CK2btes gene encodes a testis-specific isoform of the regulatory
subunit of casein kinase 2 in
Drosophila melanogaster
Alla I. Kalmykova
1
, Yuri Y. Shevelyov
1
, Oksana O. Polesskaya
1,
*, Anna A. Dobritsa
1,
†,
Alexandra G. Evstafieva
2
, Brigitte Boldyreff
3
, Olaf-Georg Issinger
3
and Vladimir A. Gvozdev
1
1
Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, Russia;
2
Belozersky Institute of Physico-Chemical Biology,
Center of Molecular Medicine, Moscow State University, Russia;
3
Department of Biochemistry and Molecular Biology,
University of Southern Denmark, Odense, Denmark
An earlier described CK2btes gene of Drosophila melano-
gaster is shown to encode a male germline specific isoform of
regulator y b subunit of casein kinase 2. Western-analysis

transduction, development and proliferation [1–4]. More
than 160 different proteins serve as substrates for CK2.
Phosphorylation b y CK2 has been found to affect activity
of such Drosophila proteins pivotal for realization of early
developmental program, a s Cut-homeodeomain protein,
Cactus and Antennapedia [5–7]. A CK2 holoenzyme
consists of two a-(ora¢-) and two b subunits. The a subu nit
of CK2 possesses catalytic activity and the regula tory
b subunit was shown to enhance stability of the holoenzyme,
activate CK2a and provide substrate specificity and CK2
targeting in c ells. In spite of CK2b being ubiquitously
represented among eukaryotes, it is far less conserved in
comparison with the catalytic CK2a. This fact might be
explained by a wide spectrum of substrates and partner
proteins interacting with CK2b as a regulatory subunit.
Moreover, other functions, besides being a part o f the CK2
holoenzyme, can be ascribed to the b subunit. For e xample,
it has been demonstrated that the CK2 b subunit is involved
in the regulation of catalytic activity of two other protein
kinases (A-raf a nd Mos kinases [8–10]). The conclusion that
CK2b has a more general functions is supported by the fact
that significant imbalance of its amount in respect to
a subunit is found in tumor cells and some mammalian
tissues such as testicles [11, 12].
Recently it was shown that the CK2 activity as well as the
CK2 protein level are mostly elevated in rat and mouse
testicles [12, 13]. An important role for the CK2 activity in
spermatogenesis was clearly shown by a Ôknock-ou tÕ of the
CK2a¢ gene in mice resulting in a male sterile phenotype
[14]. Spermatogenesis is a complex differentiation process

(Received 25 September 2001, revised 7 De cember 2001, accepted 14
January 2002)
Eur. J. Biochem. 269, 1418–1427 (2002) Ó FEBS 2002
CK2a was used as a bait [20]. In this work we present
compelling evide nce that the CK2btes protein serves as a
tissue-specific isoform of the CK2 regulatory subunit in
Drosophila male germline.
EXPERIMENTAL PROCEDURES
Plasmid constructions
PCRs were performed according to the recommendations
of the manufacturer using GeneAmp XL PCR Kit (Perkin
Elmer, Branchburg, NJ, USA) containing high fidelity
mixture of DNA-polymerases.
CK2btes and CK2a expression constructs: An  850 bp
BamHI–SalI fragment of the CK2btes cDNA #112 (this
cDNA sequence, cloned in the pBlueScript SK- vector,
contains no poly(A) tail and corresponds to nucleotides 72–
840 of the SSL (CK2btes) cDNA #911 sequence deposited
in GeneBank under accession number L42285, see also [18])
was s ubcloned in the pQE 30 expression vector (Stratagene,
La Jolla, CA, USA). The recombinant protein with the
N-terminal His
6
-tag comprises the whole CK2btes ORF
except for the 11 amino acids at the N-terminus.
A 1011-bp fragment of D. melanogaster CK2a gene
comprising the whole ORF region was PCR-amplified from
Drosophila genomic DNA using the f ollowing pair of
primers: 5¢-CAGGATCCATGACACTTCCTAGTGCG
GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT

inhibitor (Gibco BRL, Life Technologies, CA, USA).
Constructs for P-element transformation
To make the CK2btes–b-galactosidase fusion construct, a
934-bp fragment of the CK2btes gene including the 161 bp
of promoter region linked to the whole ORF was PCR-
amplified from the DNA of the cosmid clone #9 [18] using
the following pair of primers: 5¢-GACTGCAGTGAAGG
GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG
GACATTCCTTAGCCAGGAGGG-3¢.Tomakethe
b-galactosidase expressing construct, a 173-bp PCR frag-
ment of the CK2btes gene including the 161 bp of promoter
region joined with the first 12 bp of the ORF region was
amplified from the DNA of the c osmid clone #9 using the
same direct primer as for the CK2btes–b-galactosidase
fusion construct and the following reverse primer:
5¢-CTGGATCCGGACACGACATGCTCACTCGAA
TAA-3¢.BothPstI–BamHI digested PCR fragments were
clonedinframe,withtheb-galactosidase ORF devoid of the
ATG, into the pCaSpeR-bgal vector [22].
To genera te the CK2btes ÔantisenseÕ co nstruct, the XhoI
fragment of the CK2btes cDNA #421 corresponding to the
12–700 bp region of the sequence of cDNA #911 (one XhoI
site in the cDNA #421 is located in the MCS of BlueScript
SK- vector, and another XhoI site is located in the adaptor
sequence at the opposite side of insert) was cloned into the
modified testis vector kindly provided by H.D. Hoyle
(University of Indiana, Bloomingto n, IN, USA) [23]. This
vector carries the regulatory region of t he b2-tubulin gene
driving testis-specific expression of any gene substituting the
b2-tubulin ORF. The regulatory region had been cloned

To prepare CK2b AD- and BD- constructs, the whole
CK2b ORF region was amplified from the pEV55Dmb
plasmid DNA (kindly provided by C.V.C. Glover (Uni-
versity of Georgia, Athens, GA, USA), it contains a full size
cDNA of D. melanogaster b subunit [24]) using the follow-
ing p air o f p rimers: 5¢-CAGGATCCCTATGAGCAGC
TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA
GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT
GC-3¢. BamHI–SalI digested PCR fragment was cloned
into BamHI–SalI digested pAS2-1 vector, or into BamHI–
XhoI digested pACT2 vector.
Protein purification, generation of antibodies
Expression and purification of recombinant p roteins from
E. coli using Ni
2+
/nitrilotriacetic acid resin (Qiagen Inc.,
Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1419
CA, USA) were performed according to the Stratagene
protocols. Drosophila CK2a and CK2btes recombinant
proteins purified under n ondenaturing conditions were used
in the in vitro assays (measurement of CK2a activity, gel
filtration experiments). Human CK2a and Drosophila
CK2btes proteins p urified from E. coli inclusion bodies
under denaturing conditions were used for the g eneration of
antibodies in rabbits. The specificities of isolated antisera
were tested by Western analysis.
RNA isolation and Northern-analysis
Total R NA was isolated by guanidinium thiocyanate
extraction [25] from embryos, pupae, larvae, females, male
carcasses and testes of gt w

M
peptide) containing different N aCl concentrations (from
0m
M
to 200 m
M
)at37°C for 5 min The reaction aliquots
were loaded onto P81 phosphocellulose paper, washed with
85 m
M
phosphoric acid, and incorporated radioactivity was
measured by the liquid scintillation counter.
For the phosphorylation of calmodulin (kindly provided
by N. B. Gusev, Moscow State University) t he aliquots of
fractions after gel filtration assay containing  50 ng of
CK2a either alone or in combination w ith equimolar amount
of CK2btes protein were used. T he reaction was carried out
in 50 m
M
Tris/HCl, pH 8.0, 10 m
M
MgCl
2
, 150 m
M
NaCl,
20 l
M
ATP, 10 lCiÆmL
)1

2
O, 5.5 gÆL
)1
NaH
2
PO
4
ÆH
2
O, 0.75 gÆL
)1
KCl,
0.246 g L
)1
MgSO
4
· 7H
2
O), which contained 0.27 mL
2-mercaptoethanol and 1.67 mL 5-bromo-4-chloro-3-indo-
lyl b-galactopyranoside (X-gal; 20 mgÆmL
)1
in dimethyl-
formamide) per 100 mL. Incubation was performed at
30 °C for up to 12 h.
For the liquid assay 5 mL cultures with synthetic
medium were inoculated with single colonies cotransformed
with AD- and BD- c onstructs and were grown until
D
600

BD- constructs to grow on the medium without histidine
was used to verify protein–protein interactions.
Immunoprecipitation
A total of 100 hand-dissected pairs of testes were homo-
genized in the buffer containing 50 m
M
Tris/HCl, pH 8.0,
150 m
M
NaCl, 0.05% Nonidet P40, cocktail of protease
inhibitors. After 3 h of incubation at 4 °C followed by
15 min centrifugation at 4000 g, crude extract was fivefold
diluted with IP buffer (50 m
M
Tris/HCl, pH 8.0, 150 m
M
NaCl, 0.05% NP40, 5 m
M
EDTA, 0.2% BSA, 0.02%
NaN
3
, cocktail of protease inhibitors). Immunoprecipita-
tion was carried out over night at 4 °Cwith1lLofanti-
DmCK2a Ig, kindly provided by C.V.C. Glover. The
complex was precipitated by incubation with protein
A–Sepharose (4 Fast Flow, Pharmacia Biotech, Uppsala,
Sweden) for 1 h at 4 °C. Immunoprecipitate was washed
fourfold with 0.5 mL IP buffer and then fractionated on the
8% SDS/PAGE followed by Western analyses with poly-
clonal anti-( b-galactosidase) Ig (ICN Pharmaceuticals inc.,

mediated germline transformation technique [28] with
Df(1)w
67c23(2)
, y strain and the pTURBO transposase
source. Three transformant lines were established for the b-
galactosidase bearing construct, two lines for the CK2btes-
b-galactosidase fusion construct, and one line for the
ÔantisenseÕ CK2btes construct.
Histochemical staining of tissues
For the b-galactosidase staining, testes from adult
Drosophila males, as well as carcasses, were hand-dissected,
fixed in 2% glutaraldehyde in KCl/NaCl/P
i
buffer (8 m
M
Na
2
HPO
4
,137m
M
NaCl, 0 .5 m
M
MgCl
2
,1.6m
M
KH
2
PO

K
4
[Fe
III
(CN)
6
].
RESULTS
CK2btes protein is generated in
Drosophila
testes
at postmitotic stages of spermatogenesis
Previously we have revealed the CK2btes transcripts in
Drosophila testes only [18]. To detect the CK2btes protein
in testes, we raised rabbit polyclonal antibodies against a
recombinant CK2 btes protein purified from E. coli.These
antibodies recognize a protein with mobility of approxi-
mately 30 kDa in testes extract, but do not reveal any
specific signal in the corresponding region in the extracts
from males with removed testes and from ovaries
(Fig. 1A). The electrophoretic mobility of the recognized
protein in testes extract is slightly different from that
expected for the protein with the calculated molecular mass
of 25 kDa. The recombinant CK2btes protein purified
from E. coli during electrophoresis also runs slower than
expected. The retardation might be due to the peculiarities
of amino-acids content of the CK2btes protein. A similar
gel retardation was seen in case of ubiquitous Drosophila
CK2b when a 24.8-kDa protein runs as a 28-kDa one [24].
The generated antibodies are expected not to cross react

2
structure. The b subunit is catalyticaly inactive by i tself
but it specifically stimulates the phosphorylation activity of
CK2a 5- to 10-fold [1]. To test the CK2btes protein for i ts
ability to stimulate catalytic activity of CK2a, Drosophila
CK2btes and CK2a recombinant proteins were expressed
in E. coli. Proteins purified under nondenaturation condi-
tions were used for the CK2 activity assay. In the reac-
tion buffer without NaCl, the CK2btes protein 2.5-fold
Fig. 1. Expression of the CK2btes protein in test es. (A) Detectio n of
CK2btes protein in Drosophila tissues. Western analysis using poly-
clonal anti-CK2btes Ig: R, recombinant CK2btes protein purified
from E. coli; T, protein extract from 7 pairs of adult testes; C, protein
extract from three male carcasses with removed testes; O, protein
extract from seven pairs of ovaries. Molecular mass markers are shown
to the left. (B) Diagram of microinjected constructs. CK2btes region is
black, b-galactosidase region is gray. (C) X-gal staining (dark region)
of testes from a transgenic fly line carrying the CK2btes–b-galactosi-
dase fusion construct under the control of the CK2btes promoter
region. The arrow marks the tip of the testis, no b-galactosidase
staining of somatic tissues was observed (not shown).
Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1421
stimulates t he CK2a activity (Fig. 2). Recombinant human
b subunit at the same conditions activates Drosophila
CK2a twofold (not shown). While the CK2a activity is
practically independent of NaCl concentration in the
absence of CK2btes, it is increased 5.5 times under
physiological conditions (150 m
M
NaCl) in the presence

in vitro
To elucidate the structure of CK2a–CK2btes complexes in
vitro, recombinant CK2a and CK2btes proteins, purified
under native conditions, were analyzed separately, or in the
equimolar mixture, in gel-filtration experiments. Proteins
eluted from the column were detected by Western blot
analysis using anti-(CK2btes) Ig and polyclonal anti-
(human CK2a) Ig that a lso recognizes the Drosophila
CK2a. Figure 4 shows the results of Western analysis of
fractions 15–20 with a protein marker range from 158 kDa
(fraction 16, IgG) to 17 kDa (fraction 19, myoglobin). It is
seen that CK2btes protein is mainly eluted in the fraction 18
marked with ovalbumin possessing a molecular mass of
44 k Da. The appearance of CK2btesinthisfraction
indicates that most of t he protein molecules are associated
in the (CK2btes)
2
homodimers with a calculated molecular
mass of 50 kDa. When CK2a and CK2btes molecules were
mixed together before passing through the column each
type of subunits was mainly detected in the fraction 17
where protein complexes of a larger size (less than 1 58 k Da,
but more than 44 kDa) were eluted. This elution profile
most likely reflects the proposed (CK2a)
2
(CK2btes)
2
tetr-
amer structu re with the predicted molecular mass o f
130 kDa. The ability to dimerize and to fo rm heterotetra-

Samples were electrophoresed in 15% SDS/PAGE and autoradio-
graphed. The arrows indicate the position of calmodulin, which runs as
a doub let.
1422 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002
fusions with GAL4-activator (AD), or GAL4-binding (BD)
domains. Besides, the ubiquitous Drosophila CK2 b subunit
was cloned in both AD- and BD-vectors. To assay
interactions, different combination s of AD- and BD-
constructs were cotransformed into SFY526 and HF7c
yeast strains carrying lacZ or HIS3 reporter genes, respect-
ively, under the control of the GAL4-binding sites. When
protein interactions take place, the reporters proteins are
expressed and this expression can be monitored by X-gal
staining or the cell growth on medium without histidine.
The filter and liquid b-galactosidase assays, as well as the
growth on His
–
selection medium were carried out in order
to detect and quantify the strength of an interaction. The
results of these experiments are presented in Table 1. The
pronounced b-galactosidase activity in cells cotransformed
with CK2a(BD) and CK2btes(AD) constructs, as well as
the cell growth on the medium without histidine indicate
that CK2btes protein does interact with the CK2 a subunit
in yeast c ells. Moreover, the strength of such interaction is
nearly the same a s in the case of a/b CK2 interaction (124
vs. 156 Miller units, Table 1). We also observed the nearly
equal ability of different b subu nits to form dimers com-
posed of two b subunits, of two btes subunits and, of the
mixture of b/btes subunits. These interactions are weaker

high affinity anti-(b-galactosidase) Ig.
Anti-(b-galactosidase) Ig staining revealed single bands of
different mobility in testes extracts of transgenic flies (Fig. 5,
lanes 1, 3), corresponding to the b-galactosidase or the
CK2btes–b-galactosidase fusion protein, respectively. Lanes
Fig. 4. Analysis of oligomerization status of the CK2a and CK2btes
proteins by gel filtration. The CK2a and CK2btes proteins alone or in
the equimolar mixture were passed through the Pharmacia SMART
system chromatographic Superose 6 column and fractions were ana-
lysed by W estern blotting using anti-CK2a or anti-CK2btes Ig. Posi-
tions of the corresponding protein markers run in parallel are
designated by arrows.
Table 1. CK2 subunits interactions in two-hybrid system. The interactions were determined by growth on His
–
medium (activation of HIS reporter
gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424;
AD**, pACT2. Activity values are given as mean values ± standard deviation from two to four different experiments.
Type of interaction Filter b-galactosidase assay Growth on His
–
medium
b-Galactosidase activity
(Miller units)
CK2a(BD): CK2btes(AD**) Blue Yes 124 ± 12
CK2a(BD): CK2b(AD**) Blue Yes 156 ± 7
CK2a(BD): CK2a(AD) White Weak growth 0.05 ± 0.02
CK2a(BD): (AD**) White No 0.06 ± 0.02
CK2b(BD*): CK2btes(AD**) Blue Yes 3.1 ± 0.4
CK2b(BD*): CK2b(AD**) Blue Yes 2.1 ± 0.1
CK2b(BD*): (AD**) White No 0.05 ± 0.05
CK2btes(BD*): CK2btes(AD**) Blue Yes 1.8 ± 0.3

Drosophila.
DISCUSSION
Our previous studies [18, 19] have shown that the SSL gene,
later renamed CK2btes, is a candidate for being a testis-
specific regulatory subunit of CK2: CK2btes transcripts,
encoding a putative protein with 45% identity to CK2
b subunit, were revealed in Drosophila testes only. The
degree of sequence identity between Drosophila CK2btes
protein and b s ubunit was noticeably lower than among
b subunits from different organisms (chicken, mouse and
human sequences are 100% identical, Drosophila and
human sequences are 88% identical [16]), but still at the
same level as between S. cerevisiae b and b¢ subunits (45%,
[34]). Therefore, it was likely but not strikingly obvious that
CK2btes protein functions as a regulatory subunit of CK2
during Drosophila spermatogenesis. The data of this work
provide direct evidence that the CK2btes gene encodes a
male germline-specific protein possessing typical properties
of the b subunit of CK2. The CK2btes protein is able to
bind the CK2 a sub unit and to stimulate its phosphorylation
activity towards a synthetic peptide in the in vitro experi-
ments. Like the canonical b subunit [32, 33], the CK2btes
protein negatively regulates the CK2 catalytic a ctivity
toward calmodulin and this suppression is overcome by
polylysine. The CK2btes binding with a subunit occurs in
yeast cells as was shown by registration of strong CK2a–
CK2btes interaction in the two-hybrid system experiments.
The CK2btes p rotein forms homodimer molecules in vitro
and in vivo, in yeast cells. It is known [35] that the CK2b
dimerservesasaprecursoroftheformationoftheCK2

washed, separated by SDS/PAGE followed by Western analysis and
immunostaining with polyclonal anti-(b-galactosidase) Ig (lanes 2 and
4, resp ectively). T, testes extract; IP, immunoprecipitated complexes
bound to protein-A–Se pharose afte r washing. P ositions of CK2btes–
b-galactosidase or b-galactosidase alone are indicated to the right.
Fig. 6. Testis-specific transciption of CK2b¢ gene. Approximately equal
amounts of total RNA isolated from carcasses (male body remnants
after removal of testes), testes, embryos, larvae, pup ae an d fem ales
wereelectrophoresedin1%formaldehydegel,blottedtoHybond-N
membrane, an d hybridiz ed with either CK2b¢ probe (upper pane l) or
rp49 probe (lower panel). Hybridization signal with the CK2b¢ probe
was detected only in the testes RNA.
1424 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(residues 55–64), which is highly conservative among
b subunits from different organisms, is responsible for the
downregulation of catalytic activity of a subunit toward
calmodulin and for the activation by polybasic compounds.
The examination of amino-acid alignment in the acidic
region of three Drosophila CK2 regulatory subunits (Fig. 7)
reveals the lack of two charged residues (Glu57 and Asp60)
in the btes sequence, which might be responsible for less
pronounced CK2btes-mediated effects on the calmodulin
phosphorylation by an asubunit. The b¢ subunit has more
significantly reduced negative charge density in the acidic
region than btes subunit (Fig. 7), but it is still able both to
suppress calmodulin phosph orylation and mediate activa-
tion by polylysine and protamine [20]. Further structural
studies are required to unravel mechanism of this regula-
tion.
In the previous studies it was shown that Drosophila

suggestion showing that some b subunits are specialized for
a specific tissue. It seems likely that Drosophila CK2btes and
CK2 b¢ subunit genes were evolutionary adapted for
spermatogenesis.
As was shown earlier [12], quantity of the b subunit
reaches its maximum in the testicles of mammals, as
compared to other tissues. On the other hand, in Drosophila
the ubiquitous CK2 b subunit gene is poorly expressed in
testes [18]. Therefore, the supposed requirement of massive
b subunit production during spermatogenesis is resolved by
different ways in Drosophila and in mammals: while
mammals utilitize the upregulation of expression of a single
b subunit gene, the fruit fly has generated in evolution two
specialized genes f or this purpose.
Despite the accumulation of large amount of information
about it, CK2 remains an enigmatic enzyme. Its un-
doubtedly crucial role in signalling is based only on a
variety of indirect observations, rather than on clear
evidence of cause-and-effect relations. Xu et al.[14]have
shown that the CK2 activity was essential for the spermato-
genesis in mammals. The gene Ôknock-outÕ of the CK2
a¢ subunit in mice resulted in male sterility without any
other physiological defects. In S . cerevisiae , the deletions of
both CK2 a and a¢ subunit genes appeared to be lethal [40],
whereas, the disruption of CK2b,orCK2b¢, or both
resulted in no phenotype or morphology alterations except
the elevated sensitivity to salt concentration in the medium
[34]. Thus, the question concerning vital functions of the
CK2 b subunits in higher eukaryotes is still open.
We tried to address this issue on the model of spermato-

a subunit. These interactive partners are represented, for
example, by A-raf and Mo s kinases [8–10]. If this is the case
in Drosophila, the achieved decrease of the CK2btes p rotein
level in testes of transgenic males might be insufficient to
affect the CK2 activity, a s it could be compensated by the
initial m olar excess of total pool of b subunits over the CK2
a subunit. Taking into account the CK2btes ability to form
Fig. 7. Alignment of acidic region 55–64 in three Drosophila CK2
regulatory subunits. The GenBank accession numbers for t he se quen-
ces shown are the following: D. melanogaster CK2b (M16535),
D. melanogaster CK2b¢ (U51209), D. melanogaster CK2btes
(L49382). Dashes indicate gaps introduced to improve the alignment.
Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1425
heterodimers with other b subunits shown in ou r yeast two-
hybrid system experiments, it is reasonable to suppose a
possibility of a replacement of one b subunit by another i n
the case of a deficiency of any of the subunits, i.e. a so called
ÔbypassÕ mechanism may operate in order to maintain
appropriate levels and targeting of CK2 activity in testes. In
accordance with this hypothesis are our results showing that
two to fourfold downregulation of the CK2btes gene in
transgenic males does not lead to the noticeable decrease of
total CK2 activity in testes (not shown). Drosophila CK2b-
related genes expressed in testes undoubtedly require further
investigation a s a system for understanding how evolution
of structural properties i s responsible for subtle functional
differences between related genes.
ACKNOWLEDGEMENTS
We are grateful to Dr C.V.C. Glover for providing us with the
pEV55Dmß plasmid a nd the a nti-DmCK2a antiserum, and to Dr H .D.

8. Boldyreff, B. & Issinger, O G. (1997) A-Raf kinase is a new
interacting partner of protein kinase CK2 b subunit. FEBS Lett.
403, 197–199.
9. Hagemann,C.,Kalmes,A.,Wixler,V.,Wixler,L.,Schuster,T.,
Rapp, U.R. (1997) The regulatory subunit of protein kinase CK2
is a specific A-Raf activator. FEBS Lett. 403, 200–202.
10. Chen, M. & Cooper, J.A. (1997) The b-subunit of CKII negatively
regulates Xenopus oocyte matu ration. Proc. Natl Acad. Sci. USA
94, 9136–9140.
11. Lu
¨
scher, B. & Litchfield, D. (1994) Biosynthesis of casein kinase II
in lymphoid cell lines. Eur. J. Biochem. 220, 521–526.
12. Guerra, B., Siemer, S., Boldyreff, B., Issinger, O G. (1999) Protein
kinase CK2: evidence for a protein kinase CK2b subunit fraction,
devoid of the catalytic CK2a subunit, in mouse brain and testicles.
FEBS L ett. 462, 353–357.
13. Diaz-Nido, J., Mizuno, K., Nawa, H., Marshak, D.R. (1994)
Regulation of protein kinase CK2 isoform expression during rat
brain d evelopm ent. Cell. Mol. Biol. Res. 40, 581–585.
14. Xu, X., Toselli, P.A., R ussel, L.D., Seldin, D.C. (1999) Globo-
zoospermia in mice lacking the casein kinase II a catalytic subunit.
Nat. Genet. 23, 118–121.
15. Fuller, M.T. (1998) Genetic control of cell proliferation and dif-
ferentiation in Drosophila spermatogenesis. Semin. Cell. Devel.
Biol. 9, 433–444.
16. Reed, J.C., Bidwai, A.P., Glover, C.V.C. (1994) Cloning and
disruption of CKB2, the gene encodin g the 32-kDa regulatory
b-subun it of Saccharomyces cerevisiae casein kinase II. J. Biol.
Chem. 269, 18192–18200.

isolation by acid guanidinium th iocyanate- phenol-ch loroform
extraction. Anal. Biochem. 162, 156–159.
26. Sambrook, J., Fritsch, E.F., M aniatis, T. (1989) Molecular Clo-
ning. A Laboratory Manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York, USA.
27. O’Connel, P.O. & Rosbash, M. (1984) Sequence, structure and
codon preference of the Drosophila ribosomal protein 49 gene.
Nucleic Acids Res. 12, 5495–5513.
28. Spradling, A.C. (1986) P-element-mediated transformation. In
Drosophila, a Practical Approach (Roberts, D.B., ed.), 1 78–197.
IRL P re ss, Oxford, UK.
29. Michiels, F., Gasch, A., Kaltschmidt, B., Renkawitz-Pohl, R.
(1989) A 14 bp promoter element directs the testis specificity of the
Drosophila b2 tubulin gene. EMBO J. 8, 1559–1565.
30. Yang, J., Porte r, L., Rawls, J. (1995) Expression of the
dihydroorotate dehydrogenase gene, dhod, during spermato-
genesis i n Drosophila melanogaster. Mol. Gen. Genet. 246, 3 34–341.
31. Nurminsky, D.I., Nurminskaya, M.V., De Aguiar, D., Hartl, D.L.
(1998) Selective sweep of a newly evolved sperm-specific gene in
Drosophila. Nature 396, 572–575.
32. Bidwai, A.P., Reed, J.C., Glover, C.V. (1993) Phosphorylation
of calmodulin by the catalytic subunit of casein kinase II is
inhibited by the regulatory subunit. Arch. Biochem. Bioph ys. 300,
265–270.
1426 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002
33. Meggio, F., Boldyreff, B., Marin, O., Marchiori, F., Perich, J.W.,
Issinger, O G., Pinna, L.A. (1992) The effect of polylysine on
casein-kinase-2 activity is influenced by both the structure of the
protein/peptide substrates and the subunit composition of the
enzyme. Eur. J. Biochem. 205, 939–945.

41. Misquitta, L. & Paterson, B .M. (1999) Targeted disruption of gene
function in Drosophila by RNA interference (RNA-i): a role for
nautilus in embryonic somatic muscle formation. Proc. Natl Acad.
Sci. USA 96, 1451–1456.
42. Fortier, E. & Belote, J.M. (2000) Temperature-dependent gene
silencing by an expressed inverted repeat in Drosophila. Genesis 26,
240–244.
Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1427