Identi®cation and properties of type I-signal peptidases
of
Bacillus amyloliquefaciens
Hoang Ha Chu, Viet Hoang*, Peter Kreutzmann², Brigitte Hofemeister, Michael Melzer
and JuÈ rgen Hofemeister
Institute of Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany
The use of Bacillus amyloliquefaciens for enzyme production
and its exceptional high protein export capacity initiated this
study where the presence and function of multiple type I
signal peptidase isoforms was investigated. In addition to
type I signal peptidases SipS(ba) [Meijer, W.J.J., de Jong, A.,
Bea, G., Wisman, A., Tjalsma, H ., Venema, G., Bron, S. &
van Dijl, J.M. (1995) Mol. Microbiol. 17, 621±631] and
SipT(ba) [ Hoang, V. & Hofemeister, J . (1995) Biochim.
Biophys. Acta 1269, 64±68] which were previously identi®ed,
here we present e vidence for two other Sip-like g enes in
B. amyloliquefaciens. Same map positions as well as
sequence motifs veri®ed that these genes encode homologues
of Bacillus subtilis SipV and S ipW. SipU-encoding DNA was
not found in B. amyloliquefaciens. SipW-encoding DNA
was also found for other Bacillus strains representing dif-
ferent phylogenetic groups, but not for Bacillus stearother-
mophilus and Thermoactinomyces vulgaris. The absence of
these genes, however, could have been overlooked due to
sequence diversity. Seq uence alignments of 23 known Sip-
like proteins from Bacillus origin indicated further branching
of the P-group signal peptidases into clusters represented by
B. subtilis SipV, SipS-SipT-SipU and B. anthracis Sip3-Sip5
proteins, respectively. Each B. amyloliquefaciens sip(ba)
gene was expressed in an Escherichia coli LepBts mutant and
tested for g enetic complementation of the temperature se n-
or groups of export proteins. The B. subtilis genome
sequencing project [12] has enabled computer analysis to
predict that 166 proteins o f the total B. subtilis proteome
contain a N-terminal signal peptide, characteristic for Sec
export protein precursors [4]. Several e ubacteria and
archaebacteria possess only one type I SPase functioning
in Sec export protein processing [13]. However, B. subtilis
contains ®ve chromosomally encoded type I SPases, named
SipS, SipT, SipU, SipV, and SipW, respectively [4,5,14,15].
Multiple type I SPases were also found in Archaeoglobus
fulgidus [16], Streptomyces lividans [17], Bradyrhizobium
japonicum [18,19] and Staphylococcus aureus [20]. The
presence of a unique type I SPase (LepB in E. coli)was
shown to be essential for cell viability [21,22]. In c ontrast,
B. subtilis has ®ve Sip homologues, of which SipS a s well a s
SipT isoforms were shown to be essential for cell viability,
and have overlapping processing functions. Double mutants
Correspondence to J. Hofemeister, Institute of Plant Genetics and
Crop Plant Research (IPK), Corrensstrasse 3, Gatersleben, D-06466,
Germany. Fax/Tel.: + 49 394825 13 8/241,
E-mail:
Abbreviations: Ap, ampicillin; c.f.u., colony forming units; Cm, chlo-
ramphenicol; CWBP, cell wall bound proteins; Em, erythromycin;
pre-OmpA, OmpA precursor protein; Sip, signal peptidase protein;
SPase I, signal peptidase I (leader peptidase I); TS, temperature
sensitivity; IPTG, isopropyl thio-b-
D
-galactoside.
De®nitions:SipS(ba), SipS(bj), SipT(ba), SipV(ba) and SipW(ba)are
the products of the sipS(ba), sipS(bj), sipT(ba), sipV(ba),and
taxon [26,27]. Although strains of B. amyloliquefaciens are
among the most p otent producers o f i ndustrial enzymes
[28], little is known a bout physiological and g enetic
peculiarities [29]. In previous studies, two SipS-like signal
peptidases SipS1(ba) and SipS2(ba)ofB. amyloliquefaciens
were described [30] and later shown to have the highest
sequence similarity to SipS or SipT of B. subtilis,respect-
ively [31]. These ®ndings indicated sequence, as well as
mapping speci®city, of type I-SPase homologous of Bacillus
species [4,14]. The aim of this study was to isolate additional
Sip-like genes in B. amyloliquefaciens, and to evaluate
differences in functions after genetic complementation
in an E. coli LepBts mutant and a fter construction of
B. amyloliquefaciens sip(ba) gene disruption mutants.
MATERIALS AND METHODS
Strains and culture conditions
Table 1 lists the strains and plasmids used. Bacteria were
usually grown in trypton/yeast extract TBY broth or on
TBY-agar [32], Spizizen minimal medium (SMM) [33] or
Schaeffer's sporulation medium (SSM) [34], respectively.
Isopropyl thio-b-
D
-galactoside (IPTG, 1 m
M
) was added to
cultures. For antibiotica selection, Bacillus cultures were
supplemented with erythromycin (Em, 1 gáL
)1
) and/or with
chloramphenicol (Cm, 5 gáL
22
Bacillus subtilis GSB26 arol906 metB6 sacA321 str6 amyE 32
Bacillus amyloliquefaciens
GBA12 ALKO2718; DnprE, DaprE 53
GBA13 GBA12, but sipS::pEAS*
a
This study
GBA14 GBA12, but sipT::pEAT* This study
GBA15 GBA12, but sipV::pEAV* This study
GBA16 GBA12, but sipW::pEAW* This study
Plasmids
pUC18 Ap
r
Stratagene
pQE16 Ap
r
QIAGEN
pE194 Em
r
, temperature- sensitive (TS) 41
integration plasmid
pDG148 Km
r
,Pm
r
,Ap
r
,Pspac, lacI 40
pEAS*, pEAT*, pEAV*, pEAW* pE194, Em
r
phoresis were carried out essentially as described by
Sambrook et al. [36] and Ausubel et al. [35]. DNA
fragments were prepared from agarose gels using the
QIAEX gel elution kit (Qiagen). E. coli was transformed
with competence treatment [36]. B. subtilis was transformed
either after competence treatment [33] or protoplast f orma-
tion [37]. Th e latter method was also used to transform
B. amyloliquefaciens, except that prior to transformation,
the DNA was occasionally treated with BamHI methylase.
Alternatively, plasmid DNA was transformed into
B. amyloliquefaciens by electroporation [38].
DNA sequencing and sequence analysis
DNA sequencing was performed by an automated system
(A.L.F. express, Pharmacia), u sing the r ecommended
primers for the pGEM-T and pUC18 vector, w ith t he
AutoRead sequencing kit (Pharmacia). Sequence analysis
was performed with the
PC
/
GENE
software from Intelli-
Genetics, Inc. (Mountain View, Calif.) and
DNA-STAR
software from Lasergene Inc. (Madison, WI, USA).
The
BLAST
software (National Center for Biotech nology
Information, Bethesda, MD, USA) was used for online
database scanning. Phenetic and cladistic analyses of the
amino-acid alignment were performed in
were isolated from initial cloning vectors and cloned into
the vector pQE16 in frame with the His-tag-encoding
sequence. The lepB gene was PCR ampli®ed from E. coli
DNA using the primers Lep1 and Lep2 (Table 2), and then
cloned into the pQE16 vector. A fter restriction e nzyme
digestion of p QE derivated plasmids (pQSh, pQTh, p QVh,
pQWh, pQBh), the His-tagged genes (sipSh, sipTh, sipVh,
sipWh, and lepBh) w ere isolated and each cassette was
cloned into t he pOpac vector to obtain t he OmpA-Sip/Lep
expression plasmids (pOpacSh, pOpacTh, pOpacVh, pOp-
acWh, and pOpacBh). The integrative plasmids pEAS*,
pEAT*, pEAV* and pEAW* used for construction of the
B. amyloliquefaciens sip gene disruption mutants were
formed as follow s: a c ore DNA fragment c overing an
internal portion of the r espective sip gene was ampli®ed
using chromosomal DNA of B. amyloliquefaciens and the
respective gene-speci®c, i nternal primers (Table 2). These
PCR fragments were cloned i nto the pUC18 vector and the
resulting pUC18- sip construct ligated into the PstIsiteof
the temperature sensitive (TS) p lasmid pE194. After the
transformation of ALKO2718 cells with one respective
integrative plasmid (see above), integration mutants were
isolated by Em selection a t 42 °C [41]. S everal Em and h eat
resistant colonies of each mutant progeny were isolated
andtestedforintegrationofthesip::pE* cassette a fter PCR
ampli®cation. The construction scheme of mutant strains
GBA13 (sipS::pEAS*), GBA14 (sipT::pEAT*), GBA15
(sipV:: pEAV*) and GBA16 (sipW::pEAW*) is shown in
Fig. 4.
Pulse-chase protein labelling, immunoprecipitation,
37 °C and agitation at 200 r.p.m. [43].
Cell-wall-bound protein (CWBP) extraction, and autolysin
detection after SDS/PAGE
Cell wall substrate was isolated from exponential growing
B. amyloliquefaciens cells according to Harwood et al.[44].
The CWBP extract was prepared from vegetative B. amy-
loliquefaciens cells according to Blackman et al. [43], exce pt
that cells were desintegrated by ultrasonication. Autolysin
activities were performed after SDS/PAGE, and enzymo-
graphy was assayed after renaturation of gels as described
by Foster [45] using B. amyloliquefaciens vegetative cell wall
as the substrate.
460 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
DNase detection after SDS/PAGE
Supernatant proteins of respective cultures were trichloro-
acetic acid-precipitated, collected, washed and sep arated by
12% SDS/PAGE containing calf thymus DNA (10 mgáL
)1
)
according to t he method described by Rosenthal & Lacks
[46].
Electron microscopy
For the primary ®xation, cells of B. amyloliquefaciens were
kept for 1 h at room temperature in 50 m
M
cacodylate
buffer ( pH 7.2), containing 0.5% (v/v) glutaraldehyde and
2.0% (v/v) formaldehyde. After washing, the samples were
subjucted to a secondary ®xation [1 h in a solution of 1 .0%
(w/v) OsO
sequence of the ampli®ed DNA fragment revealed the
presence of three ORFs, the deduced proteins having 70, 77,
and 67% identity to proteins encoded by the yhjE-sipV-yhjG
Table 2. Oligonucleotide primers used for P CR.
Name 5¢®3¢ Sequence
a
Description
CH1 CAYTTYGGNGCNGGNAAYATNGG Cloning of sipU
CH2 CAYGGNWSNGCNCCNGAYATNGCNGG Cloning of sipU
CH5 ATGATHGCNGCNYTNATHTTYACNAT Cloning of sipU
CH6 TTYTAYAARCCNTTYYTNATHGARGG Cloning of sipU
CH7 TCYTCNSWNGGCATNCCCATNCCRTT Cloning of sipU
CH8 TTNGCYTGNCKCATYTCNCCRAANGG Cloning of sipU
HV11 TTRTCNCCCATNACRAARTA Cloning of sipU
U1 TTGAAYGCNAARACNATHACNYTNAARAA Cloning of sipU
V1 TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipV
V2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipV
V3 TCNGCRTCNSWNATNACNCCNACNAT Cloning of sipV
V4 GCCAAAACAACGATAAGCACGCC Cloning of sipV
V5 GGATTCATGCTGATTCCTTCGAC Cloning of sipV
V6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipV
V7 ATTTCGTGATTGGCGACAACCGC Cloning of sipV
V8 GAGAATTCCGGAGGGGGACAGGAATCTTG Construction of pOpacVh
V9 GCAGATCTCTTGGCGTATGATTCACTGAT Construction of pOpacVh
W1 GGNWSNATGGARCCNGARTTYAAYACNGG Cloning of sipW
W2 TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipW
W7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipW
W8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipW
W9 GGCGATGTCATCACTTTTACACAA Cloning of sipW
W10 AACACACAGAATAATCGGGATCAC Cloning of sipW
genomic DNA from B. subtilis 168 or B. amyloliquefac-
iens. Although the former template always resulted in the
generation of a DNA fragment of the expected size, no
ampli®cation products were obtained with B. a mylolique-
faciens DNA (data not shown). In extension, the forward
primers CH1 and C H2 were designed for conserved
regions HFGAGNIG and HGSAPDIAG of the genes
mtlD and ycsA, which map in B. subtilis upstream of the
searched sipU, and used in combination with reverse
primers HV11, CH7 and CH8. Speci®c ampli®cation
Fig. 1. Identi®cation of the sipV(ba) and sipW(ba) gene regions of B. amyloliquefaciens. (A1/B1) PCR reactions with genomic DNA of B. amy-
loliquefaciens and the degenerative primers V1/V3 and V2/V3 or W1 and W2, led to the isolation of core DNA fragments of about 0.5 kb (lane b)
and 0.4 kb (lane c), or 0.2 kb, respectively. (A2/B2) The respective 0.5 o r 0.2 kb-DNA fragments were u sed as a p robe fo r South ern hybridization o f
either PstI(lanea)orEcoRI (lane b) digested c hromosomal DN A in c ase of sipV or Hin dIII (lane a) or EcoRI-SacI (lane b) digested genomic DNA
in case of sipW. Hybridization indicated DNA fragments of about 2.5 and 1.6 kb or 0.8 and 1.2 k b, respectively. Each digest indicated one speci®c
signal and suggested the existence of sipV or sipW like genes in B. amyloliquefaciens.(A3/B3)TheRAGEprotocol[30]wasusedforPCR
ampli®cation as follows: The DNA of B. amyloliquefaciens was cut with either PstIandEcoRI in case of sipV or EcoRI-SacIincaseofsipW and
ligated into corresponding sites of pUC18 DNA. The ligation mixes were used for PCR with oligo nucleotides Uni1 or Uni2 and pairs of primers
V6/V7 a nd V4/V5 or W 9/W10 and W11/W12 (T able 2) for fo rward or reverse react ions, respectively. The latter were chosen according the
indicated regions within the 0.5 kb- or 0.2 kb-PCR fragments from step A1 or step B1. The PCR fragments were cloned and sequenced. Ultimate
PCR led to fragments covering 1.2 or 1.3 kb of DNA, respectively. The nucleotide sequence was submitted t o GenBank and given the accession
number AF085497 or AF084950, re spectively. The detected open reading f rames are indicated.
462 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
products were obtained with DNA of B. subtilis, but not
with DNA of B. amyloliquefaciens (data not shown).
Southern hybridization e xperiments with a 0.4-kb DNA
fragment for a sipU-speci®c probe, that had been PCR
ampli®ed with primers CH5 and CH7 from B. subtilis
DNA (Table 2) were carried out with B. subtilis as well as
B. amyloliquefaciens genomic DNA. Even at low strin-
were used in repeated experiment s. (B) Processing of p re-OmpA in
E. coli IT41 was a nalysed after pulse-chase labelling, immunoprecipi-
tation, SDS/PAGE and ¯uorography. Samples were withdrawn at the
intervals indicated. p, precursor; m, mature protein. (a), IT41/pOpac;
(b),IT41/pTK100;(c),pOpacSh;(d),pOpacTh;(e),pOpacVhor(f),
pOpacWh, respectively. (C) Expression of His-tagged Bacillus SipS(ba)
proteins in E. coli IT41 was detected by Western blotting. L anes 1/2,
3/4, 5/6 a nd 7/8 refer to His-tagged Sip(ba) protein detection in cells
with SipS(ba), SipT(ba), SipV(ba)orSipW(ba) expression either grown
without or with the a ddition of IPTG a t 30 °C.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 463
proteins encoded by yqxM-sipW-tasA genes of B. subtilis,
respectively (Fig. 1,B3). This map position also indicated
the B. amyloliquefaciens sipW(ba) gene to be similar to
sipW(bs) of B. subtilis [12].
Abundance of sipW-encoding DNA in diverse
Bacillus
groups
After successful application of primers W1 and W2 for PCR
ampli®cation of a sipW gene homologue from B. amyloliq-
uefaciens (Fig. 1B), the same strategy was a pplied to search
for the abundance of similar genes in other, distantly related
Bacillus species. Genomic DNA of several species, including
at least on e strain of each Bacillus 16S rRNA-phylogentic
group [26,48], was used to carry out the above mentioned
PCR approach. T he abundance of the sipW-like genes was
indeed con®rmed for distantly related Bacillus species, b ut
not found in DNA of B. stearothermophilus and Thermo-
actinomyces vulgaris ( Fig. 2 ). The latter might have been
overlooked due to primer speci®city.
respective transformants con® rmed by immunodetection
using His-tag antibodies (Fig. 3). Without IPTG induction,
IT41 transformants with expression of LepB, SipS(ba), or
SipS(bj)ofB. japonicum revealed growth at 42 °C, but not
with SipT(ba), SipV(ba)orSipW(ba) (Fig. 3). Moreover, all
Sip(ba) e xpressing IT41 cultures, grow signi®cantly slowed
after IPTG addition indicating overexpression lethality
(data not shown). Processing of pre-OmpA was thus studied
without IPTG induction at the non permissive temperature
and found in SipS(ba) and SipT(ba) expressing IT41
cultures, but not with SipV(ba)orSipW(ba) expression
(Fig. 3).
Sip disruption mutants
In order to s tudy the phenotype of sipS(ba), sip T(ba),
sipV(ba) and sipW(ba) mutants, B. amyloliquefaciens
strains GB13, GBA14, GBA15 and GBA16 were grown
and tested under certain conditions. Inspecting the
changed characters o f the mutants, it should be s tressed
that secondary mutant allels (see Material and methods),
translation of front portions of each sip gene as well as
promoter activities on downstream genes from the large
DNA i nsert (Fig. 4), are unlikely but ®nally not
excluded.
Growth and protein secretion
The growth of sip(ba) mutants was compared at either 37 or
45 °C in TBY and SMM medium. Under each condition,
the sipV(ba) mutant exhibited s lower growth rate, com-
pared to the wild type and other sip(ba) mutant strain (data
not shown). The yields of protein s ecreted after 24 h of
growth in TBY medium as well as the protein changed
mutant cultures. These experiments were several times
repeated. This distinct gene d isruption was always found to
correlate with low s pore frequencies and cell lysis of SSM
cultures after 8 h of growth ( data not shown). The few
sporulating cells from sipT(ba) mutant cultures in this
incubation period exhibited the structure of stage III
forespores and e xhibited obvious abnormalities in either
coat or cortex structures (Fig. 5). The progeny from SMM
cultures without antibiotica selection, was Em sensitive to
about 80%, and exhibited restored spore frequencies (data
not shown). This correlation underlined sipT(ba) gene
disruption to correlate with spore formation de®cien cy.
Autolysis and cell motility
Microscopical inspection of stationary cultures indicated
cells of the sipV(ba) mutant to grow in TBY as ®laments,
while c ultures of the wild-type and other mutants grow as
rod shaped cells. This observation indicated a de®ciency in
either cell division or cell wall formation. We therefore
compared the mutants for cell autolysis, cell m otility as w ell
as autolysin activities of puri®ed CWBP fractions by
SDS/PAGE. After the addition of sodium azide (0.05
M
)
cultures of the sipV(ba) mutant were exceptionally less
affected by autolysis, compared to wild-type and the other
sip(ba) mutants ( Fig. 6). As changed cell autolysis was
expected to correlate with changed cell motility [43], the halo
diameter of colonies of wild type and m utant cultures was
compared after plating on soft agar and growth at 25 or
37 °C. The sipV(ba) mutant colonies in the average had
600
0.5±0.6). Cell
lysis was followed spectrophotometrically at 600 nm (d) wild type
GBA12; (s), sipS(ba) mutant GBA13; (.), sipT(ba) GBA14; (,),
sipV(ba) mutant GBA 15; (j) sipW(ba) mutant GBA16. (B) SDS/
PAGE separation of the CWBP fraction of B. amyloliquefaciens
GBA12 and sipV(ba) mutant G BA15 (a) and enzymography of
autolysin activities a fter renaturing SDS/PAGE of gels containing
puri®ed B. amyloliquefaciens cell wall material as substrate (b). Sample
preparation is described in Methods and renaturation of the SDS/
PAGE gel was according to Foster [45]. Lane 1, GBA15; lane 2,
GBA12. The arrows indic ate protein bands reduced or lacking in the
mutant. The labels a
1
and a
2
point to autolysins w hich are most sig-
ni®cantly aected. The data are from one representative experiment
after three tim es of r epetition.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 465
the area of 30 kDa-proteins of supernatant fractions of wild
type and several sip(ba) mutant cultures. T his nuclease
activities were strongly reduced in the sipT(ba), about nearly
lacking in the supernatant of sipS(ba)mutantcultures
(Fig. 7). In spite of numerous attempts to purify that
suspected nuclease, likely due to low protein concentration,
it could not be isolated from wild type cultures. Conse-
quently, the identity of the suspected nuclease activity, even
of its export protein character has not been veri®ed.
DISCUSSION
previously proposed [13], but also the clustering of P-type
Sip proteins into at least three subgroups represented by
B. subtilis SipV-, SipS,T,U- and B. anthracis Sip3,5-like
SPases, respectively. This analysis showed close relationship
between Sip proteins of B. amyloliquefaciens and B. subtilis
as well as their relatedness to other SPases, where the Sip-
isoforms of these t wo Bacillus species. Basically these data
are similar to those of van Roosmalen et al.[15],where15
different SPases w ere included and the authors claimed the
distinction between major and minor SPases upon similar
phylogenetic analyses. According to our data, which include
additional SPases from B. halodurans, as well as from
B. anthracis, the given criteria for major a nd minor SPases
might differ from one species t o another. For instance,
SipV(Bha)ofB. halodurans, apparently plays the role of a
major SPase, but according t o its phylogenetic character
would not belong to the group of major SPases.
With respect to their group character of Sip isoforms, it
was a sked, whether SPases of one group genetically
complement each other more likely, than SPases from
another group. Each of the four Sip(ba) proteins was in a
LepBts mutant of E. co li tested for its ef®ciency to restore
de®ciencies of LepB, i.e. the complementation of the mutant
TS phenotype as well as pre-OmpA processing. Only
SipS(ba) and SipT(ba) were active in processing pre-OmpA,
while SipV(ba) and SipW(ba) failed. The lack of processing
activities of the latter correlates with enhanced degradation,
as indicated by degradation products of the SipV(ba)aswell
as SipW( ba)proteinfromE. coli after i mmunodetection
(Fig. 3). These observation could re¯ect inactivation by self-
). The gel was renatured and
stained with ethidium bromide. The bright areas indicate zones of
DNA hydrolysis.
466 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
speci®c protein sorting [13,24,25]. Inactivation of either SipS
or SipT in B. subtilis just decreased the total yields of export
proteins compared to the wild type, a s it w as also found in
B. amyloliquefaciens to 30% (data not shown). A ll of the
B. amyloliquefaciens Sip(ba) disruption mutants were via-
ble, but some had impaired growth, sporulation and cell
division properties. Strict correlation of a distinct mutant
phenotype with that distinct sip gene disruption, as well as
restoration of the mutant phenotype after spontaneous
excision of the insertion cassette from B. amyloliquefaciens
mutants, strongly indicated gene disruption to c orrelate
with the distinct mutant de®ciencies, which were preliminary
analysed.
Disruption of sipT(ba) in B. amyloliquefaciens correlated
with a drastic reduction of sporulation and rare forespores
stalled in stage III development with apparently changed
cortex or coat structures [45]. Similar, sporulation de®ciency
of B. subtilis sipT-sipV doub le-deletion mutants have been
reported [51]. These two ®ndings would suggest a distinct
role of those SPases in the processing and export of
sporulation-related proteins in both species.
The same might be true for export of a not yet de®ned
nuclease in B. amyloliquefaciens, which was most affected
by sipS(ba),andtoalesserextendalsobysipT(ba) gene
disruption. The respective nuclease of B. amyloliquefaciens
is appar ently not a homologue of the 1 2 kDa-B. subtilis
È
ller kindly provided plasmids pKT99
Fig. 8. Unrooted phe nogram of t he Neighbor±
Joining analysis of known Bacillus Sip proteins
including Saccharomyces cerevisiae Sec11_Sce
(NP012288). The Bacillus Sip proteins ana-
lysed are: B. amyloliquefaciens SipS_Bam
(P41026), SipT_Bam (P41025), SipV_Bam
(AAF02219), SipW_Bam (A AF02220);
B. subtilis SipS_Bsu (P28 628), SipT_Bsu
(G69707), SipU_Bsu (I39890), SipV_Bsu
(A69708), SipW_Bsu (B69 708), pTA1015
(I40470), pTA1040 (I40552); B. halodurans
SipV_Bha (BAB04749), SipW_Bha
(BAB05849); B. licheniformis Sip_Bli
(CAA53272); B . caldolyticus Sip_Bca
(I40175); B. anthracis Sip1_Ban,Sip2_Ban,
Sip3_Ban,Sip4_Ban,Sip5_Ban,SipW_Ban;
B. stearothermophilus Sip1_Bst,Sip2_Bst
(preliminary sequence d ata from the website
). The l ength of e ach pair
of branches represents the d istance between
sequence pairs and bootstrap values are given.
The cluster of major SPases as d e®ned by
Roosmalen et al. [15] is circled.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 467
and pKT100 as well as valuable data about sipSgenesofB. japonicum.
Roland Freudl kindly provided the anti-OmpA- antibodies. We are
indebted to Adam Driks for helpful c omments about forespore
structures as well as Frank Blattner's professional h elp with phylogentic
8.vanVoorst,F.&DeKruij,B.(2000)Roleoflipidsinthe
translocation o f proteins across m embranes. Biochem. J. 347,
601±612.
9. Wu, L.F., Chanal, A. & Rodrigue, A. (2000) Membrane targeting
and translocation of bacterial hydrogenases. Arch. Microbiol. 173,
319±324.
10. Dalbey, R.E., Lively, M.O., Bron, S. & van Dijl, J.M. (1997) The
chemistry and enzymology of the type I signal peptidases. Protein
Sci. 6, 1129±1138.
11. Paetzel, M., Dalbey, R.E. & Strynadka, N.C. (2000) The structure
and mechanism of bacterial type I signal peptidases. A novel
antibiotic target. Pharmacol. The r. 87, 27±49.
12. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G.,
Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A ., Borchert, S.
et al. (1997) The complete genome sequence of the Gram-positive
bacterium Bacillus subtilis. Nature 390, 249±256.
13. Tjals ma, H., Bolhuis, A., van Roosmalen, M.L., Wiegert, T.,
Schumann, W., Broekhuizen, C.P., Quax, W., Venema, G., Bron,
S. & van Dijl, J.M. (1998) Functional analysis of the secretory
precursor p rocessin g machinery of Bacillus subtilis: i denti®cation
of an eubacterial homolog of archaeal and eukaryotic signal
peptidases. Genes Dev. 12 , 2318±2331.
14. Tjalsma,H.,Noback,M.A.,Bron,S.,Venema,G.,Yamane,K.&
van Dijl, J.M. (1997) Bacillus subtilis contains four closely related
type I signal peptidases with overlapping substrate speci®cities:
constitutive and temporally controlled expression of dierent
genes. J. Biol. Chem. 272, 25983±25992.
15. van Roosmalen, M.L., Jongbloed, J.D.H., Dubois, J Y.F.,
Venema, G ., Bron, S. & van Dijl, J.M. (2001) Distinction
betweenmajorandminorBacillus signal peptidases based on
22. Inada, T., Court, D .L., Ito, K. & Nakamura, Y. (1989) Condi-
tionally lethal amber mutations in the leader peptidase gene of
Escherichia coli. J. Bacteriol. 171, 585±587.
23. Tjalsma, H., van den Dolder, J., Meijer, J.J., Venema, G., Bron, S.
& van Dijl, J.M. (1999) The plasmid-encoded signal peptidase
SipP can functionally replace the major signal peptidase SipS and
SipT of Bacillus s ubtilis. J. Bacteriol. 181, 2448±2454.
24. Serrano, M., Zilhao, R., Ricca, E., Ozin, A.J., Moran Jr, C .P. &
Henriques, A.O. (1999) A Bacillus subtilis secreted protein with a
role in endospore coat assembly an d function. J. Ba ct eriol. 181,
3632±3643.
25. Sto
È
ver, A.G. & Driks, A . ( 1999) Secretion, localization, and
antibacterial activity of TasA, a Bacillus subtilis spore-associated
protein. J. Bacteriol. 181, 1664±1672.
26. Priest, F.G. (1993) Systematic and ecology of Bacillus.InBacillus
subtilis and Other G ram-Positive Bacteria (Sonenshein, A .L.,
Hoch, J.A. & Losick, R., eds), pp. 3±16. American Society for
Microbiology, Washington, DC.
27. Stackebrandt, E., Ludwig, W., Weizenegger, M., Dorn, S.,
McGill, T., Fox, G.E., Woese, C.R., Schubert, W. & Schleifer,
K H. (1987) Comparative 16S rRNA oligonucleotide analyses
and m urein t ypes of round-spore-fo rming bacilli and non -spore-
forming relatives. J. Gen e ral Microbiol. 133, 2523±2529.
28. Debabov, V.G. (1982) The industrial use of bacilli. In Th e
Molecular Biology of the Bacilli (Dubnau, D.A., ed.), pp. 331±370.
Academic Press, Boston.
29. Bron, S., Meima, R., van Dijl, J.M., Wipat, A. & Harwood, C.
(1999) Molecular biology and genetics of Bacillus spp. In Manual
Press, Cold Spring Harbor, New York.
37. Chang, S. & Cohen, S.N. (1979) High frequency transformation of
Bacillus subtilis protoplasts by plasmid DNA. Mol. Gen. Genet.
168, 111±115.
38. V eh maa nper a
È
, J. (1989) Transformation of Bacillus amylo-
liquefaciens by electroporation. FEMS Microbiol. Lett. 61, 165±
170.
39. Swoord, D.L. (2001) PAUP*. Phylogenetic Analysis Using Par-
simony (*and Other Methods), Version 4. Sinauer Associates,
Sunderland, Massachusetts.
40. Stragier, P., Bonamy, C. & Karmazyn-Campelli, C. (1988) Pro-
cessing of a sporulation sigma factor in Bacillus subtilis:How
morphological structure could control gene expression. Cell 52 ,
697±704.
41. Hofemeister, J., Israelis-Reches, M. & Dubnau, D. (1983) Inte-
gration of plasmid pE194 at multiple sites on the Bacillus subtilis
chromosome. Mol. Gen. Genet. 189, 58±68.
42. Edens, L., Heslinga, L., Klok, R., Ledeboer, A.M., Maat, J.,
Toonen,M.Y.,Visser,C.&Verrips,T.(1982)CloningofcDNA
encoding the sweet-tasting plant protein thaumatin and its
expression in Escherichia coli. Gene 18 , 1±12.
43. Blackman,S.A.,Smith,T.J.&Foster,S.J.(1998)Theroleof
autolysins during vegetative growth of Bacillus subtilis 168.
Microbiology 144, 73±82.
44. Harwood, C.R., Coxon, R.D. & Hancock, I.C. ( 1990) The
Bacillus cell envelope and secretion. In: Molecular Biological
Methods for Bacillus (Harwood, C.R. & Cutting, S.M., eds),
p. 374. John Wiley & S ons Ltd, New York.
, J., Steinborn, G. & Hofemeister, J. (1991) Genetic
manipulation of Bacillus amyloliquefaciens. J. Biotechnol. 19,
221±240.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 469