleoprotein complexes.
J Biol Chem 277, 23773–23780.
50 O’Day CL, Chavanikamannil F & Abelson J (1996) 18S
rRNA processing requires the RNA helicase-like protein
Rrp3. Nucleic Acids Res 24, 3201–3207.
51 Daugeron MC & Linder P (1998) Dbp7p, a putative
ATP-dependent RNA helicase from Saccharomyces cer-
evisiae, is required for 60S ribosomal subunit assembly.
RNA 4, 566–581.

mechanism controlling the dynamic cycling of nucleo-
stemin. J Cell Biol 168, 179–184.
60 Misteli T (2005) Going in GTP cycles in the nucleolus.
J Cell Biol 168, 177–178.
61 Valdez BC (2000) Structural domains involved in the
RNA folding activity of RNA helicase II ⁄ Gu protein.
Eur J Biochem 267, 6395–6402.
H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production
FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS 3801
62 Valdez BC, Henning D, So RB, Dixon J & Dixon MJ
(2004) The Treacher Collins syndrome (TCOF1 ) gene
product is involved in ribosomal DNA gene transcrip-
tion by interacting with upstream binding factor. Proc
Natl Acad Sci USA 101, 10709–10714.
63 Valdez BC, Perlaky L, Henning D, Saijo Y, Chan PK
& Busch H (1994) Identification of the nuclear and
nucleolar localization signals of the protein p120. Inter-
action with translocation protein B23. J Biol Chem 269,
23776–23783.
3802 FEBS Journal 272 (2005) 3788–3802 ª 2005 FEBS
Gua–RPL4 interaction in mammalian rRNA production H. Yang et al.